Starting /dee2/code/volunteer_pipeline.sh SRR7169756 current disk space = 3050307928064 free memory = 1212167812 SRR7169756 SRAfilesize c9d60e1533bfd6ae4fa582f18b319517 SRR7169756.sra SRR7169756.sra file validated SRR7169756 is paired end SRR7169756 is conventional basespace SRR7169756 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169756_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.262 33.0 32.0 33.0 27.0 34.0 2 32.395 33.0 33.0 34.0 29.0 34.0 3 32.83475 33.0 33.0 34.0 31.0 34.0 4 32.775 33.0 33.0 34.0 31.0 34.0 5 33.22325 34.0 33.0 34.0 33.0 34.0 6 37.23625 38.0 37.0 38.0 36.0 38.0 7 37.50475 38.0 38.0 38.0 37.0 38.0 8 37.662 38.0 38.0 38.0 38.0 38.0 9 37.711 38.0 38.0 38.0 38.0 38.0 10-14 37.7217 38.0 38.0 38.0 38.0 38.0 15-19 37.7112 38.0 38.0 38.0 38.0 38.0 20-24 37.7427 38.0 38.0 38.0 38.0 38.0 25-29 37.750099999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.7117 38.0 38.0 38.0 38.0 38.0 35-39 37.71464999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.671150000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.642849999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.51345 38.0 38.0 38.0 38.0 38.0 55-59 37.6068 38.0 38.0 38.0 38.0 38.0 60-64 37.5117 38.0 38.0 38.0 38.0 38.0 65-69 37.48675 38.0 38.0 38.0 37.8 38.0 70-74 37.504650000000005 38.0 38.0 38.0 38.0 38.0 75-79 37.43915 38.0 38.0 38.0 37.4 38.0 80-84 37.40915 38.0 38.0 38.0 37.0 38.0 85-89 37.356899999999996 38.0 38.0 38.0 37.0 38.0 90-94 37.2193 38.0 38.0 38.0 36.8 38.0 95-99 37.27045 38.0 38.0 38.0 37.0 38.0 100-104 37.147499999999994 38.0 38.0 38.0 36.6 38.0 105-109 36.6485 38.0 38.0 38.0 35.6 38.0 110-114 36.69265 38.0 38.0 38.0 35.8 38.0 115-119 36.92405 38.0 38.0 38.0 35.8 38.0 120-124 36.89335 38.0 38.0 38.0 35.0 38.0 125-129 36.7118 38.0 38.0 38.0 34.8 38.0 130-134 36.52025 38.0 38.0 38.0 34.0 38.0 135-139 36.3123 38.0 38.0 38.0 34.0 38.0 140-144 35.94315 38.0 36.8 38.0 33.0 38.0 145-149 35.656499999999994 38.0 36.4 38.0 32.8 38.0 150-151 32.633250000000004 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 4.0 20 2.0 21 3.0 22 2.0 23 3.0 24 6.0 25 3.0 26 1.0 27 7.0 28 11.0 29 14.0 30 18.0 31 34.0 32 37.0 33 53.0 34 97.0 35 169.0 36 408.0 37 3127.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.704038123902684 11.81339352896915 7.875595685979434 40.60697266114873 2 21.575 15.15 34.475 28.799999999999997 3 20.724999999999998 19.925 24.65 34.699999999999996 4 24.375 29.15 22.3 24.175 5 23.925 33.375 23.65 19.05 6 18.175 37.15 24.05 20.625 7 14.2 26.325 43.125 16.35 8 17.825 24.45 31.75 25.974999999999998 9 17.525 23.65 33.825 25.0 10-14 20.285 30.025000000000002 26.735 22.955000000000002 15-19 19.509999999999998 28.82 27.735 23.935000000000002 20-24 19.695 28.455000000000002 27.884999999999998 23.965 25-29 19.744999999999997 28.825 27.785 23.645 30-34 19.97 28.22 28.4 23.41 35-39 19.945 29.175 27.11 23.77 40-44 19.814999999999998 28.939999999999998 27.575 23.669999999999998 45-49 20.31 28.055000000000003 27.98 23.655 50-54 20.244999999999997 28.915000000000003 27.634999999999998 23.205000000000002 55-59 19.445 29.160000000000004 27.884999999999998 23.51 60-64 19.218632607062357 28.98071625344353 27.798647633358375 24.00200350613574 65-69 19.855 28.835 27.779999999999998 23.53 70-74 19.865 28.975 27.66 23.5 75-79 20.005 28.48 27.815 23.7 80-84 19.905 28.675 27.735 23.685000000000002 85-89 20.349999999999998 28.405 27.47 23.775 90-94 20.315 28.744999999999997 27.85 23.09 95-99 20.630000000000003 27.6 28.360000000000003 