Starting /dee2/code/volunteer_pipeline.sh SRR7169758 current disk space = 3050543607808 free memory = 1410724216 SRR7169758 SRAfilesize 7bc3dff3b490599cb4d6c4de986c1146 SRR7169758.sra SRR7169758.sra file validated SRR7169758 is paired end SRR7169758 is conventional basespace SRR7169758 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169758_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.50625 25.0 18.0 33.0 18.0 33.0 2 26.8765 28.0 25.0 31.0 18.0 33.0 3 30.50275 31.0 29.0 33.0 27.0 33.0 4 32.18425 33.0 31.0 33.0 31.0 33.0 5 32.82475 33.0 33.0 33.0 32.0 34.0 6 36.756 38.0 37.0 38.0 35.0 38.0 7 37.048 38.0 38.0 38.0 35.0 38.0 8 37.34325 38.0 38.0 38.0 36.0 38.0 9 37.5625 38.0 38.0 38.0 37.0 38.0 10-14 37.5988 38.0 38.0 38.0 37.8 38.0 15-19 37.61194999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.6235 38.0 38.0 38.0 38.0 38.0 25-29 37.54605 38.0 38.0 38.0 37.6 38.0 30-34 37.5702 38.0 38.0 38.0 37.8 38.0 35-39 37.4148 38.0 38.0 38.0 37.2 38.0 40-44 37.3409 38.0 38.0 38.0 37.0 38.0 45-49 37.3995 38.0 38.0 38.0 37.0 38.0 50-54 37.4446 38.0 38.0 38.0 37.0 38.0 55-59 37.41265 38.0 38.0 38.0 37.0 38.0 60-64 37.35435 38.0 38.0 38.0 37.0 38.0 65-69 37.053900000000006 38.0 38.0 38.0 36.0 38.0 70-74 37.214999999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.409549999999996 38.0 37.4 38.0 32.8 38.0 80-84 36.9247 38.0 38.0 38.0 35.6 38.0 85-89 36.81115 38.0 38.0 38.0 35.0 38.0 90-94 36.77765 38.0 38.0 38.0 35.2 38.0 95-99 36.70745 38.0 38.0 38.0 35.0 38.0 100-104 36.678200000000004 38.0 38.0 38.0 34.8 38.0 105-109 36.4979 38.0 38.0 38.0 34.2 38.0 110-114 35.96595 38.0 37.0 38.0 31.6 38.0 115-119 35.00555 38.0 35.4 38.0 26.4 38.0 120-124 35.978449999999995 38.0 36.8 38.0 32.6 38.0 125-129 35.64605 38.0 36.0 38.0 31.2 38.0 130-134 35.28595 38.0 35.6 38.0 29.8 38.0 135-139 34.96640000000001 38.0 35.4 38.0 28.2 38.0 140-144 34.064800000000005 38.0 34.4 38.0 24.2 38.0 145-149 33.9978 38.0 34.8 38.0 24.0 38.0 150-151 29.816625000000002 36.0 27.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 2.0 16 0.0 17 2.0 18 4.0 19 3.0 20 4.0 21 6.0 22 1.0 23 4.0 24 4.0 25 7.0 26 12.0 27 16.0 28 18.0 29 21.0 30 38.0 31 37.0 32 65.0 33 108.0 34 168.0 35 354.0 36 1057.0 37 2066.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.27263530601922 11.532625189681335 7.53667172483561 37.658067779463835 2 21.825 14.499999999999998 33.050000000000004 30.625000000000004 3 18.675 19.425 28.825 33.074999999999996 4 23.799999999999997 26.950000000000003 22.875 26.375 5 22.925 32.525 24.675 19.875 6 19.950000000000003 35.75 23.3 21.0 7 14.099999999999998 26.875 41.05 17.974999999999998 8 17.349999999999998 25.275 31.85 25.525 9 17.175 24.6 33.575 24.65 10-14 19.725 29.67 27.04 23.565 15-19 20.025000000000002 28.09 28.065 23.82 20-24 19.79 29.104999999999997 27.52 23.585 25-29 19.950000000000003 29.185 27.029999999999998 23.835 30-34 20.165 29.07 27.215 23.549999999999997 35-39 20.19 28.095 28.21 23.505000000000003 40-44 20.21 28.48 27.07 24.240000000000002 45-49 19.79 28.199999999999996 27.91 24.099999999999998 50-54 20.3 28.185 27.735 23.78 55-59 20.715 28.335 27.455000000000002 23.494999999999997 60-64 20.435 28.315 27.495000000000005 23.755000000000003 65-69 20.085 28.26 27.644999999999996 24.01 70-74 20.035 27.955000000000002 27.82 24.19 75-79 20.235 28.050000000000004 27.675 24.04 80-84 20.465 27.689999999999998 27.755000000000003 24.09 85-89 20.66 28.075 27.765 23.5 90-94 20.75 28.199999999999996 