Starting /dee2/code/volunteer_pipeline.sh SRR7169760 current disk space = 3050072203264 free memory = 1575749408 SRR7169760 SRAfilesize 6d12a33112e68c5ebc658fa7cddce236 SRR7169760.sra SRR7169760.sra file validated SRR7169760 is paired end SRR7169760 is conventional basespace SRR7169760 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169760_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.46725 30.0 18.0 33.0 18.0 34.0 2 28.60225 30.0 27.0 33.0 18.0 33.0 3 31.2605 33.0 30.0 33.0 29.0 33.0 4 32.56225 33.0 33.0 33.0 31.0 34.0 5 32.97225 33.0 33.0 34.0 33.0 34.0 6 36.90025 38.0 37.0 38.0 35.0 38.0 7 37.29275 38.0 38.0 38.0 36.0 38.0 8 37.4915 38.0 38.0 38.0 37.0 38.0 9 37.62775 38.0 38.0 38.0 38.0 38.0 10-14 37.6434 38.0 38.0 38.0 38.0 38.0 15-19 37.67415 38.0 38.0 38.0 38.0 38.0 20-24 37.66645 38.0 38.0 38.0 38.0 38.0 25-29 37.58825 38.0 38.0 38.0 38.0 38.0 30-34 37.58855 38.0 38.0 38.0 38.0 38.0 35-39 37.39855 38.0 38.0 38.0 37.2 38.0 40-44 37.329950000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.415800000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.11655 38.0 38.0 38.0 36.0 38.0 55-59 37.41195 38.0 38.0 38.0 37.0 38.0 60-64 37.36335 38.0 38.0 38.0 37.0 38.0 65-69 36.9722 38.0 38.0 38.0 35.8 38.0 70-74 37.24065 38.0 38.0 38.0 36.6 38.0 75-79 37.1648 38.0 38.0 38.0 36.2 38.0 80-84 37.05255 38.0 38.0 38.0 35.8 38.0 85-89 36.7588 38.0 38.0 38.0 35.0 38.0 90-94 36.7812 38.0 38.0 38.0 35.0 38.0 95-99 36.78855 38.0 38.0 38.0 35.0 38.0 100-104 36.7 38.0 38.0 38.0 35.0 38.0 105-109 36.58575 38.0 38.0 38.0 34.4 38.0 110-114 36.0496 38.0 37.2 38.0 33.4 38.0 115-119 35.84155 38.0 36.8 38.0 31.6 38.0 120-124 36.21295 38.0 37.2 38.0 33.6 38.0 125-129 35.0018 38.0 35.4 38.0 27.0 38.0 130-134 35.1334 38.0 35.4 38.0 27.2 38.0 135-139 35.455349999999996 38.0 36.0 38.0 31.4 38.0 140-144 34.765750000000004 38.0 35.0 38.0 28.2 38.0 145-149 34.343900000000005 38.0 35.0 38.0 27.0 38.0 150-151 30.827374999999996 36.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.0 19 2.0 20 4.0 21 1.0 22 5.0 23 4.0 24 9.0 25 12.0 26 7.0 27 20.0 28 16.0 29 24.0 30 31.0 31 53.0 32 66.0 33 96.0 34 144.0 35 269.0 36 897.0 37 2335.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.514198782961465 11.511156186612576 8.21501014198783 41.759634888438136 2 20.549999999999997 15.975 33.925 29.549999999999997 3 19.975 21.025 26.275 32.725 4 23.075000000000003 29.599999999999998 22.525000000000002 24.8 5 21.775 34.150000000000006 24.875 19.2 6 17.65 37.4 25.650000000000002 19.3 7 14.2 25.324999999999996 42.3 18.175 8 17.525 25.6 31.275 25.6 9 16.925 25.15 34.425 23.5 10-14 19.73 30.25 26.369999999999997 23.65 15-19 20.025000000000002 28.29 28.015 23.669999999999998 20-24 20.205000000000002 28.754999999999995 27.52 23.52 25-29 19.86 29.195 27.529999999999998 23.415 30-34 19.73 28.76 27.605 23.905 35-39 20.165 28.98 27.025 23.830000000000002 40-44 19.935 28.910000000000004 27.375 23.78 45-49 20.380000000000003 28.71 27.474999999999998 23.435 50-54 20.07 28.835 27.565 23.53 55-59 20.615 28.29 27.38 23.715 60-64 20.405 28.754999999999995 27.495000000000005 23.345 65-69 20.205000000000002 28.425 27.860000000000003 23.51 70-74 20.01 28.87 27.345000000000002 23.775 75-79 20.36 28.435 27.445000000000004 23.76 80-84 20.52 28.585 27.215 23.68 85-89 20.305 28.965000000000003 27.08 23.65 90-94 20.115 28.7 27.395000000000003 23.79 95-99 20.555 29.080000000000002 27.045 23.32 100-104 20.535 29.365000000000002 