Starting /dee2/code/volunteer_pipeline.sh SRR7169759 current disk space = 3050293297152 free memory = 1495146124 SRR7169759 SRAfilesize 1f9ef64822b8cdcf257fd6f0d306bc16 SRR7169759.sra SRR7169759.sra file validated SRR7169759 is paired end SRR7169759 is conventional basespace SRR7169759 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169759_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.08725 25.0 18.0 30.0 18.0 33.0 2 29.617 31.0 29.0 33.0 25.0 33.0 3 31.3395 33.0 31.0 33.0 29.0 33.0 4 32.361 33.0 33.0 33.0 31.0 34.0 5 32.6805 33.0 33.0 34.0 32.0 34.0 6 36.80525 38.0 37.0 38.0 35.0 38.0 7 37.18825 38.0 38.0 38.0 36.0 38.0 8 37.4465 38.0 38.0 38.0 37.0 38.0 9 37.56125 38.0 38.0 38.0 37.0 38.0 10-14 37.63095 38.0 38.0 38.0 38.0 38.0 15-19 37.5947 38.0 38.0 38.0 38.0 38.0 20-24 37.59305 38.0 38.0 38.0 38.0 38.0 25-29 37.624199999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.5972 38.0 38.0 38.0 38.0 38.0 35-39 37.555400000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.57854999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.45735 38.0 38.0 38.0 37.8 38.0 50-54 37.457899999999995 38.0 38.0 38.0 37.6 38.0 55-59 37.362649999999995 38.0 38.0 38.0 37.0 38.0 60-64 36.8624 38.0 37.8 38.0 35.4 38.0 65-69 37.2098 38.0 38.0 38.0 36.6 38.0 70-74 37.329449999999994 38.0 38.0 38.0 37.0 38.0 75-79 37.295100000000005 38.0 38.0 38.0 37.0 38.0 80-84 37.2097 38.0 38.0 38.0 36.8 38.0 85-89 37.177800000000005 38.0 38.0 38.0 36.6 38.0 90-94 36.975049999999996 38.0 38.0 38.0 35.8 38.0 95-99 37.0086 38.0 38.0 38.0 36.0 38.0 100-104 37.06465 38.0 38.0 38.0 36.0 38.0 105-109 36.677049999999994 38.0 38.0 38.0 35.2 38.0 110-114 36.62925 38.0 38.0 38.0 35.0 38.0 115-119 36.7187 38.0 38.0 38.0 35.0 38.0 120-124 36.607000000000006 38.0 38.0 38.0 34.8 38.0 125-129 36.48225 38.0 38.0 38.0 34.4 38.0 130-134 36.24615000000001 38.0 37.8 38.0 33.6 38.0 135-139 35.99955 38.0 37.6 38.0 33.0 38.0 140-144 35.82775 38.0 36.8 38.0 32.6 38.0 145-149 35.34135 38.0 36.0 38.0 31.8 38.0 150-151 31.593000000000004 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 2.0 18 0.0 19 0.0 20 1.0 21 3.0 22 2.0 23 5.0 24 3.0 25 7.0 26 7.0 27 11.0 28 14.0 29 17.0 30 27.0 31 44.0 32 54.0 33 89.0 34 125.0 35 187.0 36 567.0 37 2830.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.708835341365464 13.50401606425703 8.659638554216867 38.127510040160644 2 22.275 16.25 34.449999999999996 27.025 3 19.525000000000002 21.875 26.700000000000003 31.900000000000002 4 22.625 30.025000000000002 22.6 24.75 5 21.4 33.85 24.474999999999998 20.275000000000002 6 18.075 36.825 25.424999999999997 19.675 7 13.750000000000002 26.625 41.8 17.825 8 18.25 24.925 31.65 25.174999999999997 9 17.974999999999998 22.825 34.025 25.174999999999997 10-14 19.29 30.264999999999997 27.065 23.380000000000003 15-19 19.49 29.659999999999997 27.275 23.575 20-24 20.405 28.815 27.62 23.16 25-29 19.885 30.049999999999997 26.700000000000003 23.365 30-34 19.907986197929688 29.124368655298294 27.394109116367453 23.57353603040456 35-39 20.61309196379457 28.579286893033956 27.344101615242288 23.46351952792919 40-44 19.955000000000002 29.21 27.515 23.32 45-49 20.32 28.945 27.279999999999998 23.455000000000002 50-54 20.549999999999997 28.735 27.169999999999998 23.544999999999998 55-59 20.73 28.970000000000002 27.215 23.085 60-64 19.950000000000003 28.675 27.48 23.895 65-69 20.495 28.744999999999997 27.18 23.580000000000002 70-74 19.765 29.285 27.0 23.95 75-79 20.105 29.345 27.215 23.335 80-84 20.285 28.37 27.61 23.735 85-89 20.285 28.605000000000004 27.43 23.68 90-94 20.810000000000002 