27.16 23.89 95-99 20.435 28.189999999999998 27.435 23.94 100-104 20.61 28.139999999999997 27.534999999999997 23.715 105-109 21.195 28.21 26.634999999999998 23.96 110-114 20.419999999999998 28.095 27.68 23.805 115-119 20.685000000000002 28.715000000000003 26.650000000000002 23.95 120-124 20.256012800640033 28.371418570928547 26.941347067353366 24.431221561078054 125-129 21.08 27.205000000000002 27.725 23.990000000000002 130-134 20.905 27.43 27.395000000000003 24.27 135-139 21.025 27.700000000000003 26.705000000000002 24.57 140-144 21.154999999999998 27.63 27.18 24.035 145-149 20.79 27.810000000000002 26.86 24.54 150-151 21.1875 28.7375 25.874999999999996 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.5 25 1.5 26 2.5 27 4.0 28 8.5 29 10.0 30 12.5 31 23.0 32 26.5 33 25.5 34 45.0 35 68.5 36 86.5 37 110.0 38 130.0 39 155.0 40 186.0 41 215.0 42 237.0 43 258.0 44 268.5 45 264.0 46 269.0 47 267.0 48 241.5 49 216.5 50 187.0 51 144.5 52 112.0 53 91.5 54 73.5 55 65.0 56 54.0 57 37.5 58 25.0 59 18.5 60 14.5 61 10.0 62 11.5 63 7.5 64 3.0 65 2.5 66 0.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64824120603015 99.15 2 0.32663316582914576 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02512562814070352 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 8 0.2 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.8875 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 90-91 1.175 0.0 0.0 0.0 0.0 92-93 1.475 0.0 0.0 0.0 0.0 94-95 1.6875 0.0 0.0 0.0 0.0 96-97 2.0 0.0 0.0 0.0 0.0 98-99 2.3125 0.0 0.0 0.0 0.0 100-101 2.7 0.0 0.0 0.0 0.0 102-103 3.0250000000000004 0.0 0.0 0.0 0.0 104-105 3.3375 0.0 0.0 0.0 0.0 106-107 3.7625 0.0 0.0 0.0 0.0 108-109 4.175 0.0 0.0 0.0 0.0 110-111 4.6875 0.0 0.0 0.0 0.0 112-113 5.0 0.0 0.0 0.0 0.0 114-115 5.4 0.0 0.0 0.0 0.0 116-117 5.949999999999999 0.0 0.0 0.0 0.0 118-119 6.4375 0.0 0.0 0.0 0.0 120-121 7.0 0.0 0.0 0.0 0.0 122-123 7.6 0.0 0.0 0.0 0.0 124-125 8.0875 0.0 0.0 0.0 0.0 126-127 8.649999999999999 0.0 0.0 0.0 0.0 128-129 9.425 0.0 0.0 0.0 0.0 130-131 9.875 0.0 0.0 0.0 0.0 132-133 10.524999999999999 0.0 0.0 0.0 0.0 134-135 11.125 0.0 0.0 0.0 0.0 136-137 11.8375 0.0 0.0 0.0 0.0 138-139 12.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAGAA 10 0.0063298983 148.6923 1 CTAATTT 10 0.0068343505 144.975 145 >>END_MODULE SRR7169758 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169758_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94825 33.0 33.0 34.0 32.0 34.0 2 33.1135 34.0 33.0 34.0 32.0 34.0 3 33.1465 34.0 33.0 34.0 33.0 34.0 4 33.0725 34.0 33.0 34.0 33.0 34.0 5 33.1285 34.0 33.0 34.0 33.0 34.0 6 37.355 38.0 38.0 38.0 37.0 38.0 7 37.337 38.0 38.0 38.0 37.0 38.0 8 37.34175 38.0 38.0 38.0 37.0 38.0 9 37.209 38.0 38.0 38.0 37.0 38.0 10-14 37.2642 38.0 38.0 38.0 37.2 38.0 15-19 36.686 38.0 37.8 38.0 34.6 38.0 20-24 37.1437 38.0 38.0 38.0 36.8 38.0 25-29 35.9743 38.0 37.0 38.0 30.6 38.0 30-34 37.13629999999999 38.0 38.0 38.0 36.8 38.0 35-39 37.2076 38.0 38.0 38.0 37.0 38.0 40-44 37.14919999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.020849999999996 38.0 38.0 38.0 36.4 38.0 50-54 37.03985 38.0 38.0 38.0 36.4 38.0 55-59 37.002250000000004 38.0 38.0 38.0 36.6 38.0 60-64 36.970000000000006 38.0 38.0 38.0 36.0 38.0 65-69 35.335300000000004 38.0 35.6 38.0 27.8 38.0 70-74 35.9734 38.0 37.2 38.0 31.6 38.0 75-79 36.6597 38.0 38.0 38.0 35.6 38.0 80-84 36.3564 38.0 37.6 38.0 34.0 38.0 85-89 36.68695 38.0 38.0 38.0 35.6 38.0 90-94 