Starting /dee2/code/volunteer_pipeline.sh SRR7169761 current disk space = 3050376892416 free memory = 1444591820 SRR7169761 SRAfilesize b8c67dd89e5ee4c78e04068aef9a7b2a SRR7169761.sra SRR7169761.sra file validated SRR7169761 is paired end SRR7169761 is conventional basespace SRR7169761 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169761_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.3695 32.0 28.0 33.0 18.0 34.0 2 31.16075 33.0 31.0 33.0 28.0 33.0 3 32.46775 33.0 33.0 33.0 31.0 34.0 4 32.9435 33.0 33.0 34.0 31.0 34.0 5 33.23 33.0 33.0 34.0 33.0 34.0 6 37.19175 38.0 37.0 38.0 36.0 38.0 7 37.52125 38.0 38.0 38.0 37.0 38.0 8 37.62825 38.0 38.0 38.0 38.0 38.0 9 37.7055 38.0 38.0 38.0 38.0 38.0 10-14 37.704750000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.67335 38.0 38.0 38.0 38.0 38.0 20-24 37.68005000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.656099999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.6396 38.0 38.0 38.0 38.0 38.0 35-39 37.4615 38.0 38.0 38.0 37.8 38.0 40-44 37.19415 38.0 38.0 38.0 36.4 38.0 45-49 37.443 38.0 38.0 38.0 37.2 38.0 50-54 37.48765 38.0 38.0 38.0 37.2 38.0 55-59 37.45535 38.0 38.0 38.0 37.0 38.0 60-64 37.37435 38.0 38.0 38.0 37.0 38.0 65-69 37.285849999999996 38.0 38.0 38.0 36.8 38.0 70-74 37.19445 38.0 38.0 38.0 36.2 38.0 75-79 37.19565 38.0 38.0 38.0 36.4 38.0 80-84 37.158950000000004 38.0 38.0 38.0 36.0 38.0 85-89 37.0272 38.0 38.0 38.0 35.8 38.0 90-94 36.830999999999996 38.0 38.0 38.0 35.2 38.0 95-99 36.89919999999999 38.0 38.0 38.0 35.4 38.0 100-104 36.7059 38.0 38.0 38.0 35.0 38.0 105-109 36.5462 38.0 38.0 38.0 34.0 38.0 110-114 36.4519 38.0 38.0 38.0 34.0 38.0 115-119 36.2734 38.0 37.6 38.0 34.0 38.0 120-124 36.15220000000001 38.0 37.2 38.0 33.6 38.0 125-129 35.93415 38.0 37.0 38.0 33.0 38.0 130-134 35.61775 38.0 36.4 38.0 31.6 38.0 135-139 35.35125 38.0 36.0 38.0 31.0 38.0 140-144 35.06224999999999 38.0 35.4 38.0 29.4 38.0 145-149 34.67205 38.0 35.0 38.0 28.2 38.0 150-151 30.957625 36.5 29.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 4.0 19 4.0 20 3.0 21 3.0 22 1.0 23 5.0 24 4.0 25 4.0 26 8.0 27 14.0 28 14.0 29 20.0 30 29.0 31 41.0 32 73.0 33 66.0 34 129.0 35 245.0 36 637.0 37 2690.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.7342799188641 11.029411764705882 9.888438133874239 37.34787018255578 2 23.075000000000003 15.024999999999999 35.225 26.674999999999997 3 20.150000000000002 21.575 25.05 33.225 4 22.225 30.075000000000003 23.325000000000003 24.375 5 22.025 33.375 24.65 19.950000000000003 6 18.125 36.775000000000006 25.924999999999997 19.175 7 14.75 25.724999999999998 42.199999999999996 17.325 8 18.8 25.1 31.075000000000003 25.025 9 17.825 24.224999999999998 34.1 23.849999999999998 10-14 20.225 29.985 26.565 23.225 15-19 20.03 28.965000000000003 27.825 23.18 20-24 19.634999999999998 29.375 