23.41 100-104 20.54595542198848 28.35962935136489 27.473077886301027 23.621337340345605 105-109 20.42744543249798 28.875303152789005 27.303961196443005 23.393290218270007 110-114 20.573389864728448 28.518069856652534 27.4076317383404 23.50090854027862 115-119 20.665 28.310000000000002 27.255000000000003 23.77 120-124 20.544999999999998 28.565 26.87 24.02 125-129 21.240000000000002 28.525 26.529999999999998 23.705000000000002 130-134 21.2 28.13 26.674999999999997 23.995 135-139 21.3 28.23 26.490000000000002 23.98 140-144 20.9 28.435 26.515 24.15 145-149 21.01 28.065 26.575 24.349999999999998 150-151 20.5875 28.4 26.125 24.887500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 2.0 24 2.5 25 2.5 26 3.0 27 7.0 28 10.0 29 13.0 30 23.5 31 30.5 32 29.0 33 42.0 34 60.5 35 61.5 36 85.5 37 114.0 38 141.5 39 164.5 40 195.0 41 218.0 42 226.5 43 260.5 44 280.5 45 264.5 46 267.0 47 269.5 48 236.5 49 200.5 50 181.0 51 164.0 52 122.0 53 93.5 54 72.0 55 39.0 56 23.5 57 28.5 58 20.0 59 9.0 60 6.5 61 4.5 62 4.0 63 4.5 64 4.0 65 1.5 66 1.5 67 3.0 68 2.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.17500000000000002 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.17500000000000002 105-109 1.04 110-114 0.9400000000000001 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.2625 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.7000000000000002 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.7625 0.0 0.0 0.0 0.0 110-111 3.0625 0.0 0.0 0.0 0.0 112-113 3.3625 0.0 0.0 0.0 0.0 114-115 3.7375 0.0 0.0 0.0 0.0 116-117 4.25 0.0 0.0 0.0 0.0 118-119 4.9875 0.0 0.0 0.0 0.0 120-121 5.5875 0.0 0.0 0.0 0.0 122-123 5.8875 0.0 0.0 0.0 0.0 124-125 6.45 0.0 0.0 0.0 0.0 126-127 6.987500000000001 0.0 0.0 0.0 0.0 128-129 7.475 0.0 0.0 0.0 0.0 130-131 8.162500000000001 0.0 0.0 0.0 0.0 132-133 8.587499999999999 0.0 0.0 0.0 0.0 134-135 9.1375 0.0 0.0 0.0 0.0 136-137 9.95 0.0 0.0 0.0 0.0 138-139 10.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATTA 10 0.006892826 144.5625 4 TTTTATC 10 0.006892826 144.5625 6 TTCTATT 10 0.006892826 144.5625 2 TGTGTTT 10 0.006892826 144.5625 8 >>END_MODULE SRR7169756 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169756_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15975 34.0 33.0 34.0 33.0 34.0 2 33.15925 34.0 33.0 34.0 33.0 34.0 3 33.2675 34.0 33.0 34.0 33.0 34.0 4 33.2005 34.0 33.0 34.0 33.0 34.0 5 33.24 34.0 33.0 34.0 33.0 34.0 6 37.49275 38.0 38.0 38.0 38.0 38.0 7 37.474 38.0 38.0 38.0 38.0 38.0 8 37.476 38.0 38.0 38.0 38.0 38.0 9 37.48225 38.0 38.0 38.0 38.0 38.0 10-14 37.483 38.0 38.0 38.0 38.0 38.0 15-19 37.4529 38.0 38.0 38.0 38.0 38.0 20-24 37.390150000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.407999999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.342850000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.2824 38.0 38.0 38.0 37.8 38.0 40-44 37.29345 38.0 38.0 38.0 37.6 38.0 45-49 37.26485 38.0 38.0 38.0 37.4 38.0 50-54 37.16765 38.0 38.0 38.0 37.0 38.0 55-59 36.953649999999996 38.0 38.0 38.0 36.2 38.0 60-64 36.37555 38.0 37.8 38.0 33.0 38.0 65-69 37.20945 38.0 38.0 38.0 37.0 38.0 70-74 36.924549999999996 38.0 38.0 38.0 37.0 38.0 75-79 35.96995 38.0 38.0 38.0 35.4 38.0 80-84 36.592999999999996 38.0 38.0 38.0 35.6 38.0 85-89 37.05255 38.0 38.0 38.0 36.8 38.0 90-94 37.0603 38.0 38.0 38.0 36.8 38.0 95-99 36.93730000000001 38.0 38.0 38.0 36.0 38.0 100-104 36.622 38.0 38.0 38.0 35.6 38.0 105-109 35.2509 38.0 38.0 38.0 32.0 38.0 110-114 34.11035 38.0 37.8 38.0 21.6 38.0 