36.644 38.0 38.0 38.0 35.2 38.0 95-99 36.594550000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.23035 38.0 38.0 38.0 34.0 38.0 105-109 35.208299999999994 38.0 36.6 38.0 28.4 38.0 110-114 34.9787 38.0 37.0 38.0 28.0 38.0 115-119 33.80780000000001 38.0 35.8 38.0 21.4 38.0 120-124 33.82125 38.0 35.2 38.0 19.8 38.0 125-129 33.9491 38.0 35.2 38.0 22.4 38.0 130-134 34.7851 38.0 35.4 38.0 26.6 38.0 135-139 34.7637 38.0 35.4 38.0 28.0 38.0 140-144 34.4367 38.0 34.6 38.0 27.2 38.0 145-149 33.58820000000001 38.0 33.8 38.0 21.6 38.0 150-151 29.3035 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 0.0 6 2.0 7 1.0 8 1.0 9 1.0 10 3.0 11 1.0 12 5.0 13 2.0 14 3.0 15 5.0 16 4.0 17 3.0 18 6.0 19 9.0 20 6.0 21 11.0 22 11.0 23 6.0 24 13.0 25 13.0 26 11.0 27 25.0 28 21.0 29 48.0 30 58.0 31 67.0 32 106.0 33 132.0 34 208.0 35 293.0 36 742.0 37 2175.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.63197398048536 21.065799349512133 11.883912934701026 24.418313735301474 2 27.925 27.725 28.199999999999996 16.150000000000002 3 20.925 28.775000000000002 30.425 19.875 4 22.925 34.125 23.825 19.125 5 24.725 36.225 21.325 17.724999999999998 6 21.025 37.824999999999996 22.25 18.9 7 21.625 22.05 36.15 20.175 8 22.225 26.0 27.175 24.6 9 22.325 24.7 29.2 23.775 10-14 23.54 28.73 25.86 21.87 15-19 23.64 28.1 26.86 21.4 20-24 23.580000000000002 28.205000000000002 26.76 21.455 25-29 23.45 28.645 27.045 20.86 30-34 23.330000000000002 28.549999999999997 27.224999999999998 20.895 35-39 23.815 27.48 27.900000000000002 20.805 40-44 23.580000000000002 28.1 27.415 20.905 45-49 23.195 28.42 26.995 21.39 50-54 23.785 27.71 27.435 21.07 55-59 23.565 27.700000000000003 27.425 21.310000000000002 60-64 23.580000000000002 28.23 27.229999999999997 20.96 65-69 24.099999999999998 27.61 27.57 20.72 70-74 23.28 28.605000000000004 27.325 20.79 75-79 23.732302440004016 28.692639823275428 27.62325534692238 19.951802389798175 80-84 23.695 28.105000000000004 27.77 20.43 85-89 24.065 28.389999999999997 27.13 20.415 90-94 24.055 27.705000000000002 27.744999999999997 20.495 95-99 23.97 28.720000000000002 27.075 20.235 100-104 24.154855511594132 28.456953974057193 27.004557519907845 20.383632994440827 105-109 24.43393378283184 28.07185267183254 27.387541511522596 20.106672033813023 110-114 24.791911351682582 28.25920441198999 26.900883419292242 20.048000817035184 115-119 25.450639278977157 27.59379584992664 27.59903584154265 19.356529029553553 120-124 25.164011246485472 27.996459439758407 27.022805373320836 19.81672394043528 125-129 25.820176337912653 28.029526348164858 26.701865901168752 19.44843141275374 130-134 26.2454313322986 28.508486456716568 26.010113653432132 19.235968557552695 135-139 25.929999999999996 28.09 26.32 19.66 140-144 26.540000000000003 28.27 26.375 18.815 145-149 26.490000000000002 28.225 26.224999999999998 19.06 150-151 27.675 27.3 26.625 18.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.5 27 2.0 28 5.0 29 6.0 30 5.5 31 9.0 32 12.5 33 25.0 34 39.5 35 47.5 36 72.0 37 100.5 38 125.0 39 155.0 40 195.5 41 239.0 42 252.0 43 276.5 44 291.5 45 278.5 46 273.5 47 265.5 48 248.0 49 222.0 50 190.0 51 152.0 52 125.0 53 106.5 54 79.5 55 53.5 56 41.0 57 30.0 58 18.5 59 12.0 60 12.0 61 8.0 62 5.5 63 5.0 64 3.0 65 2.0 66 1.5 67 1.