Starting /dee2/code/volunteer_pipeline.sh SRR7169753 current disk space = 3050338996224 free memory = 1577225088 SRR7169753 SRAfilesize b489e1e04115abf314629cb13572dd06 SRR7169753.sra SRR7169753.sra file validated SRR7169753 is paired end SRR7169753 is conventional basespace SRR7169753 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169753_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.97325 28.0 18.0 33.0 18.0 33.0 2 26.89275 28.0 25.0 31.0 18.0 33.0 3 30.4315 31.0 29.0 33.0 27.0 33.0 4 32.169 33.0 31.0 33.0 30.0 33.0 5 32.784 33.0 33.0 33.0 32.0 34.0 6 36.68425 38.0 37.0 38.0 34.0 38.0 7 36.96775 38.0 37.0 38.0 35.0 38.0 8 37.29975 38.0 38.0 38.0 36.0 38.0 9 37.55775 38.0 38.0 38.0 37.0 38.0 10-14 37.533100000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.5704 38.0 38.0 38.0 38.0 38.0 20-24 37.5941 38.0 38.0 38.0 38.0 38.0 25-29 37.4228 38.0 38.0 38.0 37.4 38.0 30-34 37.491 38.0 38.0 38.0 37.8 38.0 35-39 37.390249999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.33685 38.0 38.0 38.0 37.0 38.0 45-49 37.331 38.0 38.0 38.0 37.0 38.0 50-54 37.3436 38.0 38.0 38.0 37.0 38.0 55-59 37.308350000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.23005 38.0 38.0 38.0 36.6 38.0 65-69 36.9523 38.0 38.0 38.0 35.6 38.0 70-74 37.111000000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.39065000000001 38.0 37.4 38.0 33.4 38.0 80-84 36.90325 38.0 38.0 38.0 35.4 38.0 85-89 36.64435 38.0 38.0 38.0 34.8 38.0 90-94 36.75265 38.0 38.0 38.0 35.0 38.0 95-99 36.74805 38.0 38.0 38.0 35.0 38.0 100-104 36.6232 38.0 38.0 38.0 34.6 38.0 105-109 36.477700000000006 38.0 38.0 38.0 34.2 38.0 110-114 36.02405 38.0 37.0 38.0 32.0 38.0 115-119 34.7866 38.0 34.8 38.0 25.8 38.0 120-124 35.8871 38.0 36.8 38.0 32.6 38.0 125-129 35.69945 38.0 36.2 38.0 31.6 38.0 130-134 35.1486 38.0 35.6 38.0 29.2 38.0 135-139 34.89725 38.0 35.4 38.0 27.6 38.0 140-144 33.7365 38.0 34.0 38.0 22.2 38.0 145-149 33.8999 38.0 35.0 38.0 24.0 38.0 150-151 29.188125 36.0 18.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 2.0 15 1.0 16 4.0 17 1.0 18 2.0 19 1.0 20 6.0 21 4.0 22 3.0 23 3.0 24 4.0 25 9.0 26 17.0 27 14.0 28 22.0 29 32.0 30 27.0 31 54.0 32 79.0 33 108.0 34 163.0 35 365.0 36 1036.0 37 2039.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.27316334259025 10.09845998485231 10.350921484473616 41.27745518808382 2 21.4 15.35 32.975 30.275000000000002 3 17.9 21.125 25.75 35.225 4 21.25 28.925 22.725 27.1 5 22.125 32.800000000000004 24.2 20.875 6 18.099999999999998 36.8 24.175 20.925 7 13.875000000000002 26.200000000000003 42.375 17.549999999999997 8 19.400000000000002 26.174999999999997 30.675 23.75 9 17.375 25.8 33.5 23.325000000000003 10-14 19.68 29.785 27.365000000000002 23.169999999999998 15-19 19.645000000000003 28.720000000000002 27.994999999999997 23.64 20-24 19.7 30.175 27.3 22.825 25-29 19.695 29.485 27.18 23.64 30-34 19.595000000000002 29.609999999999996 27.49 23.305 35-39 19.36 29.360000000000003 27.794999999999998 23.485 40-44 19.99 28.785 27.72 23.505000000000003 45-49 20.29 28.970000000000002 26.950000000000003 23.79 50-54 19.915 28.610000000000003 27.935 23.54 55-59 20.72 28.575 27.229999999999997 23.474999999999998 60-64 20.285 29.005 27.134999999999998 23.575 65-69 19.5 29.110000000000003 27.82 23.57 70-74 20.169999999999998 28.325 28.105000000000004 23.400000000000002 75-79 20.119999999999997 29.115000000000002 27.175 23.59 80-84 20.18 