26.834999999999997 23.265 105-109 21.071053552677636 28.30141507075354 27.391369568478424 23.236161808090404 110-114 20.491266925051594 29.385412996426236 26.546534454119897 23.576785624402273 115-119 20.76 28.9 26.634999999999998 23.705000000000002 120-124 20.925 27.97 27.185 23.919999999999998 125-129 20.195 28.625 27.445000000000004 23.735 130-134 20.849999999999998 28.615000000000002 26.534999999999997 24.0 135-139 21.05 28.415000000000003 26.345000000000002 24.19 140-144 21.315 28.854999999999997 26.05 23.78 145-149 21.435000000000002 28.355000000000004 26.015 24.195 150-151 21.224999999999998 27.85 26.737499999999997 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 1.5 24 2.5 25 2.0 26 3.0 27 7.5 28 10.5 29 12.0 30 20.5 31 30.5 32 31.0 33 40.0 34 48.5 35 50.5 36 72.0 37 102.5 38 118.0 39 149.5 40 192.5 41 226.0 42 257.0 43 284.0 44 302.0 45 295.5 46 278.5 47 258.5 48 233.5 49 193.5 50 154.0 51 130.5 52 115.5 53 89.5 54 74.0 55 61.0 56 38.0 57 31.0 58 24.0 59 15.5 60 10.0 61 8.5 62 5.5 63 3.0 64 1.5 65 3.5 66 4.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.6649999999999999 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7875 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.0125 0.0 0.0 0.0 0.0 94-95 1.2625000000000002 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.7625 0.0 0.0 0.0 0.0 100-101 2.0875 0.0 0.0 0.0 0.0 102-103 2.3875 0.0 0.0 0.0 0.0 104-105 2.7874999999999996 0.0 0.0 0.0 0.0 106-107 3.1624999999999996 0.0 0.0 0.0 0.0 108-109 3.5250000000000004 0.0 0.0 0.0 0.0 110-111 3.7625 0.0 0.0 0.0 0.0 112-113 4.1625 0.0 0.0 0.0 0.0 114-115 4.75 0.0 0.0 0.0 0.0 116-117 5.125 0.0 0.0 0.0 0.0 118-119 5.4375 0.0 0.0 0.0 0.0 120-121 6.025 0.0 0.0 0.0 0.0 122-123 6.5125 0.0 0.0 0.0 0.0 124-125 7.0 0.0 0.0 0.0 0.0 126-127 7.3875 0.0 0.0 0.0 0.0 128-129 7.925000000000001 0.0 0.0 0.0 0.0 130-131 8.6125 0.0 0.0 0.0 0.0 132-133 9.425 0.0 0.0 0.0 0.0 134-135 10.15 0.0 0.0 0.0 0.0 136-137 10.7625 0.0 0.0 0.0 0.0 138-139 11.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGATGA 10 0.006365939 148.41026 1 TCAGTAG 25 8.78529E-4 86.82 2 >>END_MODULE SRR7169760 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169760_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79725 33.0 33.0 34.0 32.0 34.0 2 32.90875 33.0 33.0 34.0 32.0 34.0 3 31.92475 33.0 33.0 34.0 27.0 34.0 4 32.406 33.0 33.0 34.0 31.0 34.0 5 32.904 33.0 33.0 34.0 32.0 34.0 6 37.15925 38.0 38.0 38.0 37.0 38.0 7 37.255 38.0 38.0 38.0 37.0 38.0 8 37.32275 38.0 38.0 38.0 37.0 38.0 9 37.3375 38.0 38.0 38.0 38.0 38.0 10-14 37.29505 38.0 38.0 38.0 37.2 38.0 15-19 37.34225 38.0 38.0 38.0 37.6 38.0 20-24 36.63535 38.0 37.4 38.0 34.0 38.0 25-29 37.2417 38.0 38.0 38.0 37.0 38.0 30-34 37.26745 38.0 38.0 38.0 37.0 38.0 35-39 37.2481 38.0 38.0 38.0 37.0 38.0 40-44 37.169850000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.22875 38.0 38.0 38.0 37.0 38.0 50-54 37.19085 38.0 38.0 38.0 37.0 38.0 55-59 37.091699999999996 38.0 38.0 38.0 36.8 38.0 60-64 36.923500000000004 38.0 38.0 38.0 36.4 38.0 65-69 36.8274 38.0 38.0 38.0 36.0 38.0 70-74 36.793 38.0 38.0 38.0 35.8 38.0 75-79 36.369800000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.000699999999995 38.0 37.4 38.0 32.6 38.0 85-89 36.500099999999996 38.0 38.0 38.0 34.6 38.0 90-94 36.737100000000005 38.0 38.0 38.0 35.6 38.0 95-99 36.6177 38.0 38.0 38.0 35.0 38.0 100-104 36.3382 38.0 38.0 38.0 34.4 38.0 105-109 34.885400000000004 38.0 36.4 38.0 27.2 