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.41000000000000003 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.165 105-109 0.63 110-114 2.085 115-119 4.58 120-124 3.9699999999999998 125-129 2.46 130-134 0.135 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4778672032193159 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025150905432595575 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.9125000000000001 0.0 0.0 0.0 0.0 88-89 1.0 0.0 0.0 0.0 0.0 90-91 1.2 0.0 0.0 0.0 0.0 92-93 1.5 0.0 0.0 0.0 0.0 94-95 1.7125 0.0 0.0 0.0 0.0 96-97 2.05 0.0 0.0 0.0 0.0 98-99 2.3375 0.0 0.0 0.0 0.0 100-101 2.7125 0.0 0.0 0.0 0.0 102-103 3.0375 0.0 0.0 0.0 0.0 104-105 3.375 0.0 0.0 0.0 0.0 106-107 3.85 0.0 0.0 0.0 0.0 108-109 4.2375 0.0 0.0 0.0 0.0 110-111 4.7125 0.0 0.0 0.0 0.0 112-113 5.050000000000001 0.0 0.0 0.0 0.0 114-115 5.45 0.0 0.0 0.0 0.0 116-117 5.975 0.0 0.0 0.0 0.0 118-119 6.425 0.0 0.0 0.0 0.0 120-121 6.925 0.0 0.0 0.0 0.0 122-123 7.475 0.0 0.0 0.0 0.0 124-125 7.9875 0.0 0.0 0.0 0.0 126-127 8.5625 0.0 0.0 0.0 0.0 128-129 9.325 0.0 0.0 0.0 0.0 130-131 9.8 0.0 0.0 0.0 0.0 132-133 10.525 0.0 0.0 0.0 0.0 134-135 11.225 0.0 0.0 0.0 0.0 136-137 11.9375 0.0 0.0 0.0 0.0 138-139 12.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra Read 995427 spots for SRR7169758.sra Written 995427 spots for SRR7169758.sra SRR ids: ['SRR7169758.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9he72kva SRR7169758.sra spots: 19908540 blocks: [[1, 995427], [995428, 1990854], [1990855, 2986281], [2986282, 3981708], [3981709, 4977135], [4977136, 5972562], [5972563, 6967989], [6967990, 7963416], [7963417, 8958843], [8958844, 9954270], [9954271, 10949697], [10949698, 11945124], [11945125, 12940551], [12940552, 13935978], [13935979, 14931405], [14931406, 15926832], [15926833, 16922259], [16922260, 17917686], [17917687, 18913113], [18913114, 19908540]] SRR7169758 file size 6724650 SRR7169758 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169758 SRR7169758_1.fastq SRR7169758_2.fastq Input file: SRR7169758_1.fastq Paired file: SRR7169758_2.fastq trimmed: SRR7169758-trimmed-pair1.fastq, SRR7169758-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:09:26 2025 >> started Tue Feb 11 13:10:01 2025 >> done (35.966s) 19908540 read pairs processed; of these: 16641 ( 0.08%) short read pairs filtered out after trimming by size control 51176 ( 0.26%) empty read pairs filtered out after trimming by size control 19840723 (99.66%) read pairs available; of these: 10428206 (52.56%) trimmed read pairs available after processing 9412517 (47.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 4 0.00% 20 7 0.00% 21 7 0.00% 22 6 0.00% 23 10 0.00% 24 11 0.00% 25 7 0.00% 26 9 0.00% 27 17 0.00% 28 20 0.00% 29 16 0.00% 30 18 0.00% 31 11 0.00% 32 25 0.00% 33 24 0.00% 34 27 0.00% 35 36 0.00% 36 44 0.00% 37 46 0.00% 38 46 0.00% 39 50 0.00% 40 78 0.00% 41 98 0.00% 42 91 0.00% 43 129 0.00% 44 97 0.00% 45 127 0.00% 46 141 0.00% 47 150 0.00% 48 193 0.00% 49 215 0.00% 50 257 0.00% 51 337 0.00% 52 334 0.00% 53 385 0.00% 54 422 0.00% 55 497 0.00% 56 500 0.00% 57 539 0.00% 58 668 0.00% 59 793 0.00% 60 936 0.00% 61 1088 0.01% 62 1186 0.01% 63 1393 0.01% 64 1540 0.01% 65 1707 0.01% 66 1862 0.01% 67 1958 0.01% 68 2301 0.01% 69 2711 0.01% 70 3086 0.02% 71 3706 0.02% 72 4280 0.02% 73 4771 0.02% 74 5347 0.03% 75 5951 0.03% 76 6778 0.03% 77 7284 0.04% 78 7580 0.04% 79 8432 0.04% 80 9249 0.05% 81 10634 0.05% 82 11890 0.06% 83 13602 0.07% 84 15395 0.08% 85 17085 0.09% 86 17715 0.09% 87 18608 0.09% 88 19682 0.10% 89 20553 0.10% 90 21892 0.11% 91 23583 0.12% 92 25434 0.13% 93 28146 0.14% 94 29518 0.15% 95 30981 0.16% 96 