115-119 33.42925 38.0 37.0 38.0 13.8 38.0 120-124 33.44 38.0 36.2 38.0 15.6 38.0 125-129 34.12455 38.0 36.6 38.0 22.2 38.0 130-134 35.08225 38.0 37.0 38.0 28.2 38.0 135-139 35.38975000000001 38.0 37.2 38.0 32.0 38.0 140-144 34.535450000000004 38.0 35.0 38.0 26.8 38.0 145-149 34.65 38.0 35.8 38.0 29.4 38.0 150-151 30.728125 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 2.0 11 0.0 12 1.0 13 0.0 14 1.0 15 2.0 16 3.0 17 4.0 18 5.0 19 3.0 20 6.0 21 7.0 22 10.0 23 25.0 24 16.0 25 15.0 26 16.0 27 39.0 28 36.0 29 47.0 30 66.0 31 60.0 32 69.0 33 95.0 34 116.0 35 193.0 36 454.0 37 2695.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.434608652163035 20.655163790947736 13.678419604901226 27.231807951987996 2 25.494615577260205 25.31930879038317 32.2564487853744 16.929626846982217 3 20.150000000000002 27.775 31.525 20.549999999999997 4 23.15578894723681 34.00850212553138 23.88097024256064 18.95473868467117 5 24.95 35.85 21.6 17.599999999999998 6 19.2 38.475 24.099999999999998 18.224999999999998 7 21.224999999999998 19.35 40.025 19.400000000000002 8 22.35 25.1 28.225 24.325 9 20.9 24.9 30.7 23.5 10-14 22.74 28.1 27.22 21.94 15-19 22.74 27.24 28.67 21.349999999999998 20-24 23.169999999999998 27.97 27.465 21.395 25-29 23.002300230023 28.28782878287829 28.03780378037804 20.672067206720673 30-34 22.916145807290363 28.016400820041003 28.23641182059103 20.831041552077604 35-39 23.338168358925625 28.189866453258638 27.76471765117791 20.707247536637823 40-44 23.464692938587717 27.970594118823765 27.935587117423484 20.629125825165033 45-49 23.474999999999998 28.084999999999997 27.700000000000003 20.74 50-54 23.49 27.73 28.194999999999997 20.585 55-59 23.028059820937326 27.924773670784774 28.164857700195068 20.88230880808283 60-64 23.605 28.084999999999997 28.38 19.93 65-69 23.915 27.54 28.275 20.27 70-74 23.74075378654456 28.12358476324662 27.91224274140794 20.223418708800885 75-79 24.151449499638915 26.735788713504594 28.525740224904574 20.587021561951925 80-84 23.79200886783897 27.203103743638835 28.498009774777046 20.50687761374515 85-89 23.641182059102956 28.16640832041602 27.60138006900345 20.591029551477575 90-94 23.080000000000002 28.194999999999997 28.499999999999996 20.225 95-99 23.77 28.13 27.689999999999998 20.41 100-104 24.263857536995236 27.378981690494108 27.574617506897415 20.782543265613242 105-109 24.037612343498363 27.866382669229573 27.90794326978025 20.188061717491816 110-114 23.98710370768404 28.049435787211173 27.6732939279957 20.29016657710908 115-119 24.957684957684958 27.764127764127768 27.534807534807538 19.743379743379744 120-124 24.58795647958634 27.421092319293333 28.14822794355273 19.842723257567595 125-129 25.058102683287554 28.30128882315656 26.970209169659835 19.67039932389605 130-134 25.06041079339509 27.75875956504229 27.678211840515505 19.50261780104712 135-139 25.27 27.279999999999998 27.68 19.77 140-144 24.941247062353117 28.296414820741038 27.1863593179659 19.575978798939946 145-149 25.955000000000002 27.224999999999998 27.68 19.139999999999997 150-151 25.454316002019183 26.75416456335184 28.24331145885916 19.548207975769813 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.5 24 1.5 25 2.0 26 2.5 27 5.5 28 6.5 29 7.5 30 15.5 31 22.5 32 26.5 33 36.0 34 43.5 35 57.5 36 82.0 37 105.5 38 132.0 39 158.5 40 187.0 41 226.0 42 274.0 43 287.5 44 274.5 45 281.5 46 308.0 47 294.0 48 235.0 49 198.0 50 171.5 51 138.0 52 110.5 53 86.5 54 61.5 55 44.5 56 30.5 57 27.0 58 20.5 59 8.0 60 6.0 61 3.5 62 3.0 63 3.5 64 3.0 65 2.0 66 1.5 67 1.