38.0 110-114 34.10505 38.0 36.4 38.0 21.8 38.0 115-119 33.11275 38.0 35.8 38.0 9.6 38.0 120-124 33.0113 38.0 35.0 38.0 15.6 38.0 125-129 33.144800000000004 38.0 35.0 38.0 14.8 38.0 130-134 34.2872 38.0 35.2 38.0 23.8 38.0 135-139 34.6909 38.0 35.6 38.0 27.8 38.0 140-144 34.50275 38.0 35.0 38.0 27.8 38.0 145-149 33.72715000000001 38.0 33.8 38.0 23.6 38.0 150-151 29.109625 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 2.0 10 2.0 11 2.0 12 1.0 13 1.0 14 3.0 15 2.0 16 2.0 17 3.0 18 5.0 19 13.0 20 8.0 21 7.0 22 8.0 23 16.0 24 10.0 25 20.0 26 23.0 27 20.0 28 33.0 29 62.0 30 56.0 31 110.0 32 103.0 33 160.0 34 154.0 35 260.0 36 600.0 37 2306.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.175 18.825 12.85 28.15 2 26.650000000000002 24.224999999999998 32.324999999999996 16.8 3 21.375 28.425 30.95 19.25 4 22.95 34.325 23.35 19.375 5 23.849999999999998 34.9 22.725 18.525 6 21.3 35.425000000000004 24.575 18.7 7 19.775000000000002 20.225 39.900000000000006 20.1 8 22.475 24.975 28.075 24.474999999999998 9 22.75 22.925 30.55 23.775 10-14 23.43 28.28 26.41 21.88 15-19 22.955000000000002 27.92 28.18 20.945 20-24 22.805 28.110000000000003 28.17 20.915 25-29 23.195 27.73 28.015 21.060000000000002 30-34 23.46 27.860000000000003 28.255000000000003 20.424999999999997 35-39 23.7 27.48 27.91 20.91 40-44 22.82 28.155 27.855 21.17 45-49 22.895 28.125 28.599999999999998 20.380000000000003 50-54 23.28 27.115000000000002 28.355000000000004 21.25 55-59 23.435 27.63 28.125 20.810000000000002 60-64 23.669999999999998 27.345000000000002 28.389999999999997 20.595 65-69 23.77 27.495000000000005 28.285 20.45 70-74 23.150000000000002 27.465 28.749999999999996 20.635 75-79 23.335697639071842 27.40905866855811 28.381801600972743 20.873442091397305 80-84 23.280503144654087 27.954716981132076 28.241509433962264 20.523270440251572 85-89 24.005000000000003 27.525 28.389999999999997 20.080000000000002 90-94 23.855 27.544999999999998 28.365000000000002 20.235 95-99 23.724999999999998 27.845 27.765 20.665 100-104 24.28578576074448 27.602941912242958 27.868114274278284 20.243158052734277 105-109 23.44144690310195 28.250985147014244 27.72557340608265 20.58199454380115 110-114 24.112690889942076 27.719852553975777 28.062137967351237 20.10531858873091 115-119 24.25659146507203 27.415058439793423 28.078282141886383 20.250067953248166 120-124 24.9051157320789 27.524456085957127 27.89864756508259 19.67178061688138 125-129 25.274842565908852 27.612338563347212 27.55897107482122 19.553847795922724 130-134 24.701053911633565 28.14146736927442 27.492906364004867 19.664572355087152 135-139 25.979999999999997 27.595 27.195000000000004 19.23 140-144 25.945 27.939999999999998 27.11 19.005 145-149 26.640000000000004 27.375 27.389999999999997 18.595 150-151 27.275 27.537499999999998 26.924999999999997 18.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 1.5 26 2.5 27 3.5 28 3.5 29 7.0 30 8.5 31 17.5 32 27.5 33 33.5 34 45.0 35 55.0 36 75.0 37 100.0 38 132.0 39 167.0 40 197.5 41 221.0 42 250.0 43 278.0 44 303.5 45 311.0 46 291.5 47 269.5 48 230.5 49 201.0 50 167.5 51 130.5 52 119.0 53 96.5 54 62.5 55 49.5 56 40.0 57 28.0 58 20.0 59 12.0 60 6.5 61 7.0 62 9.0 63 6.0 64 3.5 65 2.0 66 1.