Starting /dee2/code/volunteer_pipeline.sh SRR7169757 current disk space = 3050354524160 free memory = 1479209768 SRR7169757 SRAfilesize e966b05ccab976dd23ed736d14d75e18 SRR7169757.sra SRR7169757.sra file validated SRR7169757 is paired end SRR7169757 is conventional basespace SRR7169757 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169757_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.86125 25.0 18.0 32.0 18.0 33.0 2 30.61125 32.0 30.0 33.0 27.0 33.0 3 30.68075 31.0 29.0 33.0 27.0 33.0 4 30.37125 31.0 29.0 33.0 27.0 33.0 5 32.19775 33.0 32.0 33.0 31.0 33.0 6 36.34075 38.0 36.0 38.0 34.0 38.0 7 37.0055 38.0 37.0 38.0 35.0 38.0 8 37.475 38.0 38.0 38.0 37.0 38.0 9 37.52325 38.0 38.0 38.0 37.0 38.0 10-14 37.58539999999999 38.0 38.0 38.0 37.8 38.0 15-19 37.6353 38.0 38.0 38.0 38.0 38.0 20-24 37.62065 38.0 38.0 38.0 38.0 38.0 25-29 37.596199999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.56575 38.0 38.0 38.0 38.0 38.0 35-39 37.49569999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.4342 38.0 38.0 38.0 37.4 38.0 45-49 37.4829 38.0 38.0 38.0 38.0 38.0 50-54 37.403549999999996 38.0 38.0 38.0 37.2 38.0 55-59 37.2763 38.0 38.0 38.0 36.8 38.0 60-64 37.279199999999996 38.0 38.0 38.0 36.6 38.0 65-69 37.27425000000001 38.0 38.0 38.0 36.8 38.0 70-74 37.311 38.0 38.0 38.0 37.0 38.0 75-79 37.1281 38.0 38.0 38.0 37.0 38.0 80-84 37.0096 38.0 38.0 38.0 36.2 38.0 85-89 36.908699999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.93425 38.0 38.0 38.0 36.0 38.0 95-99 36.917 38.0 38.0 38.0 36.0 38.0 100-104 36.837399999999995 38.0 38.0 38.0 36.0 38.0 105-109 36.6307 38.0 38.0 38.0 35.0 38.0 110-114 36.4138 38.0 38.0 38.0 34.0 38.0 115-119 36.3887 38.0 38.0 38.0 34.0 38.0 120-124 36.4598 38.0 38.0 38.0 34.0 38.0 125-129 36.31785 38.0 38.0 38.0 34.0 38.0 130-134 36.066250000000004 38.0 37.4 38.0 33.0 38.0 135-139 35.70195 38.0 36.4 38.0 32.4 38.0 140-144 35.358 38.0 36.0 38.0 31.0 38.0 145-149 35.242200000000004 38.0 36.0 38.0 31.0 38.0 150-151 31.866500000000002 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 3.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 2.0 16 0.0 17 3.0 18 2.0 19 6.0 20 3.0 21 5.0 22 4.0 23 4.0 24 3.0 25 2.0 26 10.0 27 8.0 28 16.0 29 14.0 30 27.0 31 40.0 32 62.0 33 86.0 34 126.0 35 211.0 36 622.0 37 2737.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.790790790790794 11.611611611611613 9.25925925925926 38.33833833833834 2 21.6 14.249999999999998 33.800000000000004 30.349999999999998 3 21.475 18.475 25.25 34.8 4 23.825 27.250000000000004 22.175 26.75 5 22.925 31.025000000000002 25.424999999999997 20.625 6 20.125 34.55 24.275 21.05 7 13.825000000000001 26.75 41.325 18.099999999999998 8 17.08781586189642 25.544158118588946 31.023267450587944 26.344758568926697 9 16.1 25.7 34.225 23.974999999999998 10-14 20.445 29.599999999999998 27.105 22.85 15-19 19.895 28.705000000000002 27.315 24.085 20-24 19.84 28.84 27.175 24.145 25-29 20.035 29.185 27.505000000000003 23.275000000000002 30-34 19.759999999999998 29.09 27.834999999999997 23.315 35-39 20.035 29.049999999999997 27.76 23.155 40-44 20.085 29.189999999999998 27.235 23.49 45-49 20.380000000000003 28.7 27.025 23.895 50-54 19.89 28.665000000000003 27.73 23.715 