Starting /dee2/code/volunteer_pipeline.sh SRR7169754 current disk space = 3050619543552 free memory = 1416291380 SRR7169754 SRAfilesize dc0c977af2e89027f5378d17684ca66c SRR7169754.sra SRR7169754.sra file validated SRR7169754 is paired end SRR7169754 is conventional basespace SRR7169754 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169754_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.7605 28.0 18.0 33.0 18.0 33.0 2 30.137 31.0 29.0 33.0 27.0 33.0 3 31.931 33.0 31.0 33.0 29.0 33.0 4 32.1465 33.0 33.0 33.0 31.0 33.0 5 32.7515 33.0 33.0 33.0 32.0 34.0 6 36.743 38.0 37.0 38.0 35.0 38.0 7 37.30225 38.0 38.0 38.0 36.0 38.0 8 37.558 38.0 38.0 38.0 37.0 38.0 9 37.6245 38.0 38.0 38.0 38.0 38.0 10-14 37.6052 38.0 38.0 38.0 38.0 38.0 15-19 37.6324 38.0 38.0 38.0 38.0 38.0 20-24 37.66035 38.0 38.0 38.0 38.0 38.0 25-29 37.632999999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.612049999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.3837 38.0 38.0 38.0 37.2 38.0 40-44 37.047250000000005 38.0 38.0 38.0 36.0 38.0 45-49 37.359049999999996 38.0 38.0 38.0 36.8 38.0 50-54 37.466049999999996 38.0 38.0 38.0 37.2 38.0 55-59 37.426550000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.29965 38.0 38.0 38.0 37.0 38.0 65-69 37.289750000000005 38.0 38.0 38.0 36.8 38.0 70-74 37.25690000000001 38.0 38.0 38.0 36.6 38.0 75-79 37.229049999999994 38.0 38.0 38.0 36.0 38.0 80-84 37.117200000000004 38.0 38.0 38.0 36.0 38.0 85-89 37.0323 38.0 38.0 38.0 36.0 38.0 90-94 36.83685 38.0 38.0 38.0 35.4 38.0 95-99 36.9252 38.0 38.0 38.0 35.6 38.0 100-104 36.8141 38.0 38.0 38.0 35.0 38.0 105-109 36.60815 38.0 38.0 38.0 34.4 38.0 110-114 36.43275 38.0 38.0 38.0 34.0 38.0 115-119 36.33135 38.0 37.8 38.0 33.8 38.0 120-124 36.1024 38.0 37.0 38.0 33.0 38.0 125-129 36.033550000000005 38.0 37.0 38.0 33.0 38.0 130-134 35.574600000000004 38.0 36.2 38.0 31.0 38.0 135-139 35.4372 38.0 35.8 38.0 30.6 38.0 140-144 35.00345 38.0 35.0 38.0 29.2 38.0 145-149 34.5167 38.0 35.0 38.0 27.4 38.0 150-151 30.743499999999997 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 1.0 19 4.0 20 1.0 21 1.0 22 2.0 23 4.0 24 3.0 25 9.0 26 13.0 27 9.0 28 16.0 29 28.0 30 32.0 31 48.0 32 49.0 33 76.0 34 132.0 35 294.0 36 744.0 37 2529.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.35487959442332 11.280101394169835 8.086185044359949 40.27883396704689 2 21.525 16.25 34.150000000000006 28.075 3 20.424999999999997 20.974999999999998 24.925 33.675 4 23.25 30.0 20.65 26.1 5 22.55 34.725 22.975 19.75 6 18.95 36.449999999999996 24.3 20.3 7 15.2 26.200000000000003 40.849999999999994 17.75 8 18.125 26.575 30.825000000000003 24.474999999999998 9 17.549999999999997 23.799999999999997 34.599999999999994 24.05 10-14 20.03 30.395 26.355 23.22 15-19 20.14 28.525 28.015 23.32 20-24 19.79 28.215 28.050000000000004 23.945 25-29 19.955000000000002 28.810000000000002 27.77 23.465 30-34 20.27 28.665000000000003 27.625 23.44 35-39 20.175 28.349999999999998 27.58 23.895 40-44 20.06 29.03 27.26 23.65 45-49 20.369999999999997 28.749999999999996 27.134999999999998 23.745 50-54 20.0 28.715000000000003 27.365000000000002 23.919999999999998 55-59 20.16 29.32 26.825 23.695 60-64 20.11 28.845 27.544999999999998 23.5 65-69 20.375 28.21 27.694999999999997 23.72 70-74 20.52 29.665000000000003 