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 1.31 80-84 0.625 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.065 105-109 1.03 110-114 5.050000000000001 115-119 8.025 120-124 6.465 125-129 6.3100000000000005 130-134 1.32 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.6499999999999999 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 0.9 0.0 0.0 0.0 0.0 92-93 1.0125 0.0 0.0 0.0 0.0 94-95 1.2625000000000002 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.725 0.0 0.0 0.0 0.0 100-101 2.0125 0.0 0.0 0.0 0.0 102-103 2.2750000000000004 0.0 0.0 0.0 0.0 104-105 2.6375 0.0 0.0 0.0 0.0 106-107 2.95 0.0 0.0 0.0 0.0 108-109 3.2875 0.0 0.0 0.0 0.0 110-111 3.4875 0.0 0.0 0.0 0.0 112-113 3.875 0.0 0.0 0.0 0.0 114-115 4.387499999999999 0.0 0.0 0.0 0.0 116-117 4.699999999999999 0.0 0.0 0.0 0.0 118-119 5.0 0.0 0.0 0.0 0.0 120-121 5.5625 0.0 0.0 0.0 0.0 122-123 6.0 0.0 0.0 0.0 0.0 124-125 6.425 0.0 0.0 0.0 0.0 126-127 6.75 0.0 0.0 0.0 0.0 128-129 7.2625 0.0 0.0 0.0 0.0 130-131 7.9375 0.0 0.0 0.0 0.0 132-133 8.725000000000001 0.0 0.0 0.0 0.0 134-135 9.412500000000001 0.0 0.0 0.0 0.0 136-137 10.025 0.0 0.0 0.0 0.0 138-139 10.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGCCA 10 0.007271448 142.0 4 ATGCCAA 10 0.007271448 142.0 5 >>END_MODULE Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra Read 936478 spots for SRR7169760.sra Written 936478 spots for SRR7169760.sra SRR ids: ['SRR7169760.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u5c06f1c SRR7169760.sra spots: 18729560 blocks: [[1, 936478], [936479, 1872956], [1872957, 2809434], [2809435, 3745912], [3745913, 4682390], [4682391, 5618868], [5618869, 6555346], [6555347, 7491824], [7491825, 8428302], [8428303, 9364780], [9364781, 10301258], [10301259, 11237736], [11237737, 12174214], [12174215, 13110692], [13110693, 14047170], [14047171, 14983648], [14983649, 15920126], [15920127, 16856604], [16856605, 17793082], [17793083, 18729560]] SRR7169760 file size 6325132 SRR7169760 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169760 SRR7169760_1.fastq SRR7169760_2.fastq Input file: SRR7169760_1.fastq Paired file: SRR7169760_2.fastq trimmed: SRR7169760-trimmed-pair1.fastq, SRR7169760-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:13:56 2025 >> started Tue Feb 11 14:14:18 2025 >> done (22.582s) 18729560 read pairs processed; of these: 9445 ( 0.05%) short read pairs filtered out after trimming by size control 11587 ( 0.06%) empty read pairs filtered out after trimming by size control 18708528 (99.89%) read pairs available; of these: 9207832 (49.22%) trimmed read pairs available after processing 9500696 (50.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 4 0.00% 21 4 0.00% 22 7 0.00% 23 6 0.00% 24 5 0.00% 25 2 0.00% 26 16 0.00% 27 6 0.00% 28 5 0.00% 29 13 0.00% 30 7 0.00% 31 8 0.00% 32 12 0.00% 33 13 0.00% 34 13 0.00% 35 25 0.00% 36 27 0.00% 37 27 0.00% 38 28 0.00% 39 24 0.00% 40 46 0.00% 41 56 0.00% 42 72 0.00% 43 67 0.00% 44 64 0.00% 45 92 0.00% 46 73 0.00% 47 104 0.00% 48 116 0.00% 49 126 0.00% 50 216 0.00% 51 195 0.00% 52 248 0.00% 53 238 0.00% 54 281 0.00% 55 277 0.00% 56 286 0.00% 57 373 0.00% 58 407 0.00% 59 459 0.00% 60 596 0.00% 61 722 0.00% 62 763 0.00% 63 885 0.00% 64 995 0.01% 65 1117 0.01% 66 1205 0.01% 67 1351 0.01% 68 1445 0.01% 69 1736 0.01% 70 2010 0.01% 71 2449 0.01% 72 2705 0.01% 73 3140 0.02% 74 3503 0.02% 75 3845 0.02% 76 4135 0.02% 77 4531 0.02% 78 4846 0.03% 79 5606 0.03% 80 6206 0.03% 81 7139 0.04% 82 7997 0.04% 83 9028 0.05% 84 10317 0.06% 85 11723 0.06% 86 12397 0.07% 87 12993 0.07% 88 14197 0.08% 89 15032 0.08% 90 15784 0.08% 91 17508 0.09% 92 18743 0.10% 93 20677 0.11% 94 22103 0.12% 95 23503 0.13% 96 24692 