Starting /dee2/code/volunteer_pipeline.sh SRR7169755 current disk space = 3050410463232 free memory = 1505025228 SRR7169755 SRAfilesize dd4753ba52e382323c93298d9a3476c1 SRR7169755.sra SRR7169755.sra file validated SRR7169755 is paired end SRR7169755 is conventional basespace SRR7169755 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169755_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.2895 30.0 18.0 33.0 18.0 33.0 2 29.44025 31.0 27.0 33.0 25.0 33.0 3 30.697 31.0 29.0 33.0 28.0 33.0 4 30.66275 31.0 29.0 33.0 28.0 33.0 5 32.12925 33.0 32.0 33.0 31.0 33.0 6 36.521 38.0 37.0 38.0 34.0 38.0 7 37.149 38.0 38.0 38.0 36.0 38.0 8 37.56675 38.0 38.0 38.0 37.0 38.0 9 37.56475 38.0 38.0 38.0 37.0 38.0 10-14 37.58800000000001 38.0 38.0 38.0 37.6 38.0 15-19 37.677800000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.68445 38.0 38.0 38.0 38.0 38.0 25-29 37.61665000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.57495 38.0 38.0 38.0 38.0 38.0 35-39 37.4729 38.0 38.0 38.0 37.6 38.0 40-44 37.444750000000006 38.0 38.0 38.0 37.4 38.0 45-49 37.3846 38.0 38.0 38.0 37.0 38.0 50-54 37.20745 38.0 38.0 38.0 36.2 38.0 55-59 37.32000000000001 38.0 38.0 38.0 36.8 38.0 60-64 37.27915 38.0 38.0 38.0 36.8 38.0 65-69 37.037 38.0 38.0 38.0 36.2 38.0 70-74 37.161500000000004 38.0 38.0 38.0 36.4 38.0 75-79 37.0877 38.0 38.0 38.0 36.0 38.0 80-84 36.7387 38.0 38.0 38.0 35.0 38.0 85-89 36.73405 38.0 38.0 38.0 34.8 38.0 90-94 36.67685 38.0 38.0 38.0 34.8 38.0 95-99 36.71185 38.0 38.0 38.0 35.0 38.0 100-104 36.5768 38.0 38.0 38.0 34.0 38.0 105-109 36.42635 38.0 37.6 38.0 34.0 38.0 110-114 36.19235 38.0 37.6 38.0 33.8 38.0 115-119 35.45195 38.0 35.8 38.0 29.4 38.0 120-124 36.06455 38.0 37.0 38.0 33.4 38.0 125-129 35.071450000000006 38.0 35.4 38.0 26.6 38.0 130-134 35.1171 38.0 35.4 38.0 28.4 38.0 135-139 35.33970000000001 38.0 35.8 38.0 30.6 38.0 140-144 34.63740000000001 38.0 35.0 38.0 27.2 38.0 145-149 34.124849999999995 38.0 35.0 38.0 25.6 38.0 150-151 30.378 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 3.0 16 0.0 17 2.0 18 2.0 19 6.0 20 4.0 21 2.0 22 5.0 23 3.0 24 4.0 25 6.0 26 8.0 27 14.0 28 24.0 29 25.0 30 34.0 31 38.0 32 70.0 33 94.0 34 152.0 35 336.0 36 955.0 37 2209.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.500882278800105 11.469624401310814 9.377363246785984 39.652130073103095 2 21.95 14.725 33.925 29.4 3 20.275000000000002 20.75 24.85 34.125 4 22.625 28.775000000000002 22.05 26.55 5 22.15 32.75 24.125 20.974999999999998 6 19.15 36.475 24.75 19.625 7 15.825 25.95 39.825 18.4 8 18.675 27.325 29.799999999999997 24.2 9 17.25 25.525 33.675 23.549999999999997 10-14 19.325 31.095 26.215 23.365 15-19 19.73 29.630000000000003 27.42 23.22 20-24 20.895 28.54 27.275 23.29 25-29 20.19 29.165000000000003 27.325 23.32 30-34 20.415 29.080000000000002 26.919999999999998 23.585 35-39 20.69 28.455000000000002 27.08 23.775 40-44 20.355 28.754999999999995 27.36 23.53 45-49 20.235 29.265 26.91 23.59 50-54 20.28 29.54 26.634999999999998 23.544999999999998 55-59 19.919999999999998 29.12 27.08 23.880000000000003 60-64 20.36 29.035 26.365 24.240000000000002 65-69 20.595 28.595 26.979999999999997 23.830000000000002 70-74 19.99 29.005 27.16 23.845 75-79 20.635 28.110000000000003 27.405 23.849999999999998 80-84 20.445 28.48 27.089999999999996 23.985 85-89 