Starting /dee2/code/volunteer_pipeline.sh SRR7169752 current disk space = 3050252812288 free memory = 1574815288 SRR7169752 SRAfilesize ad2a96b6813418741a2fe49292e2f3b4 SRR7169752.sra SRR7169752.sra file validated SRR7169752 is paired end SRR7169752 is conventional basespace SRR7169752 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169752_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.31325 18.0 18.0 25.0 18.0 32.0 2 28.0715 29.0 27.0 31.0 25.0 33.0 3 29.689 31.0 29.0 33.0 25.0 33.0 4 31.9095 33.0 31.0 33.0 29.0 33.0 5 32.49325 33.0 33.0 33.0 32.0 33.0 6 36.74575 38.0 37.0 38.0 35.0 38.0 7 37.3385 38.0 38.0 38.0 36.0 38.0 8 37.53125 38.0 38.0 38.0 37.0 38.0 9 37.61875 38.0 38.0 38.0 38.0 38.0 10-14 37.6545 38.0 38.0 38.0 38.0 38.0 15-19 37.67765000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.6904 38.0 38.0 38.0 38.0 38.0 25-29 37.681400000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.6072 38.0 38.0 38.0 38.0 38.0 35-39 37.4914 38.0 38.0 38.0 37.8 38.0 40-44 37.22625 38.0 38.0 38.0 36.6 38.0 45-49 37.45665 38.0 38.0 38.0 37.4 38.0 50-54 37.4988 38.0 38.0 38.0 37.6 38.0 55-59 37.466049999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.3866 38.0 38.0 38.0 37.0 38.0 65-69 37.341300000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.325900000000004 38.0 38.0 38.0 36.8 38.0 75-79 37.2659 38.0 38.0 38.0 36.6 38.0 80-84 37.192949999999996 38.0 38.0 38.0 36.0 38.0 85-89 37.06635000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.9342 38.0 38.0 38.0 35.8 38.0 95-99 36.96585 38.0 38.0 38.0 35.8 38.0 100-104 36.8903 38.0 38.0 38.0 35.2 38.0 105-109 36.66455 38.0 38.0 38.0 34.2 38.0 110-114 36.61344999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.437050000000006 38.0 37.8 38.0 34.0 38.0 120-124 36.275400000000005 38.0 37.4 38.0 33.8 38.0 125-129 36.09755 38.0 37.0 38.0 33.4 38.0 130-134 35.6723 38.0 36.2 38.0 31.8 38.0 135-139 35.534749999999995 38.0 36.0 38.0 31.0 38.0 140-144 35.195299999999996 38.0 35.4 38.0 29.6 38.0 145-149 34.673700000000004 38.0 35.0 38.0 28.0 38.0 150-151 30.97525 36.5 29.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 5.0 20 6.0 21 1.0 22 3.0 23 3.0 24 8.0 25 5.0 26 4.0 27 15.0 28 11.0 29 16.0 30 26.0 31 35.0 32 50.0 33 72.0 34 138.0 35 296.0 36 844.0 37 2459.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.22784810126582 16.354430379746834 9.443037974683545 39.974683544303794 2 20.525 15.425 34.4 29.65 3 20.9 19.975 25.525 33.6 4 24.125 27.750000000000004 21.725 26.400000000000002 5 21.65 33.725 24.45 20.175 6 19.025 35.6 24.75 20.625 7 15.049999999999999 26.450000000000003 40.825 17.675 8 16.325 26.75 31.724999999999998 25.2 9 17.849999999999998 24.125 34.425 23.599999999999998 10-14 19.805 30.255 26.825 23.115 15-19 19.77 28.62 27.63 23.98 20-24 19.82 29.085 28.095 23.0 25-29 20.015 29.575000000000003 26.995 23.415 30-34 19.48 29.470000000000002 27.755000000000003 23.294999999999998 35-39 19.73 28.79 27.944999999999997 23.535 40-44 20.36 28.73 27.52 23.39 45-49 20.169999999999998 28.64 27.905 23.285 50-54 20.13 29.505 27.36 23.005 55-59 20.015 29.244999999999997 27.250000000000004 23.49 60-64 20.29 28.825 27.315 23.57 65-69 20.169999999999998 29.2 27.339999999999996 23.29 70-74 20.27 29.535 26.21 23.985 75-79 19.695 