29.020000000000003 27.455000000000002 22.715 95-99 20.611030551527577 29.066453322666135 27.051352567628385 23.27116355817791 100-104 20.671201360408123 29.543863158947687 27.093127938381517 22.69180754226268 105-109 20.02508780732564 28.981435022579028 27.019568489713997 23.973908680381335 110-114 20.799396681749624 28.567119155354447 27.14429361488185 23.489190548014076 115-119 20.595 29.025000000000002 26.705000000000002 23.674999999999997 120-124 20.69 28.655 27.195000000000004 23.46 125-129 20.43 28.965000000000003 26.384999999999998 24.22 130-134 21.065 28.28 26.555 24.099999999999998 135-139 21.13 28.994999999999997 26.6 23.275000000000002 140-144 20.87 28.67 26.445 24.015 145-149 21.11 28.895 26.215 23.78 150-151 21.520570213830187 28.848318119294735 25.809678629486054 23.82143303738902 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 2.0 23 3.0 24 2.0 25 4.0 26 4.0 27 3.5 28 8.0 29 14.5 30 21.0 31 28.0 32 37.5 33 48.0 34 64.5 35 86.5 36 104.0 37 111.0 38 138.5 39 163.0 40 184.5 41 214.0 42 220.5 43 249.5 44 278.5 45 264.5 46 242.5 47 236.0 48 221.5 49 212.5 50 179.0 51 138.0 52 114.0 53 95.5 54 84.5 55 58.0 56 41.5 57 31.5 58 24.5 59 19.0 60 13.5 61 8.0 62 4.5 63 4.0 64 3.0 65 2.0 66 3.0 67 2.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.03 105-109 0.35000000000000003 110-114 0.5499999999999999 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.6375 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.475 0.0 0.0 0.0 0.0 106-107 2.8125 0.0 0.0 0.0 0.0 108-109 3.3375 0.0 0.0 0.0 0.0 110-111 3.7874999999999996 0.0 0.0 0.0 0.0 112-113 4.175 0.0 0.0 0.0 0.0 114-115 4.6625 0.0 0.0 0.0 0.0 116-117 5.2375 0.0 0.0 0.0 0.0 118-119 5.85 0.0 0.0 0.0 0.0 120-121 6.3625 0.0 0.0 0.0 0.0 122-123 7.050000000000001 0.0 0.0 0.0 0.0 124-125 7.612500000000001 0.0 0.0 0.0 0.0 126-127 8.3 0.0 0.0 0.0 0.0 128-129 9.0 0.0 0.0 0.0 0.0 130-131 9.7 0.0 0.0 0.0 0.0 132-133 10.3875 0.0 0.0 0.0 0.0 134-135 11.0875 0.0 0.0 0.0 0.0 136-137 11.8 0.0 0.0 0.0 0.0 138-139 12.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCAAAC 10 0.006830828 145.0 7 >>END_MODULE SRR7169759 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169759_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13 34.0 33.0 34.0 33.0 34.0 2 33.22975 34.0 33.0 34.0 33.0 34.0 3 33.24575 34.0 33.0 34.0 33.0 34.0 4 33.1635 34.0 33.0 34.0 33.0 34.0 5 33.20975 34.0 33.0 34.0 33.0 34.0 6 37.40625 38.0 38.0 38.0 38.0 38.0 7 37.40775 38.0 38.0 38.0 38.0 38.0 8 37.4115 38.0 38.0 38.0 38.0 38.0 9 37.37775 38.0 38.0 38.0 38.0 38.0 10-14 37.346399999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.3468 38.0 38.0 38.0 37.8 38.0 20-24 37.37765 38.0 38.0 38.0 38.0 38.0 25-29 37.310900000000004 38.0 38.0 38.0 37.6 38.0 30-34 37.253 38.0 38.0 38.0 37.0 38.0 35-39 36.875299999999996 38.0 38.0 38.0 36.0 38.0 40-44 37.1928 38.0 38.0 38.0 37.0 38.0 45-49 37.228500000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.15175 38.0 38.0 38.0 37.0 38.0 55-59 37.0636 38.0 38.0 38.0 36.8 38.0 60-64 37.161500000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.126599999999996 38.0 38.0 38.0 37.0 38.0 70-74 36.72165 38.0 38.0 38.0 36.4 38.0 75-79 35.85805 38.0 38.0 38.0 34.4 38.0 80-84 36.425050000000006 38.0 38.0 38.0 34.8 38.0 85-89 36.965250000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.92645 38.0 38.0 38.0 36.0 38.0 95-99 36.7354 38.0 38.0 38.0 35.6 38.0 100-104 36.56245 38.0 38.0 38.0 35.0 38.0 105-109 35.52669999999999 38.0 38.0 38.0 32.8 38.0 110-114 34.389799999999994 38.0 37.2 38.0 25.8 38.0 115-119 33.41725 38.0 37.0 38.0 12.0 38.0 120-124 33.702000000000005 38.0 36.0 38.0 18.2 38.0 125-129 33.785199999999996 38.0 35.4 38.0 22.0 38.0 130-134 35.49275 38.0 36.8 38.0 31.2 38.0 135-139 35.48479999999999 38.0 36.2 38.0 31.6 38.0 140-144 35.150549999999996 38.0 36.0 38.0 31.0 38.0 145-149 34.27974999999999 38.0 34.6 38.0 27.2 38.0 150-151 30.651874999999997 35.