20.28 28.625 27.245 23.849999999999998 90-94 20.544999999999998 28.360000000000003 27.169999999999998 23.925 95-99 20.419999999999998 28.26 27.47 23.849999999999998 100-104 20.745 28.43 26.77 24.055 105-109 20.93 28.439999999999998 26.945000000000004 23.685000000000002 110-114 20.70281124497992 28.549196787148595 27.319277108433738 23.42871485943775 115-119 20.73 28.15 26.88 24.240000000000002 120-124 20.69 28.395 26.765 24.15 125-129 21.125 28.975 26.14 23.76 130-134 21.445 27.875 26.779999999999998 23.9 135-139 21.23 27.97 26.395000000000003 24.404999999999998 140-144 21.2 28.095 26.27 24.435000000000002 145-149 20.785 29.18 26.085 23.95 150-151 20.6125 28.575 26.2625 24.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 2.0 25 3.0 26 4.0 27 6.0 28 7.5 29 10.5 30 16.5 31 26.5 32 38.5 33 47.0 34 62.0 35 82.0 36 96.5 37 114.0 38 129.5 39 148.5 40 171.5 41 193.0 42 228.0 43 246.0 44 247.5 45 248.5 46 257.0 47 250.5 48 229.0 49 211.0 50 180.5 51 161.5 52 135.0 53 108.0 54 83.0 55 66.0 56 52.0 57 38.0 58 29.5 59 18.0 60 15.0 61 9.0 62 8.0 63 6.5 64 4.0 65 4.0 66 2.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.4 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4526024641689716 0.8999999999999999 3 0.025144581342720643 0.075 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.1625 0.0 0.0 0.0 0.0 106-107 2.5374999999999996 0.0 0.0 0.0 0.0 108-109 2.875 0.0 0.0 0.0 0.0 110-111 3.2625 0.0 0.0 0.0 0.0 112-113 3.6375 0.0 0.0 0.0 0.0 114-115 4.025 0.0 0.0 0.0 0.0 116-117 4.675 0.0 0.0 0.0 0.0 118-119 5.1875 0.0 0.0 0.0 0.0 120-121 5.7625 0.0 0.0 0.0 0.0 122-123 6.237500000000001 0.0 0.0 0.0 0.0 124-125 6.6625 0.0 0.0 0.0 0.0 126-127 7.237500000000001 0.0 0.0 0.0 0.0 128-129 7.925 0.0 0.0 0.0 0.0 130-131 8.45 0.0 0.0 0.0 0.0 132-133 9.225 0.0 0.0 0.0 0.0 134-135 10.0375 0.0 0.0 0.0 0.0 136-137 10.675 0.0 0.0 0.0 0.0 138-139 11.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTA 10 0.0068484643 144.875 4 GCTTTCA 10 0.0068484643 144.875 4 TCAGAAA 35 0.0033237613 62.089287 145 >>END_MODULE SRR7169755 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169755_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7665 33.0 33.0 34.0 32.0 34.0 2 32.88675 33.0 33.0 34.0 32.0 34.0 3 32.2485 33.0 33.0 34.0 31.0 34.0 4 32.04975 33.0 33.0 34.0 30.0 34.0 5 32.87025 33.0 33.0 34.0 32.0 34.0 6 37.23675 38.0 38.0 38.0 37.0 38.0 7 37.24625 38.0 38.0 38.0 37.0 38.0 8 37.36575 38.0 38.0 38.0 37.0 38.0 9 37.3495 38.0 38.0 38.0 38.0 38.0 10-14 37.32115 38.0 38.0 38.0 37.6 38.0 15-19 37.33215 38.0 38.0 38.0 37.6 38.0 20-24 36.86135 38.0 38.0 38.0 35.4 38.0 25-29 37.20505000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.25985 38.0 38.0 38.0 37.0 38.0 35-39 37.2282 38.0 38.0 38.0 37.0 38.0 40-44 37.185700000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.21515 38.0 38.0 38.0 37.0 38.0 50-54 37.226 38.0 38.0 38.0 37.0 38.0 55-59 37.08255 38.0 38.0 38.0 36.8 38.0 60-64 36.793 38.0 38.0 38.0 36.0 38.0 65-69 36.7644 38.0 38.0 38.0 35.6 38.0 70-74 36.8091 38.0 38.0 38.0 36.0 38.0 75-79 36.53009999999999 38.0 38.0 38.0 35.4 38.0 80-84 36.077400000000004 38.0 37.4 38.0 32.6 38.0 85-89 36.567750000000004 38.0 38.0 38.0 34.6 38.0 90-94 36.70165 38.0 38.0 38.0 35.8 38.0 95-99 36.55965 38.0 38.0 38.0 35.2 38.0 100-104 36.292500000000004 38.0 38.0 38.0 