32917 0.17% 97 33327 0.17% 98 33913 0.17% 99 34916 0.18% 100 36858 0.19% 101 38042 0.19% 102 40389 0.20% 103 42610 0.21% 104 44623 0.22% 105 47221 0.24% 106 47884 0.24% 107 48422 0.24% 108 49432 0.25% 109 50379 0.25% 110 50950 0.26% 111 52765 0.27% 112 55109 0.28% 113 58257 0.29% 114 60411 0.30% 115 62804 0.32% 116 63624 0.32% 117 65372 0.33% 118 65229 0.33% 119 65953 0.33% 120 66210 0.33% 121 67503 0.34% 122 69630 0.35% 123 72275 0.36% 124 75454 0.38% 125 77402 0.39% 126 80120 0.40% 127 81550 0.41% 128 82087 0.41% 129 83681 0.42% 130 84705 0.43% 131 85587 0.43% 132 88490 0.45% 133 91217 0.46% 134 94420 0.48% 135 97749 0.49% 136 101006 0.51% 137 104424 0.53% 138 107898 0.54% 139 111422 0.56% 140 116618 0.59% 141 123675 0.62% 142 132318 0.67% 143 145776 0.73% 144 164198 0.83% 145 190934 0.96% 146 229959 1.16% 147 301547 1.52% 148 447858 2.26% 149 875108 4.41% 150 4401609 22.18% 151 9412517 47.44% 19840723 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=40 prefix-density=0.14 prefix-fanout=2.4 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=347.44 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=19.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=37 prefix-density=0.19 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=290.31 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=28.5 sequence=AAGAAGAAGAAG SRR7169758 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:10:58 Started mapping on | Feb 11 13:10:58 Finished on | Feb 11 13:13:45 Mapping speed, Million of reads per hour | 427.70 Number of input reads | 19840723 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 18765875 Uniquely mapped reads % | 94.58% Average mapped length | 288.77 Number of splices: Total | 17228949 Number of splices: Annotated (sjdb) | 16920863 Number of splices: GT/AG | 16965582 Number of splices: GC/AG | 209240 Number of splices: AT/AC | 15285 Number of splices: Non-canonical | 38842 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 388444 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 45610 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 701493 701493 701493 N_multimapping 388444 388444 388444 N_noFeature 435963 18540909 544976 N_ambiguous 190954 1386 73942 UnstrandedReadsAssigned:18138958 PositiveStrandReadsAssigned:223580 NegativeStrandReadsAssigned:18146957 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169758 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169758-trimmed-pair1.fastq SRR7169758-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,840,723 reads, 18,082,828 reads pseudoaligned [quant] estimated average fragment length: 210.493 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR7169758.ke.tsv 34699 SRR7169758.se.tsv 87100 total ==> SRR7169758.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.51 371 11.5171 Potri.005G024800.1.v4.1 1035 825.507 91 6.18886 Potri.004G059700.1.v4.1 961 751.507 3 0.224119 Potri.007G009000.2.v4.1 1416 1206.51 0 0 Potri.003G141000.2.v4.1 2943 2733.51 454.097 9.3265 Potri.016G087400.1.v4.1 270 95.3006 1727 1017.39 Potri.015G069301.1.v4.1 564 356.682 0 0 Potri.010G195200.1.v4.1 1773 1563.51 67 2.40583 Potri.012G127500.1.v4.1 977 767.507 8805 644.076 ==> SRR7169758.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1663 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 380 Potri.001G212900.v4.1 20 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7169758 completed mapping pipeline successfully