26.884999999999998 22.93 75-79 20.53 28.665000000000003 27.365000000000002 23.44 80-84 19.695 28.74 27.38 24.185000000000002 85-89 20.325 28.555000000000003 27.595 23.525 90-94 20.645 28.860000000000003 26.61 23.885 95-99 20.39 28.71 26.965 23.935000000000002 100-104 21.255 29.054999999999996 26.31 23.380000000000003 105-109 20.645 28.515 27.37 23.47 110-114 20.825 29.015 26.72 23.44 115-119 21.12 28.595 27.235 23.05 120-124 20.669999999999998 28.799999999999997 26.495 24.035 125-129 20.69 28.67 27.195000000000004 23.445 130-134 21.325 28.52 26.77 23.385 135-139 20.9 28.64 26.58 23.880000000000003 140-144 21.349999999999998 28.375 26.545 23.73 145-149 21.07 28.785 26.340000000000003 23.805 150-151 20.4125 28.349999999999998 26.737499999999997 24.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 1.5 23 1.5 24 0.0 25 2.0 26 3.0 27 5.0 28 7.0 29 9.5 30 17.0 31 25.5 32 31.0 33 47.0 34 59.5 35 65.5 36 88.0 37 101.5 38 115.0 39 159.0 40 192.5 41 212.0 42 241.0 43 260.5 44 269.0 45 284.0 46 291.0 47 265.5 48 231.5 49 195.0 50 171.0 51 153.5 52 118.0 53 93.5 54 74.0 55 50.5 56 39.0 57 32.0 58 22.0 59 13.5 60 8.5 61 8.5 62 8.5 63 4.0 64 3.0 65 3.5 66 3.0 67 2.5 68 3.0 69 3.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.7250000000000001 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 1.0499999999999998 0.0 0.0 0.0 0.0 94-95 1.3375 0.0 0.0 0.0 0.0 96-97 1.4874999999999998 0.0 0.0 0.0 0.0 98-99 1.7125 0.0 0.0 0.0 0.0 100-101 1.9625 0.0 0.0 0.0 0.0 102-103 2.1500000000000004 0.0 0.0 0.0 0.0 104-105 2.325 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.725 0.0 0.0 0.0 0.0 110-111 3.175 0.0 0.0 0.0 0.0 112-113 3.7625 0.0 0.0 0.0 0.0 114-115 4.2375 0.0 0.0 0.0 0.0 116-117 4.675000000000001 0.0 0.0 0.0 0.0 118-119 5.1625 0.0 0.0 0.0 0.0 120-121 5.6875 0.0 0.0 0.0 0.0 122-123 6.25 0.0 0.0 0.0 0.0 124-125 6.7125 0.0 0.0 0.0 0.0 126-127 7.3625 0.0 0.0 0.0 0.0 128-129 7.9125 0.0 0.0 0.0 0.0 130-131 8.337499999999999 0.0 0.0 0.0 0.0 132-133 8.9875 0.0 0.0 0.0 0.0 134-135 9.5625 0.0 0.0 0.0 0.0 136-137 10.3375 0.0 0.0 0.0 0.0 138-139 10.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169754 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169754_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80025 33.0 33.0 34.0 32.0 34.0 2 31.74775 33.0 32.0 34.0 27.0 34.0 3 32.741 33.0 33.0 34.0 32.0 34.0 4 32.88425 33.0 33.0 34.0 32.0 34.0 5 33.07475 34.0 33.0 34.0 33.0 34.0 6 37.313 38.0 38.0 38.0 37.0 38.0 7 37.333 38.0 38.0 38.0 37.0 38.0 8 37.3375 38.0 38.0 38.0 38.0 38.0 9 37.38025 38.0 38.0 38.0 38.0 38.0 10-14 37.3543 38.0 38.0 38.0 37.4 38.0 15-19 37.393 38.0 38.0 38.0 37.6 38.0 20-24 37.34225 38.0 38.0 38.0 37.8 38.0 25-29 37.29995 38.0 38.0 38.0 37.2 38.0 30-34 37.269800000000004 38.0 38.0 38.0 37.2 38.0 35-39 36.92235 38.0 38.0 38.0 35.6 38.0 40-44 37.18405 38.0 38.0 38.0 37.0 38.0 45-49 36.81535 38.0 38.0 38.0 35.6 38.0 50-54 37.05845 38.0 38.0 38.0 36.6 38.0 55-59 36.37985 38.0 37.4 38.0 33.2 38.0 60-64 36.95385 38.0 38.0 38.0 36.0 38.0 65-69 36.896699999999996 38.0 38.0 38.0 35.8 38.0 70-74 36.85245 38.0 38.0 38.0 36.0 38.0 75-79 36.75395000000001 38.0 38.0 38.0 35.6 38.0 80-84 36.7028 38.0 38.0 38.0 35.6 38.0 85-89 35.7777 38.0 36.6 38.0 29.8 38.0 90-94 36.6481 38.0 38.0 38.0 35.0 38.0 95-99 36.6097 38.0 38.0 38.0 