34.2 38.0 105-109 35.13494999999999 38.0 36.6 38.0 28.6 38.0 110-114 34.7454 38.0 37.0 38.0 27.8 38.0 115-119 34.15955 38.0 36.6 38.0 22.6 38.0 120-124 33.950900000000004 38.0 36.0 38.0 20.6 38.0 125-129 34.07555 38.0 36.0 38.0 21.8 38.0 130-134 34.66485 38.0 35.6 38.0 25.8 38.0 135-139 34.915949999999995 38.0 36.0 38.0 29.0 38.0 140-144 34.5107 38.0 34.8 38.0 27.0 38.0 145-149 33.8608 38.0 33.6 38.0 24.6 38.0 150-151 29.401875 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 1.0 5 2.0 6 0.0 7 1.0 8 2.0 9 1.0 10 1.0 11 1.0 12 3.0 13 4.0 14 2.0 15 1.0 16 1.0 17 3.0 18 5.0 19 1.0 20 7.0 21 10.0 22 8.0 23 15.0 24 17.0 25 10.0 26 16.0 27 15.0 28 19.0 29 39.0 30 73.0 31 77.0 32 107.0 33 140.0 34 141.0 35 237.0 36 615.0 37 2414.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.324999999999996 20.1 14.249999999999998 26.325 2 26.875 26.05 30.225 16.85 3 21.0 28.449999999999996 29.2 21.349999999999998 4 23.45 33.375 23.125 20.05 5 24.575 35.075 22.525000000000002 17.825 6 21.375 37.55 23.025000000000002 18.05 7 21.0 20.775 38.550000000000004 19.675 8 22.125 25.95 28.125 23.799999999999997 9 23.075000000000003 25.025 28.9 23.0 10-14 23.380000000000003 28.21 26.435 21.975 15-19 23.445 27.450000000000003 27.744999999999997 21.36 20-24 23.21 27.91 27.74 21.14 25-29 23.96 28.310000000000002 27.36 20.369999999999997 30-34 23.31 28.12 27.485 21.085 35-39 22.88 28.095 27.66 21.365000000000002 40-44 23.59 28.225 27.534999999999997 20.65 45-49 23.165 27.96 27.595 21.279999999999998 50-54 23.575 27.295 27.815 21.315 55-59 23.215 27.83 28.615000000000002 20.34 60-64 23.400000000000002 27.665 28.32 20.615 65-69 23.635 27.275 28.595 20.495 70-74 23.91 27.73 28.015 20.345 75-79 23.833543505674655 27.510718789407314 28.030264817150062 20.62547288776797 80-84 23.425414364640883 27.759919638372676 27.72978402812657 21.084881968859868 85-89 23.93 28.1 27.775 20.195 90-94 23.615 27.615000000000002 28.105000000000004 20.665 95-99 23.445 28.189999999999998 27.779999999999998 20.585 100-104 24.387193596798397 27.603801900950476 27.648824412206103 20.36018009004502 105-109 24.19647355163728 27.022670025188916 28.387909319899247 20.392947103274558 110-114 24.48662907981172 27.497025810789843 27.698753426783217 20.31759168261522 115-119 24.659049023221527 27.018061186877993 27.839502922436942 20.483386867463533 120-124 24.454080033434334 27.118378434855295 27.72437571831575 20.70316581339463 125-129 24.9569617611769 27.857478220042776 27.20016693619907 19.98539308258125 130-134 25.72121457080786 27.408679836305765 27.085333198605564 19.784772394280807 135-139 25.61 27.12 27.49 19.78 140-144 25.835 27.065 27.375 19.725 145-149 26.16 27.860000000000003 26.43 19.55 150-151 26.85 26.3625 27.0875 19.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 1.0 26 2.0 27 2.5 28 2.5 29 3.5 30 8.0 31 17.5 32 25.5 33 26.0 34 38.5 35 63.0 36 77.5 37 98.5 38 132.5 39 169.5 40 202.0 41 226.5 42 261.5 43 281.0 44 268.0 45 280.5 46 286.0 47 253.0 48 244.0 49 208.0 50 160.0 51 142.0 52 123.5 53 107.0 54 82.5 55 55.5 56 41.0 57 28.5 58 16.0 59 17.0 60 12.0 61 5.0 62 8.0 63 8.0 64 4.5 65 3.