28.87 27.400000000000002 23.549999999999997 85-89 20.65 28.715000000000003 27.52 23.115 90-94 20.305 29.17 27.08 23.445 95-99 20.02 28.225 27.74 24.015 100-104 20.73 28.28 26.93 24.060000000000002 105-109 20.91 28.405 27.37 23.315 110-114 20.905 28.555000000000003 26.83 23.71 115-119 21.05 28.7 27.195000000000004 23.055 120-124 20.841042052102605 28.581429071453574 27.181359067953398 23.396169808490423 125-129 21.195 28.68 26.615 23.51 130-134 21.125 28.065 26.82 23.990000000000002 135-139 21.135 28.27 26.484999999999996 24.11 140-144 21.3 27.860000000000003 26.66 24.18 145-149 20.560000000000002 28.599999999999998 26.58 24.26 150-151 21.725 28.875 25.3 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 2.0 23 2.0 24 1.5 25 5.0 26 6.0 27 7.5 28 9.0 29 12.0 30 17.5 31 27.0 32 35.5 33 43.5 34 52.5 35 72.0 36 96.0 37 121.0 38 144.5 39 168.0 40 195.0 41 204.5 42 239.0 43 278.0 44 274.5 45 263.5 46 262.0 47 241.5 48 224.5 49 210.0 50 181.0 51 146.5 52 103.0 53 84.0 54 76.0 55 54.0 56 34.0 57 24.0 58 14.5 59 13.5 60 13.5 61 6.0 62 5.0 63 4.5 64 4.5 65 5.5 66 3.5 67 2.0 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.2125 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.9624999999999999 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.5499999999999998 0.0 0.0 0.0 0.0 100-101 1.8125 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.4749999999999996 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 3.075 0.0 0.0 0.0 0.0 112-113 3.5125 0.0 0.0 0.0 0.0 114-115 3.85 0.0 0.0 0.0 0.0 116-117 4.45 0.0 0.0 0.0 0.0 118-119 4.9125 0.0 0.0 0.0 0.0 120-121 5.3625 0.0 0.0 0.0 0.0 122-123 5.8875 0.0 0.0 0.0 0.0 124-125 6.324999999999999 0.0 0.0 0.0 0.0 126-127 6.875 0.0 0.0 0.0 0.0 128-129 7.4625 0.0 0.0 0.0 0.0 130-131 8.025 0.0 0.0 0.0 0.0 132-133 8.625 0.0 0.0 0.0 0.0 134-135 9.1 0.0 0.0 0.0 0.0 136-137 9.7375 0.0 0.0 0.0 0.0 138-139 10.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATCTTG 10 0.006832588 144.9875 4 >>END_MODULE SRR7169753 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169753_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02725 33.0 33.0 34.0 33.0 34.0 2 33.15725 34.0 33.0 34.0 33.0 34.0 3 33.2035 34.0 33.0 34.0 33.0 34.0 4 33.15625 34.0 33.0 34.0 33.0 34.0 5 33.20525 34.0 33.0 34.0 33.0 34.0 6 37.31675 38.0 38.0 38.0 37.0 38.0 7 37.43175 38.0 38.0 38.0 38.0 38.0 8 37.39625 38.0 38.0 38.0 38.0 38.0 9 37.249 38.0 38.0 38.0 37.0 38.0 10-14 37.33200000000001 38.0 38.0 38.0 37.6 38.0 15-19 36.76424999999999 38.0 37.8 38.0 35.4 38.0 20-24 37.193650000000005 38.0 38.0 38.0 37.2 38.0 25-29 36.216750000000005 38.0 37.6 38.0 32.2 38.0 30-34 37.2145 38.0 38.0 38.0 36.8 38.0 35-39 37.26465 38.0 38.0 38.0 37.0 38.0 40-44 37.229200000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.0762 38.0 38.0 38.0 36.8 38.0 50-54 37.1376 38.0 38.0 38.0 36.8 38.0 55-59 37.0784 38.0 38.0 38.0 36.6 38.0 60-64 37.012350000000005 38.0 38.0 38.0 36.4 38.0 65-69 35.59425 38.0 36.6 38.0 28.4 38.0 70-74 36.02675 38.0 37.4 38.0 32.0 38.0 75-79 36.79645 38.0 38.0 38.0 36.0 38.0 80-84 36.260400000000004 38.0 37.4 38.0 31.2 38.0 85-89 36.83115 38.0 38.0 38.0 35.8 38.0 90-94 36.7601 38.0 38.0 38.0 35.8 38.0 95-99 36.730149999999995 38.0 38.0 38.0 35.8 38.0 100-104 36.4504 38.0 38.0 38.0 34.8 38.0 105-109 35.656349999999996 38.0 37.2 38.0 31.2 38.0 110-114 35.6007 38.0 37.8 38.0 32.0 38.0 115-119 34.4602 38.0 36.2 38.0 24.6 