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 1.0 6 3.0 7 1.0 8 2.0 9 1.0 10 1.0 11 2.0 12 2.0 13 0.0 14 3.0 15 6.0 16 3.0 17 5.0 18 7.0 19 4.0 20 4.0 21 4.0 22 5.0 23 6.0 24 11.0 25 13.0 26 12.0 27 21.0 28 55.0 29 65.0 30 55.0 31 68.0 32 68.0 33 111.0 34 136.0 35 227.0 36 468.0 37 2623.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.625 21.8 12.0 26.575 2 25.75 26.875 30.65 16.725 3 19.93995496622467 27.87090317738304 30.597948461346007 21.591193395046286 4 23.724999999999998 34.025 23.25 19.0 5 24.224999999999998 36.175000000000004 22.225 17.375 6 20.925 35.575 24.95 18.55 7 20.5 21.975 38.7 18.825 8 21.5 24.4 29.675 24.425 9 22.35 24.7 28.849999999999998 24.099999999999998 10-14 23.330000000000002 28.599999999999998 26.715 21.355 15-19 23.305 27.965 28.455000000000002 20.275000000000002 20-24 22.854570914182837 27.850570114022805 28.455691138227646 20.839167833566712 25-29 23.255 27.705000000000002 28.125 20.915 30-34 22.845 28.07 28.125 20.96 35-39 22.99069162246021 27.93013712341107 27.91011910719648 21.169052146932238 40-44 23.144628925785156 27.68553710742148 28.145629125825167 21.024204840968196 45-49 23.93 27.029999999999998 28.615000000000002 20.424999999999997 50-54 23.098464769715456 26.944041606240937 29.324398659798973 20.633094964244634 55-59 23.575 27.384999999999998 28.555000000000003 20.485 60-64 22.8 27.74 28.945 20.515 65-69 22.68 27.83 28.53 20.96 70-74 23.6411396241665 27.60658718933118 27.995554657506567 20.75671852899576 75-79 22.908397340069076 28.166400329913916 28.810763441414505 20.114438888602507 80-84 23.59119369824278 28.261967279337508 27.353059987881235 20.793779034538478 85-89 23.9 27.445000000000004 28.26 20.395 90-94 23.91 27.655 28.065 20.369999999999997 95-99 24.02 27.415 28.689999999999998 19.875 100-104 23.65973194638928 27.975595119023804 28.150630126025206 20.214042808561715 105-109 23.89807870132539 27.920476728655093 28.15678619130792 20.0246583787116 110-114 23.95844376126365 27.472702215625993 28.188275204070816 20.380578819039542 115-119 24.372037269111317 28.07170489838174 28.022666594017327 19.53359123848962 120-124 24.73925074499787 27.79906343124734 27.634099616858236 19.82758620689655 125-129 24.40018817625843 27.965082849824892 27.562594741519003 20.07213423239768 130-134 25.162841968133083 27.392524301032168 27.467682132478206 19.97695159835655 135-139 25.6 27.644999999999996 27.375 19.38 140-144 25.645 27.175 27.605 19.575 145-149 25.874999999999996 27.92 26.889999999999997 19.314999999999998 150-151 26.997245179063363 26.471324818432258 27.28524918607563 19.24618081642875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 1.5 26 1.0 27 3.5 28 6.0 29 12.0 30 17.5 31 21.0 32 28.0 33 40.0 34 52.0 35 68.5 36 92.0 37 115.5 38 140.0 39 161.0 40 209.5 41 258.5 42 259.0 43 251.5 44 265.0 45 276.5 46 254.5 47 256.0 48 254.0 49 199.0 50 160.5 51 141.0 52 122.0 53 88.5 54 64.5 55 51.0 56 33.5 57 23.0 58 21.5 59 17.5 60 7.0 61 4.0 62 2.5 63 2.5 64 2.5 65 1.5 66 1.5 67 2.5 68 1.5 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.02 25-29 0.0 30-34 0.0 35-39 0.09 40-44 0.02 45-49 0.0 50-54 0.015 55-59 0.0 60-64 0.0 65-69 0.0 70-74 1.02 75-79 3.005 80-84 0.98 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 2.67 