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.8750000000000001 80-84 0.44999999999999996 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.75 110-114 3.335 115-119 5.045 120-124 4.29 125-129 4.154999999999999 130-134 1.035 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.0125000000000002 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.825 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.8 0.0 0.0 0.0 0.0 110-111 3.175 0.0 0.0 0.0 0.0 112-113 3.4875 0.0 0.0 0.0 0.0 114-115 3.925 0.0 0.0 0.0 0.0 116-117 4.55 0.0 0.0 0.0 0.0 118-119 5.0625 0.0 0.0 0.0 0.0 120-121 5.65 0.0 0.0 0.0 0.0 122-123 6.112500000000001 0.0 0.0 0.0 0.0 124-125 6.55 0.0 0.0 0.0 0.0 126-127 7.125 0.0 0.0 0.0 0.0 128-129 7.8125 0.0 0.0 0.0 0.0 130-131 8.3375 0.0 0.0 0.0 0.0 132-133 9.1 0.0 0.0 0.0 0.0 134-135 9.9875 0.0 0.0 0.0 0.0 136-137 10.65 0.0 0.0 0.0 0.0 138-139 11.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGGAT 10 0.007088928 143.21251 7 TCCTGGT 20 3.7692182E-4 107.40938 145 AAAAAAA 20 0.005498888 29.452442 100-104 >>END_MODULE Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514525 spots for SRR7169755.sra Written 514525 spots for SRR7169755.sra Read 514536 spots for SRR7169755.sra Written 514536 spots for SRR7169755.sra SRR ids: ['SRR7169755.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p3_xit0m SRR7169755.sra spots: 10290511 blocks: [[1, 514525], [514526, 1029050], [1029051, 1543575], [1543576, 2058100], [2058101, 2572625], [2572626, 3087150], [3087151, 3601675], [3601676, 4116200], [4116201, 4630725], [4630726, 5145250], [5145251, 5659775], [5659776, 6174300], [6174301, 6688825], [6688826, 7203350], [7203351, 7717875], [7717876, 8232400], [8232401, 8746925], [8746926, 9261450], [9261451, 9775975], [9775976, 10290511]] SRR7169755 file size 3465416 SRR7169755 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169755 SRR7169755_1.fastq SRR7169755_2.fastq Input file: SRR7169755_1.fastq Paired file: SRR7169755_2.fastq trimmed: SRR7169755-trimmed-pair1.fastq, SRR7169755-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:33:52 2025 >> started Tue Feb 11 13:34:02 2025 >> done (10.636s) 10290511 read pairs processed; of these: 7229 ( 0.07%) short read pairs filtered out after trimming by size control 10279 ( 0.10%) empty read pairs filtered out after trimming by size control 10273003 (99.83%) read pairs available; of these: 5070386 (49.36%) trimmed read pairs available after processing 5202617 (50.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 0 0.00% 24 3 0.00% 25 1 0.00% 26 4 0.00% 27 4 0.00% 28 2 0.00% 29 3 0.00% 30 3 0.00% 31 20 0.00% 32 6 0.00% 33 13 0.00% 34 7 0.00% 35 1 0.00% 36 7 0.00% 37 7 0.00% 38 13 0.00% 39 19 0.00% 40 17 0.00% 41 16 0.00% 42 18 0.00% 43 17 0.00% 44 17 0.00% 45 31 0.00% 46 30 0.00% 47 24 0.00% 48 49 0.00% 49 57 0.00% 50 56 0.00% 51 87 0.00% 52 83 0.00% 53 80 0.00% 54 86 0.00% 55 120 0.00% 56 134 0.00% 57 138 0.00% 58 141 0.00% 59 185 0.00% 60 218 0.00% 61 285 0.00% 62 301 0.00% 63 334 0.00% 64 339 0.00% 65 453 0.00% 66 474 0.00% 67 576 0.01% 68 578 0.01% 69 660 0.01% 70 823 0.01% 71 940 0.01% 72 1086 0.01% 73 1371 0.01% 74 1438 0.01% 75 1615 0.02% 76 1880 0.02% 77 2077 0.02% 78 2244 0.02% 79 2420 0.02% 80 2636 0.03% 81 3165 0.03% 82 3478 0.03% 83 4088 0.04% 84 4870 0.05% 85 5529 0.05% 86 6014 0.06% 87 6447 0.06% 88 6909 0.07% 89 7113 0.07% 90 7998 0.08% 91 8549 0.08% 92 9214 0.09% 93 9979 0.10% 94 10937 0.11% 95 11559 0.11% 96 12253 0.12% 97 12935 0.13% 98 13549 0.13% 99 14041 0.14% 