55-59 19.555 29.315 27.275 23.855 60-64 20.31 28.925 26.974999999999998 23.79 65-69 20.035 28.660000000000004 27.775 23.53 70-74 20.345 28.615000000000002 27.145000000000003 23.895 75-79 20.525 28.235 27.889999999999997 23.35 80-84 20.34 28.425 27.325 23.91 85-89 19.955000000000002 28.505000000000003 27.560000000000002 23.98 90-94 20.64 28.02 27.334999999999997 24.005000000000003 95-99 20.305 28.610000000000003 27.43 23.655 100-104 20.085 28.470000000000002 27.205000000000002 24.240000000000002 105-109 20.46252633691181 28.624460720377243 26.818501053476474 24.094511889234475 110-114 20.518358531317496 28.348987894921894 26.90742880104475 24.225224772715855 115-119 21.015 28.110000000000003 26.735 24.14 120-124 20.825 28.23 26.72 24.224999999999998 125-129 21.5 27.939999999999998 26.590000000000003 23.97 130-134 21.08 28.360000000000003 26.545 24.015 135-139 21.11316697504626 28.00920138020703 26.098914837225585 24.77871680752113 140-144 21.556466940082025 28.05841752525758 26.077823347004102 24.307292187656294 145-149 21.18 28.075 25.835 24.91 150-151 21.327665958244783 27.740967620952617 25.703212901612705 25.2281535191899 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 3.5 27 6.0 28 9.5 29 12.5 30 17.5 31 25.5 32 38.0 33 44.5 34 51.0 35 62.5 36 80.0 37 114.5 38 139.5 39 151.0 40 171.5 41 205.5 42 236.5 43 267.5 44 283.5 45 268.0 46 259.5 47 253.0 48 237.0 49 213.0 50 176.0 51 146.0 52 117.5 53 98.0 54 84.0 55 61.5 56 44.0 57 28.0 58 18.0 59 14.5 60 13.5 61 10.0 62 5.0 63 4.5 64 5.5 65 5.0 66 2.0 67 1.0 68 3.0 69 2.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.075 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.33 110-114 0.455 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.015 140-144 0.03 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.68087265347539 97.25 2 1.2937595129375952 2.55 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025367833587011668 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 8 0.2 TruSeq Adapter, Index 19 (97% over 38bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.38749999999999996 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.5874999999999999 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.9624999999999999 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.2999999999999998 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.925 0.0 0.0 0.0 0.0 102-103 2.175 0.0 0.0 0.0 0.0 104-105 2.425 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.55 0.0 0.0 0.0 0.0 110-111 3.9125 0.0 0.0 0.0 0.0 112-113 4.375 0.0 0.0 0.0 0.0 114-115 5.012499999999999 0.0 0.0 0.0 0.0 116-117 5.4625 0.0 0.0 0.0 0.0 118-119 6.112500000000001 0.0 0.0 0.0 0.0 120-121 6.737500000000001 0.0 0.0 0.0 0.0 122-123 7.324999999999999 0.0 0.0 0.0 0.0 124-125 7.8625 0.0 0.0 0.0 0.0 126-127 8.4375 0.0 0.0 0.0 0.0 128-129 9.037500000000001 0.0 0.0 0.0 0.0 130-131 9.6625 0.0 0.0 0.0 0.0 132-133 10.225 0.0 0.0 0.0 0.0 134-135 10.9875 0.0 0.0 0.0 0.0 136-137 11.962499999999999 0.0 0.0 0.0 0.0 138-139 12.