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.17500000000000002 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.005 35-39 0.034999999999999996 40-44 0.02 45-49 0.0 50-54 0.0 55-59 0.034999999999999996 60-64 0.0 65-69 0.0 70-74 0.635 75-79 3.0700000000000003 80-84 0.765 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.325 105-109 3.755 110-114 6.950000000000001 115-119 8.425 120-124 7.17 125-129 5.34 130-134 0.6799999999999999 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.95 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.6125 0.0 0.0 0.0 0.0 110-111 2.8875 0.0 0.0 0.0 0.0 112-113 3.2 0.0 0.0 0.0 0.0 114-115 3.5625 0.0 0.0 0.0 0.0 116-117 3.9625000000000004 0.0 0.0 0.0 0.0 118-119 4.6125 0.0 0.0 0.0 0.0 120-121 5.15 0.0 0.0 0.0 0.0 122-123 5.3875 0.0 0.0 0.0 0.0 124-125 5.9 0.0 0.0 0.0 0.0 126-127 6.4375 0.0 0.0 0.0 0.0 128-129 6.949999999999999 0.0 0.0 0.0 0.0 130-131 7.625 0.0 0.0 0.0 0.0 132-133 8.0625 0.0 0.0 0.0 0.0 134-135 8.625 0.0 0.0 0.0 0.0 136-137 9.45 0.0 0.0 0.0 0.0 138-139 10.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637152 spots for SRR7169756.sra Written 637152 spots for SRR7169756.sra Read 637157 spots for SRR7169756.sra Written 637157 spots for SRR7169756.sra SRR ids: ['SRR7169756.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_loldebb3 SRR7169756.sra spots: 12743045 blocks: [[1, 637152], [637153, 1274304], [1274305, 1911456], [1911457, 2548608], [2548609, 3185760], [3185761, 3822912], [3822913, 4460064], [4460065, 5097216], [5097217, 5734368], [5734369, 6371520], [6371521, 7008672], [7008673, 7645824], [7645825, 8282976], [8282977, 8920128], [8920129, 9557280], [9557281, 10194432], [10194433, 10831584], [10831585, 11468736], [11468737, 12105888], [12105889, 12743045]] SRR7169756 file size 4296499 SRR7169756 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169756 SRR7169756_1.fastq SRR7169756_2.fastq Input file: SRR7169756_1.fastq Paired file: SRR7169756_2.fastq trimmed: SRR7169756-trimmed-pair1.fastq, SRR7169756-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:27:06 2025 >> started Tue Feb 11 13:27:21 2025 >> done (15.394s) 12743045 read pairs processed; of these: 7156 ( 0.06%) short read pairs filtered out after trimming by size control 8690 ( 0.07%) empty read pairs filtered out after trimming by size control 12727199 (99.88%) read pairs available; of these: 5585214 (43.88%) trimmed read pairs available after processing 7141985 (56.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 4 0.00% 21 3 0.00% 22 3 0.00% 23 3 0.00% 24 4 0.00% 25 1 0.00% 26 4 0.00% 27 7 0.00% 28 2 0.00% 29 4 0.00% 30 3 0.00% 31 4 0.00% 32 9 0.00% 33 10 0.00% 34 7 0.00% 35 11 0.00% 36 10 0.00% 37 8 0.00% 38 24 0.00% 39 28 0.00% 40 25 0.00% 41 44 0.00% 42 45 0.00% 43 43 0.00% 44 46 0.00% 45 44 0.00% 46 62 0.00% 47 52 0.00% 48 79 0.00% 49 94 0.00% 50 101 0.00% 51 123 0.00% 52 136 0.00% 53 140 0.00% 54 173 0.00% 55 203 0.00% 56 182 0.00% 57 229 0.00% 58 233 0.00% 59 305 0.00% 60 347 0.00% 61 406 0.00% 62 481 0.00% 63 590 0.00% 64 631 0.00% 65 654 0.01% 66 684 0.01% 67 834 0.01% 68 902 0.01% 69 1070 0.01% 70 1167 0.01% 71 1353 0.01% 72 1536 0.01% 73 1871 0.01% 74 1956 0.02% 75 2169 0.02% 76 2471 0.02% 77 2572 0.02% 78 2794 0.02% 79 3101 0.02% 80 3540 0.03% 81 3978 0.03% 82 4716 0.04% 83 5033 0.04% 84 5957 0.05% 85 6666 0.05% 86 7116 0.06% 87 7424 0.06% 88 8022 0.06% 89 8376 0.07% 90 9308 0.07% 91 10293 0.08% 92 10933 0.09% 93 12261 0.10% 94 13162 0.10% 