100 14829 0.14% 101 15637 0.15% 102 16726 0.16% 103 17846 0.17% 104 18698 0.18% 105 19975 0.19% 106 20766 0.20% 107 21392 0.21% 108 21692 0.21% 109 22511 0.22% 110 23097 0.22% 111 23937 0.23% 112 25036 0.24% 113 26541 0.26% 114 27459 0.27% 115 28698 0.28% 116 29353 0.29% 117 30176 0.29% 118 30625 0.30% 119 30996 0.30% 120 32058 0.31% 121 32463 0.32% 122 33542 0.33% 123 34929 0.34% 124 36722 0.36% 125 37787 0.37% 126 39273 0.38% 127 39945 0.39% 128 41168 0.40% 129 41232 0.40% 130 42542 0.41% 131 42783 0.42% 132 44405 0.43% 133 46001 0.45% 134 47182 0.46% 135 49116 0.48% 136 50682 0.49% 137 52670 0.51% 138 54588 0.53% 139 56873 0.55% 140 59057 0.57% 141 63772 0.62% 142 68183 0.66% 143 72802 0.71% 144 82365 0.80% 145 95253 0.93% 146 113034 1.10% 147 150437 1.46% 148 217678 2.12% 149 426489 4.15% 150 2216483 21.58% 151 5202617 50.64% 10273003 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=44 prefix-density=0.21 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=46 fanout-score=252.26 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=17.9 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=44 prefix-density=0.21 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=14 fanout-score=51.44 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=13.9 sequence=TGTTGGTGGTGG SRR7169755 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:34:45 Started mapping on | Feb 11 13:34:45 Finished on | Feb 11 13:35:47 Mapping speed, Million of reads per hour | 596.50 Number of input reads | 10273003 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 9736675 Uniquely mapped reads % | 94.78% Average mapped length | 290.52 Number of splices: Total | 8573309 Number of splices: Annotated (sjdb) | 8420852 Number of splices: GT/AG | 8447681 Number of splices: GC/AG | 98616 Number of splices: AT/AC | 7195 Number of splices: Non-canonical | 19817 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 198279 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 11937 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 345393 345393 345393 N_multimapping 198279 198279 198279 N_noFeature 246143 9615754 297628 N_ambiguous 109646 981 39418 UnstrandedReadsAssigned:9380886 PositiveStrandReadsAssigned:119940 NegativeStrandReadsAssigned:9399629 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169755 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169755-trimmed-pair1.fastq SRR7169755-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,273,003 reads, 9,349,740 reads pseudoaligned [quant] estimated average fragment length: 211.821 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7169755.ke.tsv 34699 SRR7169755.se.tsv 87100 total ==> SRR7169755.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.18 139 8.09408 Potri.005G024800.1.v4.1 1035 824.179 20 2.55366 Potri.004G059700.1.v4.1 961 750.189 1 0.140276 Potri.007G009000.2.v4.1 1416 1205.18 0 0 Potri.003G141000.2.v4.1 2943 2732.18 139.032 5.35501 Potri.016G087400.1.v4.1 270 92.1312 997.112 1138.91 Potri.015G069301.1.v4.1 564 355.318 0 0 Potri.010G195200.1.v4.1 1773 1562.18 26 1.75144 Potri.012G127500.1.v4.1 977 766.189 3118 428.247 ==> SRR7169755.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1156 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169755 completed mapping pipeline successfully