35.0 38.0 100-104 36.449 38.0 38.0 38.0 34.6 38.0 105-109 35.739999999999995 38.0 37.4 38.0 31.8 38.0 110-114 34.9377 38.0 37.0 38.0 29.0 38.0 115-119 34.1931 38.0 36.2 38.0 22.8 38.0 120-124 34.46705 38.0 36.0 38.0 25.4 38.0 125-129 34.4624 38.0 35.8 38.0 24.6 38.0 130-134 34.168099999999995 38.0 34.8 38.0 22.8 38.0 135-139 34.1285 38.0 34.6 38.0 24.0 38.0 140-144 32.717850000000006 37.6 31.6 38.0 19.0 38.0 145-149 32.4423 37.6 32.4 38.0 16.2 38.0 150-151 28.90475 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 1.0 10 4.0 11 1.0 12 1.0 13 3.0 14 4.0 15 2.0 16 6.0 17 9.0 18 2.0 19 8.0 20 2.0 21 6.0 22 7.0 23 2.0 24 11.0 25 21.0 26 19.0 27 18.0 28 25.0 29 34.0 30 53.0 31 66.0 32 105.0 33 151.0 34 222.0 35 326.0 36 738.0 37 2143.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.85 20.0 13.925 29.225 2 26.05 26.55 32.074999999999996 15.325 3 20.125 28.375 31.324999999999996 20.175 4 25.025 34.300000000000004 22.175 18.5 5 23.9 36.15 23.150000000000002 16.8 6 20.325 38.15 22.875 18.65 7 19.75 21.5 39.525 19.225 8 23.175 24.125 27.325 25.374999999999996 9 22.175 24.224999999999998 29.625 23.974999999999998 10-14 23.03 28.92 26.66 21.39 15-19 23.14 27.825 27.975 21.060000000000002 20-24 23.52 27.33 28.315 20.835 25-29 23.46 28.005000000000003 27.32 21.215 30-34 22.675 27.62 28.115000000000002 21.59 35-39 22.97 27.985 28.015 21.029999999999998 40-44 23.580000000000002 27.565 27.685 21.17 45-49 23.025000000000002 27.169999999999998 28.4 21.404999999999998 50-54 22.825 27.900000000000002 28.22 21.055 55-59 23.23 27.555000000000003 28.565 20.65 60-64 23.56 27.72 28.110000000000003 20.61 65-69 23.44 28.01 28.345 20.205000000000002 70-74 23.395 27.87 28.015 20.72 75-79 23.39 27.224999999999998 28.175 21.21 80-84 23.425 27.315 28.43 20.830000000000002 85-89 24.025 27.49 28.015 20.47 90-94 23.715 27.55 28.310000000000002 20.424999999999997 95-99 23.62 27.400000000000002 28.595 20.385 100-104 23.96 27.205000000000002 28.405 20.43 105-109 23.685000000000002 27.73 28.035 20.549999999999997 110-114 24.0551766576073 27.91138915953028 27.844725911491718 20.188708271370697 115-119 24.688253169862726 27.994341402074816 27.292256103950542 20.025149324111915 120-124 24.269904703350754 27.902449021416132 27.89732554565017 19.93032072958295 125-129 24.767092602962887 27.62816270427124 27.251438171358757 20.353306521407116 130-134 25.365 26.96 27.455000000000002 20.22 135-139 25.365 27.68 26.845000000000002 20.11 140-144 25.729999999999997 27.345000000000002 27.045 19.88 145-149 25.75 27.295 27.08 19.875 150-151 25.174999999999997 26.974999999999998 27.725 20.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 2.5 24 1.5 25 2.0 26 2.5 27 2.5 28 5.0 29 6.5 30 10.0 31 15.5 32 20.0 33 35.0 34 49.5 35 59.0 36 73.5 37 95.5 38 130.5 39 168.0 40 203.0 41 217.0 42 244.5 43 282.0 44 277.5 45 281.5 46 289.5 47 284.0 48 245.5 49 194.0 50 171.5 51 144.5 52 115.0 53 98.0 54 82.0 55 55.0 56 34.0 57 24.0 58 17.0 59 13.5 60 9.5 61 4.0 62 5.0 63 7.5 64 4.5 65 2.5 66 1.5 67 1.0 68 2.