110-114 5.67 115-119 8.235000000000001 120-124 6.04 125-129 4.345000000000001 130-134 0.21 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8999999999999999 0.0 0.0 0.0 0.0 94-95 1.1124999999999998 0.0 0.0 0.0 0.0 96-97 1.325 0.0 0.0 0.0 0.0 98-99 1.5375 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 1.9874999999999998 0.0 0.0 0.0 0.0 104-105 2.275 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.4875 0.0 0.0 0.0 0.0 112-113 3.8125 0.0 0.0 0.0 0.0 114-115 4.2375 0.0 0.0 0.0 0.0 116-117 4.8 0.0 0.0 0.0 0.0 118-119 5.300000000000001 0.0 0.0 0.0 0.0 120-121 5.7375 0.0 0.0 0.0 0.0 122-123 6.3875 0.0 0.0 0.0 0.0 124-125 6.875 0.0 0.0 0.0 0.0 126-127 7.55 0.0 0.0 0.0 0.0 128-129 8.2375 0.0 0.0 0.0 0.0 130-131 8.899999999999999 0.0 0.0 0.0 0.0 132-133 9.6 0.0 0.0 0.0 0.0 134-135 10.3125 0.0 0.0 0.0 0.0 136-137 11.037500000000001 0.0 0.0 0.0 0.0 138-139 11.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCGAA 10 0.0070723044 143.325 6 TATTCGA 10 0.0070723044 143.325 5 TTGAAGT 10 0.0070723044 143.325 2 TTTTTTT 40 0.00818552 17.915625 50-54 >>END_MODULE Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662142 spots for SRR7169759.sra Written 662142 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra Read 662136 spots for SRR7169759.sra Written 662136 spots for SRR7169759.sra SRR ids: ['SRR7169759.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1pgl75ml SRR7169759.sra spots: 13242726 blocks: [[1, 662136], [662137, 1324272], [1324273, 1986408], [1986409, 2648544], [2648545, 3310680], [3310681, 3972816], [3972817, 4634952], [4634953, 5297088], [5297089, 5959224], [5959225, 6621360], [6621361, 7283496], [7283497, 7945632], [7945633, 8607768], [8607769, 9269904], [9269905, 9932040], [9932041, 10594176], [10594177, 11256312], [11256313, 11918448], [11918449, 12580584], [12580585, 13242726]] SRR7169759 file size 4465824 SRR7169759 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169759 SRR7169759_1.fastq SRR7169759_2.fastq Input file: SRR7169759_1.fastq Paired file: SRR7169759_2.fastq trimmed: SRR7169759-trimmed-pair1.fastq, SRR7169759-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:55:59 2025 >> started Tue Feb 11 13:56:19 2025 >> done (20.193s) 13242726 read pairs processed; of these: 12051 ( 0.09%) short read pairs filtered out after trimming by size control 11796 ( 0.09%) empty read pairs filtered out after trimming by size control 13218879 (99.82%) read pairs available; of these: 6138988 (46.44%) trimmed read pairs available after processing 7079891 (53.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 3 0.00% 21 0 0.00% 22 3 0.00% 23 1 0.00% 24 2 0.00% 25 7 0.00% 26 3 0.00% 27 2 0.00% 28 7 0.00% 29 6 0.00% 30 5 0.00% 31 8 0.00% 32 13 0.00% 33 17 0.00% 34 9 0.00% 35 18 0.00% 36 15 0.00% 37 24 0.00% 38 26 0.00% 39 30 0.00% 40 28 0.00% 41 45 0.00% 42 55 0.00% 43 51 0.00% 44 50 0.00% 45 65 0.00% 46 71 0.00% 47 64 0.00% 48 100 0.00% 49 116 0.00% 50 142 0.00% 51 145 0.00% 52 185 0.00% 53 229 0.00% 54 218 0.00% 55 256 0.00% 56 262 0.00% 57 263 0.00% 58 327 0.00% 59 392 0.00% 60 461 0.00% 61 577 0.00% 62 636 0.00% 63 710 0.01% 64 731 0.01% 65 838 0.01% 66 971 0.01% 67 1027 0.01% 68 1168 0.01% 69 1304 0.01% 70 1572 0.01% 71 1704 0.01% 72 2135 0.02% 73 2493 0.02% 74 2667 0.02% 75 2947 0.02% 76 3485 0.03% 77 3715 0.03% 78 3853 0.03% 79 4374 0.03% 80 4782 0.04% 81 5519 0.04% 82 6334 0.05% 83 6978 0.05% 84 8160 0.06% 85 9183 0.07% 86 9657 0.07% 87 10161 0.08% 88 10832 0.08% 89 11392 0.09% 90 12263 0.09% 91 13335 0.10% 92 14518 0.11% 93 15993 0.12% 94 17108 0.13% 95 18416 0.14% 96 