0.13% 97 25486 0.14% 98 26554 0.14% 99 27387 0.15% 100 28933 0.15% 101 30152 0.16% 102 32207 0.17% 103 34151 0.18% 104 35999 0.19% 105 37739 0.20% 106 39272 0.21% 107 40072 0.21% 108 40817 0.22% 109 41688 0.22% 110 42694 0.23% 111 44366 0.24% 112 46507 0.25% 113 48345 0.26% 114 50238 0.27% 115 52260 0.28% 116 53833 0.29% 117 55150 0.29% 118 55138 0.29% 119 56200 0.30% 120 57313 0.31% 121 58432 0.31% 122 59768 0.32% 123 62211 0.33% 124 64819 0.35% 125 67010 0.36% 126 69063 0.37% 127 70804 0.38% 128 71388 0.38% 129 72904 0.39% 130 74003 0.40% 131 75741 0.40% 132 77860 0.42% 133 80094 0.43% 134 83591 0.45% 135 85627 0.46% 136 89685 0.48% 137 92364 0.49% 138 95701 0.51% 139 99268 0.53% 140 104758 0.56% 141 112362 0.60% 142 120654 0.64% 143 128137 0.68% 144 144775 0.77% 145 169430 0.91% 146 202023 1.08% 147 270095 1.44% 148 393466 2.10% 149 770428 4.12% 150 4037190 21.58% 151 9500696 50.78% 18708528 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=15.97 fanout-score-rank=17 prefix-density=0.26 prefix-fanout=7.5 sequence=CAACCTCAACAGTGGCCATTGGAACTAGAAGGAAAATAAAGCACAGCTGGGATACAAAAGAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=359.95 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=30.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=40 prefix-density=0.23 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=315.81 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=28.6 sequence=AAGAAGAAGAAG SRR7169760 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:15:00 Started mapping on | Feb 11 14:15:00 Finished on | Feb 11 14:16:31 Mapping speed, Million of reads per hour | 740.12 Number of input reads | 18708528 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17965782 Uniquely mapped reads % | 96.03% Average mapped length | 290.20 Number of splices: Total | 17322415 Number of splices: Annotated (sjdb) | 17038537 Number of splices: GT/AG | 17058166 Number of splices: GC/AG | 212778 Number of splices: AT/AC | 14207 Number of splices: Non-canonical | 37264 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360493 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 45559 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 392636 392636 392636 N_multimapping 360493 360493 360493 N_noFeature 438675 17791993 531666 N_ambiguous 147016 919 65606 UnstrandedReadsAssigned:17380091 PositiveStrandReadsAssigned:172870 NegativeStrandReadsAssigned:17368510 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169760 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169760-trimmed-pair1.fastq SRR7169760-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,708,528 reads, 17,258,878 reads pseudoaligned [quant] estimated average fragment length: 212.849 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7169760.ke.tsv 34699 SRR7169760.se.tsv 87100 total ==> SRR7169760.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.15 298 10.1467 Potri.005G024800.1.v4.1 1035 823.151 56 4.1838 Potri.004G059700.1.v4.1 961 749.16 1 0.0820896 Potri.007G009000.2.v4.1 1416 1204.15 0 0 Potri.003G141000.2.v4.1 2943 2731.15 357.095 8.04083 Potri.016G087400.1.v4.1 270 92.5956 1608 1067.97 Potri.015G069301.1.v4.1 564 354.043 0 0 Potri.010G195200.1.v4.1 1773 1561.15 9 0.354536 Potri.012G127500.1.v4.1 977 765.16 8733 701.898 ==> SRR7169760.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 872 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169760 completed mapping pipeline successfully