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 2.495 115-119 4.569999999999999 120-124 2.41 125-129 1.7850000000000001 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.2875 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.6625 0.0 0.0 0.0 0.0 100-101 1.9125 0.0 0.0 0.0 0.0 102-103 2.075 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.4125 0.0 0.0 0.0 0.0 108-109 2.5875 0.0 0.0 0.0 0.0 110-111 2.9625 0.0 0.0 0.0 0.0 112-113 3.55 0.0 0.0 0.0 0.0 114-115 3.975 0.0 0.0 0.0 0.0 116-117 4.387499999999999 0.0 0.0 0.0 0.0 118-119 4.8625 0.0 0.0 0.0 0.0 120-121 5.3625 0.0 0.0 0.0 0.0 122-123 5.9 0.0 0.0 0.0 0.0 124-125 6.300000000000001 0.0 0.0 0.0 0.0 126-127 6.887499999999999 0.0 0.0 0.0 0.0 128-129 7.4625 0.0 0.0 0.0 0.0 130-131 7.8375 0.0 0.0 0.0 0.0 132-133 8.425 0.0 0.0 0.0 0.0 134-135 9.0125 0.0 0.0 0.0 0.0 136-137 9.7625 0.0 0.0 0.0 0.0 138-139 10.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAACC 10 0.0070373793 143.5625 9 >>END_MODULE Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808478 spots for SRR7169754.sra Written 808478 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra Read 808474 spots for SRR7169754.sra Written 808474 spots for SRR7169754.sra SRR ids: ['SRR7169754.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ihw45oye SRR7169754.sra spots: 16169484 blocks: [[1, 808474], [808475, 1616948], [1616949, 2425422], [2425423, 3233896], [3233897, 4042370], [4042371, 4850844], [4850845, 5659318], [5659319, 6467792], [6467793, 7276266], [7276267, 8084740], [8084741, 8893214], [8893215, 9701688], [9701689, 10510162], [10510163, 11318636], [11318637, 12127110], [12127111, 12935584], [12935585, 13744058], [13744059, 14552532], [14552533, 15361006], [15361007, 16169484]] SRR7169754 file size 5457607 SRR7169754 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169754 SRR7169754_1.fastq SRR7169754_2.fastq Input file: SRR7169754_1.fastq Paired file: SRR7169754_2.fastq trimmed: SRR7169754-trimmed-pair1.fastq, SRR7169754-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:51:37 2025 >> started Tue Feb 11 12:52:07 2025 >> done (29.877s) 16169484 read pairs processed; of these: 8233 ( 0.05%) short read pairs filtered out after trimming by size control 12918 ( 0.08%) empty read pairs filtered out after trimming by size control 16148333 (99.87%) read pairs available; of these: 8082252 (50.05%) trimmed read pairs available after processing 8066081 (49.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 3 0.00% 23 5 0.00% 24 6 0.00% 25 3 0.00% 26 3 0.00% 27 7 0.00% 28 11 0.00% 29 11 0.00% 30 9 0.00% 31 9 0.00% 32 8 0.00% 33 20 0.00% 34 15 0.00% 35 10 0.00% 36 23 0.00% 37 25 0.00% 38 33 0.00% 39 47 0.00% 40 56 0.00% 41 51 0.00% 42 58 0.00% 43 69 0.00% 44 47 0.00% 45 87 0.00% 46 111 0.00% 47 104 0.00% 48 126 0.00% 49 134 0.00% 50 177 0.00% 51 174 0.00% 52 252 0.00% 53 221 0.00% 54 303 0.00% 55 306 0.00% 56 332 0.00% 57 356 0.00% 58 397 0.00% 59 504 0.00% 60 576 0.00% 61 678 0.00% 62 781 0.00% 63 852 0.01% 64 938 0.01% 65 1023 0.01% 66 1163 0.01% 67 1265 0.01% 68 1415 0.01% 69 1566 0.01% 70 1929 0.01% 71 2170 0.01% 72 2587 0.02% 73 2968 0.02% 74 3064 0.02% 75 3562 0.02% 76 3923 0.02% 77 4164 0.03% 78 4444 0.03% 79 4909 0.03% 80 5476 0.03% 81 6356 0.04% 82 7184 0.04% 83 7901 0.05% 84 9118 0.06% 85 10143 0.06% 86 10848 0.07% 87 11426 0.07% 88 12147 0.08% 89 13231 0.08% 90 13806 0.09% 91 15065 0.09% 92 16062 0.10% 93 17658 0.11% 94 18767 0.12% 95 19963 0.12% 96 21357 0.13% 97 22021 0.14% 98 22617 0.14% 99 23399 0.14% 100 24524 0.15% 101 26021 0.16% 102 27120 0.17% 103 