38.0 120-124 34.5788 38.0 36.0 38.0 26.4 38.0 125-129 34.4481 38.0 35.4 38.0 24.6 38.0 130-134 35.277 38.0 36.0 38.0 30.0 38.0 135-139 35.143600000000006 38.0 36.0 38.0 30.0 38.0 140-144 34.84545000000001 38.0 36.0 38.0 29.2 38.0 145-149 34.091950000000004 38.0 34.2 38.0 26.0 38.0 150-151 29.589750000000002 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 2.0 5 1.0 6 1.0 7 2.0 8 1.0 9 0.0 10 2.0 11 0.0 12 4.0 13 1.0 14 3.0 15 4.0 16 2.0 17 1.0 18 3.0 19 6.0 20 5.0 21 12.0 22 9.0 23 9.0 24 8.0 25 15.0 26 11.0 27 17.0 28 23.0 29 23.0 30 54.0 31 57.0 32 73.0 33 135.0 34 167.0 35 279.0 36 725.0 37 2336.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.89344672336168 19.609804902451224 15.582791395697848 27.913956978489246 2 26.125 26.8 30.349999999999998 16.725 3 21.75 28.525 29.675 20.05 4 23.425 34.150000000000006 22.45 19.975 5 24.45 35.5 22.175 17.875 6 21.15 37.1 23.9 17.849999999999998 7 20.599999999999998 20.200000000000003 38.75 20.45 8 22.625 25.324999999999996 27.3 24.75 9 22.275 25.2 29.925 22.6 10-14 23.799999999999997 28.315 26.52 21.365000000000002 15-19 23.9 28.055000000000003 27.465 20.580000000000002 20-24 23.14 28.115000000000002 27.705000000000002 21.04 25-29 23.735 27.865000000000002 27.925 20.474999999999998 30-34 23.3 28.194999999999997 27.71 20.794999999999998 35-39 23.025000000000002 27.644999999999996 28.27 21.060000000000002 40-44 23.085 28.335 28.28 20.3 45-49 23.14 27.935 27.965 20.96 50-54 23.59 27.935 27.700000000000003 20.775 55-59 24.32 27.589999999999996 27.29 20.8 60-64 23.575 27.32 28.345 20.76 65-69 23.755000000000003 27.884999999999998 27.884999999999998 20.474999999999998 70-74 23.225 28.060000000000002 28.055000000000003 20.66 75-79 23.31362132905683 27.75884534429187 28.480505161872305 20.44702816477899 80-84 23.615 27.565 28.27 20.549999999999997 85-89 24.315 27.075 28.599999999999998 20.01 90-94 23.98 27.655 28.33 20.035 95-99 23.674999999999997 27.694999999999997 28.12 20.51 100-104 24.045247509885378 27.669052505130388 28.219630612142748 20.066069372841483 105-109 24.12910350366429 27.9490011043068 28.09456881839173 19.827326573637187 110-114 24.186682882335056 27.33860342555995 28.23553258335867 20.239181108746326 115-119 24.591773460107483 27.55787515502274 27.816246382802813 20.034105002066973 120-124 25.06945158966972 28.15104434612615 27.297047021298486 19.482457042905647 125-129 24.88818865623094 28.262858304533438 27.647895913803616 19.201057125431998 130-134 25.451633888805485 27.853675624280637 27.293199219336433 19.40149126757744 135-139 25.224999999999998 28.015 27.105 19.655 140-144 26.41 27.66 26.605 19.325 145-149 26.595000000000002 28.17 26.655 18.58 150-151 26.7625 26.8625 27.150000000000002 19.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 2.0 27 3.0 28 3.5 29 5.0 30 10.0 31 15.5 32 17.0 33 26.5 34 41.5 35 52.0 36 82.0 37 111.0 38 140.5 39 179.5 40 201.5 41 217.0 42 240.5 43 283.5 44 306.0 45 293.0 46 290.0 47 266.0 48 224.0 49 202.0 50 174.0 51 142.5 52 115.0 53 91.5 54 67.5 55 49.5 56 36.5 57 25.5 58 20.0 59 14.5 60 12.5 61 10.5 62 8.0 63 7.0 64 3.0 65 0.5 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.22999999999999998 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.105 105-109 0.38999999999999996 110-114 1.3299999999999998 115-119 3.2399999999999998 120-124 2.81 125-129 1.6199999999999999 130-134 0.08499999999999999 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.2125 