19238 0.15% 97 19587 0.15% 98 20056 0.15% 99 21087 0.16% 100 22188 0.17% 101 23231 0.18% 102 24470 0.19% 103 26566 0.20% 104 27528 0.21% 105 28934 0.22% 106 30212 0.23% 107 30174 0.23% 108 31060 0.23% 109 31643 0.24% 110 32741 0.25% 111 33653 0.25% 112 35260 0.27% 113 36437 0.28% 114 38086 0.29% 115 39645 0.30% 116 40796 0.31% 117 41229 0.31% 118 41378 0.31% 119 41311 0.31% 120 42423 0.32% 121 43760 0.33% 122 44914 0.34% 123 46032 0.35% 124 48170 0.36% 125 49202 0.37% 126 51197 0.39% 127 52499 0.40% 128 52435 0.40% 129 52674 0.40% 130 53867 0.41% 131 53985 0.41% 132 55436 0.42% 133 57323 0.43% 134 58155 0.44% 135 60508 0.46% 136 62491 0.47% 137 64303 0.49% 138 65964 0.50% 139 68051 0.51% 140 70244 0.53% 141 74211 0.56% 142 78501 0.59% 143 84249 0.64% 144 94134 0.71% 145 109668 0.83% 146 123170 0.93% 147 158140 1.20% 148 226377 1.71% 149 426165 3.22% 150 2658963 20.11% 151 7079891 53.56% 13218879 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=39 prefix-density=0.15 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.11 sequence-density-rank=12 fanout-score=115.89 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=19.2 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=34 prefix-density=0.27 prefix-fanout=2.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=42 fanout-score=62.70 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=9.1 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7169759 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:57:00 Started mapping on | Feb 11 13:57:01 Finished on | Feb 11 13:58:15 Mapping speed, Million of reads per hour | 643.08 Number of input reads | 13218879 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 12656015 Uniquely mapped reads % | 95.74% Average mapped length | 289.69 Number of splices: Total | 11844115 Number of splices: Annotated (sjdb) | 11631277 Number of splices: GT/AG | 11667236 Number of splices: GC/AG | 140908 Number of splices: AT/AC | 10167 Number of splices: Non-canonical | 25804 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231261 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 32776 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.21% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 341872 341872 341872 N_multimapping 231261 231261 231261 N_noFeature 387965 12495671 472490 N_ambiguous 123371 651 47143 UnstrandedReadsAssigned:12144679 PositiveStrandReadsAssigned:159693 NegativeStrandReadsAssigned:12136382 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169759 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169759-trimmed-pair1.fastq SRR7169759-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,218,879 reads, 12,067,400 reads pseudoaligned [quant] estimated average fragment length: 212.158 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 993 rounds 52401 SRR7169759.ke.tsv 34699 SRR7169759.se.tsv 87100 total ==> SRR7169759.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.84 233 10.9803 Potri.005G024800.1.v4.1 1035 823.842 20 2.06712 Potri.004G059700.1.v4.1 961 749.853 5 0.567772 Potri.007G009000.2.v4.1 1416 1204.84 0 0 Potri.003G141000.2.v4.1 2943 2731.84 298.038 9.28959 Potri.016G087400.1.v4.1 270 94.8082 1150 1032.84 Potri.015G069301.1.v4.1 564 355.533 0 0 Potri.010G195200.1.v4.1 1773 1561.84 5 0.272592 Potri.012G127500.1.v4.1 977 765.853 5060 562.581 ==> SRR7169759.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 694 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 212 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169759 completed mapping pipeline successfully