29.57 27.355 23.380000000000003 80-84 19.645000000000003 29.244999999999997 27.295 23.815 85-89 20.77 29.275000000000002 26.505000000000003 23.45 90-94 20.145 28.999999999999996 26.915 23.94 95-99 20.375 28.955 27.544999999999998 23.125 100-104 20.765 29.299999999999997 26.705000000000002 23.23 105-109 20.215 29.565 26.400000000000002 23.82 110-114 20.965 28.389999999999997 26.840000000000003 23.805 115-119 20.315 29.065 27.105 23.515 120-124 20.79 28.645 26.924999999999997 23.64 125-129 20.625 28.735 26.825 23.815 130-134 21.69 28.000000000000004 26.575 23.735 135-139 20.405 28.955 26.52 24.12 140-144 21.075 28.860000000000003 26.465 23.599999999999998 145-149 20.919999999999998 28.03 26.87 24.18 150-151 20.837500000000002 28.299999999999997 27.0625 23.799999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 2.0 25 1.0 26 2.0 27 7.5 28 10.0 29 12.0 30 20.0 31 27.5 32 38.0 33 47.5 34 63.0 35 88.0 36 102.0 37 123.5 38 138.5 39 160.0 40 194.5 41 220.5 42 247.5 43 256.5 44 254.0 45 255.0 46 248.0 47 245.0 48 241.5 49 210.5 50 168.0 51 141.0 52 126.5 53 89.5 54 66.5 55 59.0 56 36.5 57 24.0 58 21.5 59 16.5 60 10.0 61 5.5 62 3.5 63 3.5 64 2.5 65 1.5 66 1.5 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.6375000000000002 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.2750000000000004 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.1500000000000004 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 4.0 0.0 0.0 0.0 0.0 118-119 4.5625 0.0 0.0 0.0 0.0 120-121 5.1 0.0 0.0 0.0 0.0 122-123 5.5125 0.0 0.0 0.0 0.0 124-125 5.95 0.0 0.0 0.0 0.0 126-127 6.4 0.0 0.0 0.0 0.0 128-129 6.85 0.0 0.0 0.0 0.0 130-131 7.375 0.0 0.0 0.0 0.0 132-133 7.9375 0.0 0.0 0.0 0.0 134-135 8.6375 0.0 0.0 0.0 0.0 136-137 9.399999999999999 0.0 0.0 0.0 0.0 138-139 10.087499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTTGA 10 0.006832588 144.9875 3 TTTTTTT 20 0.0059376103 28.9975 55-59 >>END_MODULE SRR7169752 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169752_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90925 33.0 33.0 34.0 32.0 34.0 2 32.00725 33.0 33.0 34.0 28.0 34.0 3 32.88925 33.0 33.0 34.0 32.0 34.0 4 32.99475 33.0 33.0 34.0 32.0 34.0 5 33.16625 34.0 33.0 34.0 33.0 34.0 6 37.35575 38.0 38.0 38.0 37.0 38.0 7 37.40875 38.0 38.0 38.0 38.0 38.0 8 37.4365 38.0 38.0 38.0 38.0 38.0 9 37.4855 38.0 38.0 38.0 38.0 38.0 10-14 37.391200000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.3873 38.0 38.0 38.0 37.8 38.0 20-24 37.3694 38.0 38.0 38.0 37.6 38.0 25-29 37.32039999999999 38.0 38.0 38.0 37.2 38.0 30-34 37.33945 38.0 38.0 38.0 37.2 38.0 35-39 36.9894 38.0 38.0 38.0 36.0 38.0 40-44 37.25535000000001 38.0 38.0 38.0 37.0 38.0 45-49 36.84315 38.0 38.0 38.0 35.4 38.0 50-54 36.9971 38.0 38.0 38.0 36.0 38.0 55-59 36.47145 38.0 37.4 38.0 33.6 38.0 60-64 36.9763 38.0 38.0 38.0 36.0 38.0 65-69 36.9593 38.0 38.0 38.0 35.8 38.0 70-74 36.83565 38.0 38.0 38.0 36.0 38.0 75-79 36.83615 38.0 38.0 38.0 35.6 38.0 80-84 36.7707 38.0 38.0 38.0 35.6 38.0 85-89 35.84715 38.0 36.8 38.0 29.4 38.0 90-94 36.659800000000004 38.0 38.0 38.0 34.8 38.0 95-99 36.692499999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.51055 38.0 38.0 38.0 34.0 38.0 105-109 35.92195 38.0 37.2 38.0 32.8 38.0 110-114 35.0608 38.0 37.0 