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATTT 10 0.006630061 146.43037 3 CGGCAGT 10 0.0068874825 144.6 1 AAGCTAT 10 0.0068874825 144.6 145 >>END_MODULE SRR7169757 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169757_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92725 33.0 33.0 34.0 32.0 34.0 2 33.0055 34.0 33.0 34.0 32.0 34.0 3 33.06825 34.0 33.0 34.0 33.0 34.0 4 33.034 34.0 33.0 34.0 33.0 34.0 5 32.92175 34.0 33.0 34.0 32.0 34.0 6 37.13325 38.0 38.0 38.0 37.0 38.0 7 37.05875 38.0 38.0 38.0 37.0 38.0 8 37.08925 38.0 38.0 38.0 37.0 38.0 9 37.0875 38.0 38.0 38.0 37.0 38.0 10-14 37.05305 38.0 38.0 38.0 36.8 38.0 15-19 37.00815 38.0 38.0 38.0 37.0 38.0 20-24 36.9786 38.0 38.0 38.0 37.0 38.0 25-29 36.91959999999999 38.0 38.0 38.0 36.8 38.0 30-34 36.77 38.0 38.0 38.0 36.4 38.0 35-39 36.58370000000001 38.0 38.0 38.0 35.6 38.0 40-44 36.7041 38.0 38.0 38.0 36.0 38.0 45-49 36.7157 38.0 38.0 38.0 36.0 38.0 50-54 36.26505 38.0 38.0 38.0 33.6 38.0 55-59 36.16315 38.0 37.6 38.0 33.0 38.0 60-64 36.571250000000006 38.0 38.0 38.0 35.4 38.0 65-69 36.7735 38.0 38.0 38.0 36.0 38.0 70-74 36.46765 38.0 38.0 38.0 35.4 38.0 75-79 35.734100000000005 38.0 38.0 38.0 33.8 38.0 80-84 36.1294 38.0 38.0 38.0 34.0 38.0 85-89 36.29365 38.0 38.0 38.0 34.6 38.0 90-94 36.32925 38.0 38.0 38.0 34.6 38.0 95-99 36.1325 38.0 38.0 38.0 33.8 38.0 100-104 35.9037 38.0 38.0 38.0 33.4 38.0 105-109 35.21885 38.0 37.8 38.0 31.0 38.0 110-114 33.754650000000005 38.0 36.2 38.0 19.8 38.0 115-119 33.76155 38.0 36.6 38.0 17.8 38.0 120-124 33.813700000000004 38.0 36.0 38.0 19.8 38.0 125-129 34.17135 38.0 36.0 38.0 23.6 38.0 130-134 34.60595 38.0 35.8 38.0 25.8 38.0 135-139 34.296299999999995 38.0 35.4 38.0 24.0 38.0 140-144 33.68695 38.0 34.8 38.0 21.2 38.0 145-149 33.32245 38.0 33.0 38.0 19.8 38.0 150-151 28.938125 35.5 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 8.0 4 5.0 5 3.0 6 2.0 7 3.0 8 0.0 9 1.0 10 2.0 11 2.0 12 1.0 13 5.0 14 5.0 15 7.0 16 7.0 17 2.0 18 5.0 19 5.0 20 9.0 21 10.0 22 18.0 23 12.0 24 23.0 25 16.0 26 16.0 27 20.0 28 63.0 29 51.0 30 56.0 31 77.0 32 87.0 33 115.0 34 145.0 35 236.0 36 549.0 37 2420.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.175 19.525000000000002 14.549999999999999 25.75 2 25.624999999999996 25.5 29.425 19.45 3 20.974999999999998 28.425 30.775000000000002 19.825 4 25.724999999999998 33.1 22.675 18.5 5 25.225225225225223 34.709709709709706 22.42242242242242 17.64264264264264 6 21.916437327995997 37.95346509882412 22.66700025018764 17.463097322992244 7 21.05 23.275000000000002 35.449999999999996 20.225 8 23.35 25.7 26.900000000000002 24.05 9 22.125 25.174999999999997 29.4 23.3 10-14 24.425 28.42 25.674999999999997 21.48 15-19 24.064625850340136 27.85114045618247 27.275910364145656 20.80832332933173 20-24 23.87409927942354 28.29263410728583 26.711369095276222 21.121897518014414 25-29 24.274709883953584 27.89115646258503 27.310924369747898 20.523209283713488 30-34 23.615977575332867 28.241065171688856 27.19991991190309 20.943037341075183 35-39 24.044044044044043 27.41741741741742 27.09209209209209 21.446446446446448 40-44 23.965784603071384 27.912560652293532 27.31229053073883 20.809364213896252 45-49 24.649579495394473 27.157589106928313 27.417901481778134 20.77492991589908 50-54 23.662860576923077 27.604166666666668 27.33874198717949 21.394230769230766 55-59 24.030658250676286 27.532311391644125 27.968139464983473 