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.9624999999999999 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.5499999999999998 0.0 0.0 0.0 0.0 100-101 1.8 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.2625 0.0 0.0 0.0 0.0 106-107 2.4875 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 3.0625 0.0 0.0 0.0 0.0 112-113 3.4875 0.0 0.0 0.0 0.0 114-115 3.8375000000000004 0.0 0.0 0.0 0.0 116-117 4.3875 0.0 0.0 0.0 0.0 118-119 4.85 0.0 0.0 0.0 0.0 120-121 5.324999999999999 0.0 0.0 0.0 0.0 122-123 5.8125 0.0 0.0 0.0 0.0 124-125 6.2875 0.0 0.0 0.0 0.0 126-127 6.85 0.0 0.0 0.0 0.0 128-129 7.4375 0.0 0.0 0.0 0.0 130-131 8.0 0.0 0.0 0.0 0.0 132-133 8.55 0.0 0.0 0.0 0.0 134-135 9.075 0.0 0.0 0.0 0.0 136-137 9.8 0.0 0.0 0.0 0.0 138-139 10.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAACTA 10 0.006883923 144.625 2 TTTTTTT 40 0.0077702245 18.078125 2 >>END_MODULE Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735108 spots for SRR7169753.sra Written 735108 spots for SRR7169753.sra Read 735118 spots for SRR7169753.sra Written 735118 spots for SRR7169753.sra SRR ids: ['SRR7169753.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rebs9thq SRR7169753.sra spots: 14702170 blocks: [[1, 735108], [735109, 1470216], [1470217, 2205324], [2205325, 2940432], [2940433, 3675540], [3675541, 4410648], [4410649, 5145756], [5145757, 5880864], [5880865, 6615972], [6615973, 7351080], [7351081, 8086188], [8086189, 8821296], [8821297, 9556404], [9556405, 10291512], [10291513, 11026620], [11026621, 11761728], [11761729, 12496836], [12496837, 13231944], [13231945, 13967052], [13967053, 14702170]] SRR7169753 file size 4960382 SRR7169753 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169753 SRR7169753_1.fastq SRR7169753_2.fastq Input file: SRR7169753_1.fastq Paired file: SRR7169753_2.fastq trimmed: SRR7169753-trimmed-pair1.fastq, SRR7169753-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:45:55 2025 >> started Tue Feb 11 13:46:13 2025 >> done (17.780s) 14702170 read pairs processed; of these: 12738 ( 0.09%) short read pairs filtered out after trimming by size control 16184 ( 0.11%) empty read pairs filtered out after trimming by size control 14673248 (99.80%) read pairs available; of these: 7009008 (47.77%) trimmed read pairs available after processing 7664240 (52.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 3 0.00% 21 9 0.00% 22 7 0.00% 23 5 0.00% 24 6 0.00% 25 5 0.00% 26 6 0.00% 27 6 0.00% 28 4 0.00% 29 7 0.00% 30 3 0.00% 31 7 0.00% 32 9 0.00% 33 6 0.00% 34 8 0.00% 35 9 0.00% 36 11 0.00% 37 14 0.00% 38 13 0.00% 39 20 0.00% 40 11 0.00% 41 20 0.00% 42 31 0.00% 43 33 0.00% 44 33 0.00% 45 35 0.00% 46 32 0.00% 47 47 0.00% 48 58 0.00% 49 69 0.00% 50 79 0.00% 51 92 0.00% 52 119 0.00% 53 123 0.00% 54 137 0.00% 55 134 0.00% 56 178 0.00% 57 209 0.00% 58 250 0.00% 59 252 0.00% 60 303 0.00% 61 364 0.00% 62 425 0.00% 63 480 0.00% 64 501 0.00% 65 595 0.00% 66 690 0.00% 67 817 0.01% 68 886 0.01% 69 980 0.01% 70 1128 0.01% 71 1427 0.01% 72 1565 0.01% 73 1817 0.01% 74 2004 0.01% 75 2225 0.02% 76 2542 0.02% 77 2843 0.02% 78 3090 0.02% 79 3510 0.02% 80 3799 0.03% 81 4305 0.03% 82 4922 0.03% 83 5595 0.04% 84 6878 0.05% 85 7812 0.05% 86 8392 0.06% 87 9223 0.06% 88 9779 0.07% 89 10243 0.07% 90 11159 0.08% 91 12041 0.08% 92 12965 0.09% 93 14116 0.10% 94 15100 0.10% 95 16361 0.11% 96 17500 0.12% 97 18132 0.12% 