38.0 29.2 38.0 115-119 34.4178 38.0 36.4 38.0 25.6 38.0 120-124 34.75085 38.0 36.2 38.0 27.0 38.0 125-129 34.69045 38.0 36.0 38.0 26.4 38.0 130-134 34.28340000000001 38.0 35.0 38.0 23.4 38.0 135-139 34.234249999999996 38.0 34.8 38.0 24.2 38.0 140-144 32.95195 37.6 32.2 38.0 19.2 38.0 145-149 32.6235 38.0 32.2 38.0 17.8 38.0 150-151 28.995874999999998 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 6.0 4 0.0 5 1.0 6 0.0 7 0.0 8 3.0 9 2.0 10 0.0 11 3.0 12 0.0 13 1.0 14 1.0 15 3.0 16 3.0 17 0.0 18 6.0 19 3.0 20 4.0 21 5.0 22 4.0 23 9.0 24 11.0 25 18.0 26 13.0 27 26.0 28 21.0 29 29.0 30 51.0 31 74.0 32 106.0 33 138.0 34 196.0 35 330.0 36 846.0 37 2084.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.1 18.7 14.649999999999999 30.55 2 25.924999999999997 24.625 32.1 17.349999999999998 3 20.25 26.450000000000003 33.0 20.3 4 24.375 31.65 23.95 20.025000000000002 5 24.525 35.975 22.575 16.925 6 20.275000000000002 38.525 23.45 17.75 7 20.474999999999998 21.275 38.525 19.725 8 22.525000000000002 24.825 27.6 25.05 9 21.375 24.3 31.2 23.125 10-14 23.685000000000002 28.294999999999998 26.345000000000002 21.675 15-19 23.645 27.084999999999997 28.12 21.15 20-24 23.285 28.110000000000003 27.48 21.125 25-29 23.369999999999997 27.689999999999998 28.325 20.615 30-34 22.645 28.000000000000004 28.310000000000002 21.044999999999998 35-39 23.555 27.91 27.32 21.215 40-44 23.03 28.235 28.044999999999998 20.69 45-49 22.895 27.794999999999998 28.395 20.915 50-54 23.405 28.015 28.065 20.515 55-59 23.580000000000002 28.125 27.52 20.775 60-64 23.13 27.185 28.955 20.73 65-69 23.87 27.450000000000003 27.950000000000003 20.73 70-74 23.395 27.765 28.305000000000003 20.535 75-79 23.47 27.474999999999998 28.735 20.32 80-84 23.56 27.534999999999997 28.449999999999996 20.455000000000002 85-89 23.62 27.224999999999998 28.494999999999997 20.66 90-94 23.39 27.58 28.485 20.544999999999998 95-99 23.425 28.084999999999997 28.055000000000003 20.435 100-104 24.065 27.58 28.165000000000003 20.19 105-109 23.87 27.675 28.335 20.119999999999997 110-114 24.210526315789473 27.577925396014308 27.751660705160962 20.459887583035258 115-119 24.85816894810805 27.63233227502212 27.137875396866708 20.371623380003122 120-124 24.082299484351864 27.5744115995303 27.819472098841068 20.523816817276767 125-129 24.72937947857905 28.03781064186614 27.438125730548357 19.794684149006454 130-134 25.05 27.544999999999998 27.415 19.99 135-139 25.155 27.515 27.860000000000003 19.470000000000002 140-144 25.3 28.000000000000004 27.12 19.580000000000002 145-149 25.035 27.76 27.700000000000003 19.505 150-151 25.0375 27.075 28.212500000000002 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 2.0 25 2.0 26 2.5 27 2.5 28 3.5 29 5.5 30 8.0 31 16.0 32 27.5 33 37.0 34 40.0 35 56.0 36 83.5 37 115.0 38 139.5 39 154.5 40 174.5 41 213.5 42 262.5 43 280.0 44 284.0 45 294.0 46 275.0 47 256.5 48 245.0 49 219.5 50 193.0 51 156.5 52 118.0 53 89.5 54 73.0 55 55.0 56 36.5 57 24.5 58 17.0 59 10.5 60 7.5 61 6.0 62 2.5 63 1.0 64 1.5 65 1.5 66 1.0 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 2.15 115-119 3.9350000000000005 120-124 2.0650000000000004 125-129 1.6150000000000002 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.6375000000000002 0.0 0.0 0.0 0.0 104-105 