20.468890892696123 60-64 23.59005154381224 27.87369263874293 27.853675624280637 20.682580193164192 65-69 24.383410875981788 27.675221371754468 28.130471759467707 19.810895992796038 70-74 23.95634242027965 27.708480032189918 27.814103208932707 20.521074338597728 75-79 23.9846547314578 27.66240409207161 28.153452685421993 20.19948849104859 80-84 23.504553000955877 27.88650198722141 28.127987120792874 20.48095789102983 85-89 24.2765595273856 27.64093321317713 27.69099829778712 20.391508961650146 90-94 24.536897967357564 27.060178231701208 27.876239110844097 20.526684690097127 95-99 24.414414414414416 27.59259259259259 27.57757757757758 20.415415415415417 100-104 24.343125969671185 27.68630198688754 27.98158250337821 19.98898954006306 105-109 24.52849423998369 27.515546946681617 27.255581608726683 20.700377204608014 110-114 25.018318852716426 27.692871349314352 27.1747095153355 20.11410028263373 115-119 25.380036143297545 27.543318805145105 27.564579568406504 19.512065483150845 120-124 24.587329036315044 28.51752869045748 26.68343551852434 20.211706754703137 125-129 25.382342267613666 27.523458966250196 27.202032246358026 19.89216651977811 130-134 25.702508420047256 27.6981852913085 27.01955461720203 19.579751671442217 135-139 26.192263423910322 27.34324175549217 27.06800780663564 19.39648701396187 140-144 26.291549859831797 27.928514217060474 26.291549859831797 19.488386063275932 145-149 26.514165582140354 27.244969466413053 27.224947442186405 19.015917509260184 150-151 26.58908908908909 26.5015015015015 26.789289289289293 20.12012012012012 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 2.0 21 2.5 22 1.0 23 0.5 24 1.0 25 2.0 26 2.5 27 1.5 28 2.5 29 4.0 30 5.5 31 6.5 32 12.5 33 24.5 34 37.0 35 45.5 36 58.0 37 85.0 38 121.5 39 160.0 40 187.5 41 214.5 42 281.0 43 301.0 44 292.0 45 278.0 46 252.0 47 268.5 48 248.5 49 217.5 50 192.5 51 166.0 52 140.5 53 98.5 54 69.0 55 49.0 56 40.0 57 38.0 58 27.0 59 15.0 60 13.0 61 9.5 62 3.0 63 4.0 64 5.5 65 4.0 66 3.0 67 2.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.1 6 0.075 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.04 20-24 0.08 25-29 0.04 30-34 0.11 35-39 0.1 40-44 0.045 45-49 0.12 50-54 0.16 55-59 0.19 60-64 0.08499999999999999 65-69 0.055 70-74 0.59 75-79 2.25 80-84 0.615 85-89 0.13 90-94 0.13 95-99 0.1 100-104 0.095 105-109 1.91 110-114 4.47 115-119 5.93 120-124 4.585 125-129 3.5549999999999997 130-134 0.5349999999999999 135-139 0.08499999999999999 140-144 0.12 145-149 0.11 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83514813876931 97.575 2 1.139528994682198 2.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02532286654849329 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.38749999999999996 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.5874999999999999 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.9500000000000002 0.0 0.0 0.0 0.0 102-103 2.175 0.0 0.0 0.0 0.0 104-105 2.375 0.0 0.0 0.0 0.0 106-107 2.825 0.0 0.0 0.0 0.0 108-109 3.4375 0.0 0.0 0.0 0.0 110-111 3.75 0.0 0.0 0.0 0.0 112-113 4.175 0.0 0.0 0.0 0.0 114-115 4.8 0.0 0.0 0.0 0.0 116-117 5.225 0.0 0.0 0.0 0.0 118-119 5.875 0.0 0.0 0.0 0.0 120-121 6.45 0.0 0.0 0.0 0.0 122-123 7.0375 0.0 0.0 0.0 0.0 124-125 7.5875 0.0 0.0 0.0 0.0 126-127 8.1375 0.0 0.0 0.0 0.0 128-129 8.725 0.0 0.0 0.0 0.0 130-131 9.3125 0.0 0.0 0.0 0.0 132-133 9.825 0.0 0.0 0.0 0.0 134-135 10.6 0.0 0.0 0.0 0.0 136-137 11.575 0.0 0.0 0.0 0.0 138-139 12.