28965 0.18% 104 30284 0.19% 105 31834 0.20% 106 33101 0.20% 107 33736 0.21% 108 34203 0.21% 109 35526 0.22% 110 36188 0.22% 111 37053 0.23% 112 38584 0.24% 113 40124 0.25% 114 41713 0.26% 115 43715 0.27% 116 44623 0.28% 117 45362 0.28% 118 46014 0.28% 119 46173 0.29% 120 46852 0.29% 121 48346 0.30% 122 49648 0.31% 123 51540 0.32% 124 53756 0.33% 125 55536 0.34% 126 57588 0.36% 127 58632 0.36% 128 59923 0.37% 129 60996 0.38% 130 62603 0.39% 131 63213 0.39% 132 64735 0.40% 133 66757 0.41% 134 69808 0.43% 135 72160 0.45% 136 74989 0.46% 137 77761 0.48% 138 81276 0.50% 139 84150 0.52% 140 88752 0.55% 141 95036 0.59% 142 103266 0.64% 143 112867 0.70% 144 128118 0.79% 145 150154 0.93% 146 182892 1.13% 147 240413 1.49% 148 355104 2.20% 149 691311 4.28% 150 3616566 22.40% 151 8066081 49.95% 16148333 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=43 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=113.07 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=16.9 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.2 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=14 fanout-score=58.01 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=14.7 sequence=TGTTGGTGGTGG SRR7169754 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:53:32 Started mapping on | Feb 11 12:53:34 Finished on | Feb 11 12:55:13 Mapping speed, Million of reads per hour | 587.21 Number of input reads | 16148333 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 13903407 Uniquely mapped reads % | 86.10% Average mapped length | 288.90 Number of splices: Total | 13340162 Number of splices: Annotated (sjdb) | 13124487 Number of splices: GT/AG | 13151156 Number of splices: GC/AG | 149837 Number of splices: AT/AC | 10636 Number of splices: Non-canonical | 28533 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250673 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 33296 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.11% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2001736 2001736 2001736 N_multimapping 250673 250673 250673 N_noFeature 334648 13745269 404753 N_ambiguous 186853 1504 97662 UnstrandedReadsAssigned:13381906 PositiveStrandReadsAssigned:156634 NegativeStrandReadsAssigned:13400992 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=144 echo kmer=139 SRR7169754 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169754-trimmed-pair1.fastq SRR7169754-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,148,333 reads, 14,954,694 reads pseudoaligned [quant] estimated average fragment length: 211.091 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR7169754.ke.tsv 34699 SRR7169754.se.tsv 87100 total ==> SRR7169754.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.91 280 11.7243 Potri.005G024800.1.v4.1 1035 824.909 28 2.56955 Potri.004G059700.1.v4.1 961 750.916 1 0.100812 Potri.007G009000.2.v4.1 1416 1205.91 0 0 Potri.003G141000.2.v4.1 2943 2732.91 344.071 9.53077 Potri.016G087400.1.v4.1 270 95.14 1331 1059.06 Potri.015G069301.1.v4.1 564 355.901 0 0 Potri.010G195200.1.v4.1 1773 1562.91 13 0.629673 Potri.012G127500.1.v4.1 977 766.909 3140 309.95 ==> SRR7169754.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1053 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169754 completed mapping pipeline successfully