1.8875000000000002 0.0 0.0 0.0 0.0 106-107 2.2125 0.0 0.0 0.0 0.0 108-109 2.4749999999999996 0.0 0.0 0.0 0.0 110-111 2.725 0.0 0.0 0.0 0.0 112-113 3.0375 0.0 0.0 0.0 0.0 114-115 3.3625 0.0 0.0 0.0 0.0 116-117 3.8 0.0 0.0 0.0 0.0 118-119 4.3625 0.0 0.0 0.0 0.0 120-121 4.9 0.0 0.0 0.0 0.0 122-123 5.2625 0.0 0.0 0.0 0.0 124-125 5.675 0.0 0.0 0.0 0.0 126-127 6.125 0.0 0.0 0.0 0.0 128-129 6.55 0.0 0.0 0.0 0.0 130-131 7.025 0.0 0.0 0.0 0.0 132-133 7.5125 0.0 0.0 0.0 0.0 134-135 8.25 0.0 0.0 0.0 0.0 136-137 9.0 0.0 0.0 0.0 0.0 138-139 9.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAAATT 10 0.006914255 144.41249 2 >>END_MODULE Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra Read 698574 spots for SRR7169752.sra Written 698574 spots for SRR7169752.sra Read 698562 spots for SRR7169752.sra Written 698562 spots for SRR7169752.sra SRR ids: ['SRR7169752.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d7r6xhcb SRR7169752.sra spots: 13971252 blocks: [[1, 698562], [698563, 1397124], [1397125, 2095686], [2095687, 2794248], [2794249, 3492810], [3492811, 4191372], [4191373, 4889934], [4889935, 5588496], [5588497, 6287058], [6287059, 6985620], [6985621, 7684182], [7684183, 8382744], [8382745, 9081306], [9081307, 9779868], [9779869, 10478430], [10478431, 11176992], [11176993, 11875554], [11875555, 12574116], [12574117, 13272678], [13272679, 13971252]] SRR7169752 file size 4712698 SRR7169752 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169752 SRR7169752_1.fastq SRR7169752_2.fastq Input file: SRR7169752_1.fastq Paired file: SRR7169752_2.fastq trimmed: SRR7169752-trimmed-pair1.fastq, SRR7169752-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:47:22 2025 >> started Tue Feb 11 13:47:38 2025 >> done (15.643s) 13971252 read pairs processed; of these: 8586 ( 0.06%) short read pairs filtered out after trimming by size control 10853 ( 0.08%) empty read pairs filtered out after trimming by size control 13951813 (99.86%) read pairs available; of these: 6897433 (49.44%) trimmed read pairs available after processing 7054380 (50.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 2 0.00% 22 4 0.00% 23 3 0.00% 24 8 0.00% 25 5 0.00% 26 3 0.00% 27 4 0.00% 28 4 0.00% 29 3 0.00% 30 5 0.00% 31 9 0.00% 32 8 0.00% 33 8 0.00% 34 11 0.00% 35 5 0.00% 36 8 0.00% 37 12 0.00% 38 18 0.00% 39 24 0.00% 40 18 0.00% 41 16 0.00% 42 26 0.00% 43 44 0.00% 44 35 0.00% 45 36 0.00% 46 53 0.00% 47 50 0.00% 48 67 0.00% 49 82 0.00% 50 79 0.00% 51 91 0.00% 52 113 0.00% 53 120 0.00% 54 137 0.00% 55 171 0.00% 56 157 0.00% 57 188 0.00% 58 195 0.00% 59 266 0.00% 60 310 0.00% 61 374 0.00% 62 404 0.00% 63 477 0.00% 64 517 0.00% 65 585 0.00% 66 631 0.00% 67 696 0.00% 68 796 0.01% 69 941 0.01% 70 1126 0.01% 71 1257 0.01% 72 1359 0.01% 73 1662 0.01% 74 1901 0.01% 75 2201 0.02% 76 2603 0.02% 77 2691 0.02% 78 2892 0.02% 79 3092 0.02% 80 3385 0.02% 81 4013 0.03% 82 4430 0.03% 83 5043 0.04% 84 6016 0.04% 85 6833 0.05% 86 7384 0.05% 87 7836 0.06% 88 8626 0.06% 89 9132 0.07% 90 9693 0.07% 91 10464 0.08% 92 11506 0.08% 93 12291 0.09% 94 13561 0.10% 95 14744 0.11% 96 15337 0.11% 97 15969 0.11% 98 16957 0.12% 99 17494 0.13% 100 18591 0.13% 101 19291 0.14% 102 20394 0.15% 103 21995 0.16% 104 23147 0.17% 105 24528 0.18% 106 25891 0.19% 107 26384 0.19% 