98 19001 0.13% 99 19731 0.13% 100 20813 0.14% 101 21867 0.15% 102 23025 0.16% 103 24819 0.17% 104 26299 0.18% 105 27672 0.19% 106 28890 0.20% 107 29381 0.20% 108 30480 0.21% 109 31603 0.22% 110 32059 0.22% 111 33736 0.23% 112 35388 0.24% 113 36437 0.25% 114 38165 0.26% 115 39919 0.27% 116 41442 0.28% 117 42489 0.29% 118 43060 0.29% 119 43223 0.29% 120 43680 0.30% 121 45360 0.31% 122 46478 0.32% 123 48256 0.33% 124 50343 0.34% 125 52150 0.36% 126 53627 0.37% 127 55229 0.38% 128 55716 0.38% 129 56814 0.39% 130 58747 0.40% 131 59495 0.41% 132 60890 0.41% 133 62109 0.42% 134 64254 0.44% 135 66571 0.45% 136 68921 0.47% 137 71185 0.49% 138 73943 0.50% 139 76912 0.52% 140 79926 0.54% 141 85011 0.58% 142 90433 0.62% 143 98916 0.67% 144 109960 0.75% 145 127790 0.87% 146 151095 1.03% 147 196260 1.34% 148 287324 1.96% 149 564241 3.85% 150 3139256 21.39% 151 7664240 52.23% 14673248 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=6 fanout-score=93.84 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=18.1 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.17 fanout-score-rank=32 prefix-density=0.23 prefix-fanout=3.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=251.39 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=25.6 sequence=GAAGAAGAAGAAA SRR7169753 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:46:55 Started mapping on | Feb 11 13:46:55 Finished on | Feb 11 13:48:16 Mapping speed, Million of reads per hour | 652.14 Number of input reads | 14673248 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13963145 Uniquely mapped reads % | 95.16% Average mapped length | 290.88 Number of splices: Total | 12767029 Number of splices: Annotated (sjdb) | 12549941 Number of splices: GT/AG | 12573725 Number of splices: GC/AG | 152813 Number of splices: AT/AC | 10432 Number of splices: Non-canonical | 30059 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 258994 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 128513 % of reads mapped to too many loci | 0.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.08% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463246 463246 463246 N_multimapping 258994 258994 258994 N_noFeature 309989 13806854 374203 N_ambiguous 147245 1229 54174 UnstrandedReadsAssigned:13505911 PositiveStrandReadsAssigned:155062 NegativeStrandReadsAssigned:13534768 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169753 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169753-trimmed-pair1.fastq SRR7169753-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,673,248 reads, 13,544,792 reads pseudoaligned [quant] estimated average fragment length: 211.288 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52401 SRR7169753.ke.tsv 34699 SRR7169753.se.tsv 87100 total ==> SRR7169753.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.71 293 12.1054 Potri.005G024800.1.v4.1 1035 824.712 35 3.16962 Potri.004G059700.1.v4.1 961 750.712 4 0.397949 Potri.007G009000.2.v4.1 1416 1205.71 0 0 Potri.003G141000.2.v4.1 2943 2732.71 305.041 8.33691 Potri.016G087400.1.v4.1 270 91.1605 1666.52 1365.35 Potri.015G069301.1.v4.1 564 355.109 0 0 Potri.010G195200.1.v4.1 1773 1562.71 17 0.812477 Potri.012G127500.1.v4.1 977 766.712 4728 460.56 ==> SRR7169753.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1430 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169753 completed mapping pipeline successfully