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAATG 10 0.0070181494 143.67088 2 TCATAAA 10 0.0070181494 143.67088 145 ACAATGA 10 0.0070181494 143.67088 3 >>END_MODULE Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483220 spots for SRR7169757.sra Written 483220 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra Read 483203 spots for SRR7169757.sra Written 483203 spots for SRR7169757.sra SRR ids: ['SRR7169757.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aev7gj2x SRR7169757.sra spots: 9664077 blocks: [[1, 483203], [483204, 966406], [966407, 1449609], [1449610, 1932812], [1932813, 2416015], [2416016, 2899218], [2899219, 3382421], [3382422, 3865624], [3865625, 4348827], [4348828, 4832030], [4832031, 5315233], [5315234, 5798436], [5798437, 6281639], [6281640, 6764842], [6764843, 7248045], [7248046, 7731248], [7731249, 8214451], [8214452, 8697654], [8697655, 9180857], [9180858, 9664077]] SRR7169757 file size 3253794 SRR7169757 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169757 SRR7169757_1.fastq SRR7169757_2.fastq Input file: SRR7169757_1.fastq Paired file: SRR7169757_2.fastq trimmed: SRR7169757-trimmed-pair1.fastq, SRR7169757-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:42:59 2025 >> started Tue Feb 11 13:43:12 2025 >> done (13.036s) 9664077 read pairs processed; of these: 20889 ( 0.22%) short read pairs filtered out after trimming by size control 26287 ( 0.27%) empty read pairs filtered out after trimming by size control 9616901 (99.51%) read pairs available; of these: 4614072 (47.98%) trimmed read pairs available after processing 5002829 (52.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 10 0.00% 24 7 0.00% 25 7 0.00% 26 8 0.00% 27 8 0.00% 28 4 0.00% 29 8 0.00% 30 5 0.00% 31 6 0.00% 32 5 0.00% 33 12 0.00% 34 11 0.00% 35 11 0.00% 36 6 0.00% 37 10 0.00% 38 13 0.00% 39 12 0.00% 40 15 0.00% 41 25 0.00% 42 18 0.00% 43 24 0.00% 44 26 0.00% 45 32 0.00% 46 47 0.00% 47 34 0.00% 48 60 0.00% 49 41 0.00% 50 67 0.00% 51 78 0.00% 52 105 0.00% 53 113 0.00% 54 121 0.00% 55 139 0.00% 56 149 0.00% 57 193 0.00% 58 224 0.00% 59 249 0.00% 60 288 0.00% 61 329 0.00% 62 374 0.00% 63 413 0.00% 64 479 0.00% 65 528 0.01% 66 599 0.01% 67 619 0.01% 68 747 0.01% 69 850 0.01% 70 967 0.01% 71 1102 0.01% 72 1342 0.01% 73 1516 0.02% 74 1715 0.02% 75 2016 0.02% 76 2545 0.03% 77 2769 0.03% 78 2481 0.03% 79 2910 0.03% 80 3095 0.03% 81 3479 0.04% 82 3936 0.04% 83 4733 0.05% 84 6002 0.06% 85 6611 0.07% 86 7246 0.08% 87 7609 0.08% 88 8120 0.08% 89 8501 0.09% 90 9034 0.09% 91 9746 0.10% 92 10262 0.11% 93 11192 0.12% 94 12025 0.13% 95 12915 0.13% 96 13796 0.14% 97 14213 0.15% 98 14670 0.15% 99 15139 0.16% 100 16134 0.17% 101 16549 0.17% 102 17829 0.19% 103 19001 0.20% 104 19769 0.21% 105 20838 0.22% 106 22311 0.23% 107 22362 0.23% 108 23210 0.24% 109 24211 0.25% 110 24173 0.25% 111 25268 0.26% 112 26450 0.28% 113 27857 0.29% 114 28728 0.30% 115 29975 0.31% 116 30727 0.32% 117 31292 0.33% 118 31897 0.33% 119 31863 0.33% 120 32801 