108 27296 0.20% 109 28483 0.20% 110 28602 0.21% 111 29547 0.21% 112 30865 0.22% 113 32301 0.23% 114 33677 0.24% 115 35257 0.25% 116 36303 0.26% 117 37326 0.27% 118 38415 0.28% 119 38869 0.28% 120 39332 0.28% 121 40775 0.29% 122 41229 0.30% 123 43490 0.31% 124 45166 0.32% 125 46478 0.33% 126 48467 0.35% 127 49764 0.36% 128 51021 0.37% 129 51960 0.37% 130 53157 0.38% 131 53771 0.39% 132 54948 0.39% 133 57582 0.41% 134 59033 0.42% 135 61068 0.44% 136 64185 0.46% 137 66421 0.48% 138 69149 0.50% 139 72418 0.52% 140 75901 0.54% 141 81160 0.58% 142 87603 0.63% 143 95189 0.68% 144 109146 0.78% 145 127938 0.92% 146 155597 1.12% 147 203907 1.46% 148 305188 2.19% 149 599494 4.30% 150 3180415 22.80% 151 7054380 50.56% 13951813 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=39 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=260.52 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=28.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=43 prefix-density=0.20 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=267.34 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=27.9 sequence=AAGAAGAAGAAA SRR7169752 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:48:20 Started mapping on | Feb 11 13:48:21 Finished on | Feb 11 13:49:26 Mapping speed, Million of reads per hour | 772.72 Number of input reads | 13951813 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13419184 Uniquely mapped reads % | 96.18% Average mapped length | 291.36 Number of splices: Total | 12160368 Number of splices: Annotated (sjdb) | 11939106 Number of splices: GT/AG | 11979069 Number of splices: GC/AG | 142475 Number of splices: AT/AC | 9787 Number of splices: Non-canonical | 29037 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254079 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 62924 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.47% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 286854 286854 286854 N_multimapping 254079 254079 254079 N_noFeature 368159 13253450 442403 N_ambiguous 144903 1042 52576 UnstrandedReadsAssigned:12906122 PositiveStrandReadsAssigned:164692 NegativeStrandReadsAssigned:12924205 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169752 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169752-trimmed-pair1.fastq SRR7169752-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,951,813 reads, 12,871,186 reads pseudoaligned [quant] estimated average fragment length: 214.332 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52401 SRR7169752.ke.tsv 34699 SRR7169752.se.tsv 87100 total ==> SRR7169752.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.67 253 11.3074 Potri.005G024800.1.v4.1 1035 821.668 30 2.94485 Potri.004G059700.1.v4.1 961 747.681 5 0.539376 Potri.007G009000.2.v4.1 1416 1202.67 0 0 Potri.003G141000.2.v4.1 2943 2729.67 217.061 6.41373 Potri.016G087400.1.v4.1 270 89.7583 1322 1187.94 Potri.015G069301.1.v4.1 564 352.357 0 0 Potri.010G195200.1.v4.1 1773 1559.67 55 2.84426 Potri.012G127500.1.v4.1 977 763.681 5478 578.56 ==> SRR7169752.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1250 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 218 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169752 completed mapping pipeline successfully