95 14073 0.11% 96 14700 0.12% 97 15138 0.12% 98 15773 0.12% 99 16143 0.13% 100 17324 0.14% 101 18032 0.14% 102 19626 0.15% 103 20559 0.16% 104 21903 0.17% 105 22622 0.18% 106 23358 0.18% 107 24134 0.19% 108 24833 0.20% 109 25225 0.20% 110 25746 0.20% 111 27075 0.21% 112 28349 0.22% 113 29142 0.23% 114 30313 0.24% 115 31665 0.25% 116 32937 0.26% 117 33069 0.26% 118 33505 0.26% 119 33737 0.27% 120 34097 0.27% 121 35313 0.28% 122 36298 0.29% 123 37426 0.29% 124 38648 0.30% 125 40148 0.32% 126 42100 0.33% 127 42477 0.33% 128 42945 0.34% 129 43663 0.34% 130 44565 0.35% 131 44409 0.35% 132 46341 0.36% 133 47205 0.37% 134 48768 0.38% 135 50613 0.40% 136 52428 0.41% 137 54375 0.43% 138 56157 0.44% 139 58344 0.46% 140 60973 0.48% 141 64350 0.51% 142 69601 0.55% 143 73765 0.58% 144 83974 0.66% 145 92778 0.73% 146 110168 0.87% 147 143474 1.13% 148 210804 1.66% 149 435233 3.42% 150 2597910 20.41% 151 7141985 56.12% 12727199 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=46 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=46 fanout-score=224.82 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=17.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=31 prefix-density=0.29 prefix-fanout=2.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=33 fanout-score=240.76 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=25.9 sequence=GAAGAAGAAGAAA SRR7169756 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:28:14 Started mapping on | Feb 11 13:28:14 Finished on | Feb 11 13:29:31 Mapping speed, Million of reads per hour | 595.04 Number of input reads | 12727199 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12170036 Uniquely mapped reads % | 95.62% Average mapped length | 291.58 Number of splices: Total | 11609019 Number of splices: Annotated (sjdb) | 11416465 Number of splices: GT/AG | 11435412 Number of splices: GC/AG | 137918 Number of splices: AT/AC | 9497 Number of splices: Non-canonical | 26192 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 228263 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 14724 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.44% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 336515 336515 336515 N_multimapping 228263 228263 228263 N_noFeature 318118 12031060 385783 N_ambiguous 119787 694 47969 UnstrandedReadsAssigned:11732131 PositiveStrandReadsAssigned:138282 NegativeStrandReadsAssigned:11736284 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169756 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169756-trimmed-pair1.fastq SRR7169756-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,727,199 reads, 11,665,574 reads pseudoaligned [quant] estimated average fragment length: 221.914 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52401 SRR7169756.ke.tsv 34699 SRR7169756.se.tsv 87100 total ==> SRR7169756.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.09 201 10.326 Potri.005G024800.1.v4.1 1035 814.086 35 3.9692 Potri.004G059700.1.v4.1 961 740.097 0 0 Potri.007G009000.2.v4.1 1416 1195.09 0 0 Potri.003G141000.2.v4.1 2943 2722.09 265.112 8.99152 Potri.016G087400.1.v4.1 270 90.209 915 936.432 Potri.015G069301.1.v4.1 564 346.039 0 0 Potri.010G195200.1.v4.1 1773 1552.09 30 1.78448 Potri.012G127500.1.v4.1 977 756.091 3815 465.828 ==> SRR7169756.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1145 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 153 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169756 completed mapping pipeline successfully