0.34% 121 33569 0.35% 122 34095 0.35% 123 35983 0.37% 124 37287 0.39% 125 38181 0.40% 126 39451 0.41% 127 40636 0.42% 128 40952 0.43% 129 41842 0.44% 130 42594 0.44% 131 43283 0.45% 132 44262 0.46% 133 45298 0.47% 134 46641 0.48% 135 48242 0.50% 136 50168 0.52% 137 51902 0.54% 138 53181 0.55% 139 56107 0.58% 140 58983 0.61% 141 61294 0.64% 142 63999 0.67% 143 68408 0.71% 144 75554 0.79% 145 85608 0.89% 146 100327 1.04% 147 127621 1.33% 148 179796 1.87% 149 333352 3.47% 150 1903385 19.79% 151 5002829 52.02% 9616901 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=39 prefix-density=0.25 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=13 fanout-score=99.98 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=17.4 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.07 fanout-score-rank=26 prefix-density=0.22 prefix-fanout=3.9 sequence=ATGGCATCCACCTTCATTGGAAACTCAACCTCCATCCAGGAGATGTTCAGGCGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=143.22 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.1 sequence=GAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCC SRR7169757 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:44:00 Started mapping on | Feb 11 13:44:00 Finished on | Feb 11 13:45:24 Mapping speed, Million of reads per hour | 412.15 Number of input reads | 9616901 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 8973525 Uniquely mapped reads % | 93.31% Average mapped length | 289.42 Number of splices: Total | 7853086 Number of splices: Annotated (sjdb) | 7724795 Number of splices: GT/AG | 7737795 Number of splices: GC/AG | 92639 Number of splices: AT/AC | 6653 Number of splices: Non-canonical | 15999 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 168414 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 25487 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.61% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 489360 489360 489360 N_multimapping 168414 168414 168414 N_noFeature 171119 8868797 211352 N_ambiguous 99087 588 34143 UnstrandedReadsAssigned:8703319 PositiveStrandReadsAssigned:104140 NegativeStrandReadsAssigned:8728030 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169757 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169757-trimmed-pair1.fastq SRR7169757-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,616,901 reads, 8,700,881 reads pseudoaligned [quant] estimated average fragment length: 205.154 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR7169757.ke.tsv 34699 SRR7169757.se.tsv 87100 total ==> SRR7169757.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.85 132 7.87313 Potri.005G024800.1.v4.1 1035 830.846 30 3.90638 Potri.004G059700.1.v4.1 961 756.852 2 0.285886 Potri.007G009000.2.v4.1 1416 1211.85 0 0 Potri.003G141000.2.v4.1 2943 2738.85 141 5.56962 Potri.016G087400.1.v4.1 270 93.9293 949 1093.05 Potri.015G069301.1.v4.1 564 361.08 0 0 Potri.010G195200.1.v4.1 1773 1568.85 15 1.03439 Potri.012G127500.1.v4.1 977 772.852 3916 548.176 ==> SRR7169757.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 660 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 120 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169757 completed mapping pipeline successfully