27.67 23.32 25-29 19.48 29.4 27.33 23.79 30-34 19.945 29.23 27.235 23.59 35-39 20.044999999999998 29.34 27.245 23.369999999999997 40-44 20.44 29.39 27.355 22.814999999999998 45-49 20.27 28.494999999999997 27.36 23.875 50-54 20.465 29.225 27.11 23.200000000000003 55-59 20.119999999999997 29.665000000000003 27.229999999999997 22.985 60-64 19.93 29.585 27.235 23.25 65-69 20.02 29.195 27.52 23.265 70-74 20.305 28.93 27.389999999999997 23.375 75-79 20.24 29.060000000000002 26.979999999999997 23.72 80-84 20.349999999999998 29.310000000000002 27.04 23.3 85-89 20.325 29.62 27.005000000000003 23.05 90-94 20.875 28.57 26.715 23.84 95-99 20.875 29.189999999999998 26.825 23.11 100-104 20.775 29.4 26.340000000000003 23.485 105-109 20.75 29.2 26.619999999999997 23.43 110-114 20.77 28.815 26.86 23.555 115-119 21.04 28.915000000000003 26.76 23.285 120-124 21.465 28.52 26.185000000000002 23.830000000000002 125-129 21.135 27.875 26.939999999999998 24.05 130-134 20.810000000000002 28.98 26.43 23.78 135-139 21.105 28.24 26.575 24.08 140-144 20.635 29.154999999999998 26.619999999999997 23.59 145-149 20.965 28.860000000000003 26.33 23.845 150-151 21.0375 28.299999999999997 25.7375 24.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 2.0 23 3.0 24 3.5 25 5.5 26 4.5 27 7.5 28 10.0 29 10.0 30 18.0 31 26.5 32 36.5 33 56.0 34 67.5 35 79.0 36 111.0 37 124.5 38 122.5 39 152.0 40 186.5 41 204.0 42 222.0 43 253.5 44 260.0 45 258.0 46 276.0 47 265.0 48 242.0 49 201.0 50 161.5 51 147.5 52 112.0 53 89.0 54 78.5 55 59.5 56 41.0 57 25.5 58 20.5 59 16.0 60 9.5 61 3.5 62 4.5 63 5.0 64 2.5 65 1.5 66 1.5 67 2.5 68 3.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.325 0.0 0.0 0.0 0.0 96-97 1.625 0.0 0.0 0.0 0.0 98-99 1.95 0.0 0.0 0.0 0.0 100-101 2.1625 0.0 0.0 0.0 0.0 102-103 2.4125 0.0 0.0 0.0 0.0 104-105 2.675 0.0 0.0 0.0 0.0 106-107 3.1375 0.0 0.0 0.0 0.0 108-109 3.6875 0.0 0.0 0.0 0.0 110-111 4.1875 0.0 0.0 0.0 0.0 112-113 4.7125 0.0 0.0 0.0 0.0 114-115 5.1 0.0 0.0 0.0 0.0 116-117 5.6125 0.0 0.0 0.0 0.0 118-119 6.125 0.0 0.0 0.0 0.0 120-121 6.85 0.0 0.0 0.0 0.0 122-123 7.4625 0.0 0.0 0.0 0.0 124-125 8.1625 0.0 0.0 0.0 0.0 126-127 8.75 0.0 0.0 0.0 0.0 128-129 9.4625 0.0 0.0 0.0 0.0 130-131 10.2625 0.0 0.0 0.0 0.0 132-133 10.9625 0.0 0.0 0.0 0.0 134-135 11.6375 0.0 0.0 0.0 0.0 136-137 12.5625 0.0 0.0 0.0 0.0 138-139 13.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGAGG 10 0.006830828 145.0 6 CACGGTA 10 0.006830828 145.0 3 >>END_MODULE SRR7169761 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169761_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8755 33.0 33.0 34.0 32.0 34.0 2 31.8915 33.0 33.0 34.0 27.0 34.0 3 32.8235 33.0 33.0 34.0 32.0 34.0 4 32.98375 33.0 33.0 34.0 32.0 34.0 5 33.15725 34.0 33.0 34.0 33.0 34.0 6 37.443 38.0 38.0 38.0 37.0 38.0 7 37.4285 38.0 38.0 38.0 38.0 38.0 8 37.43475 38.0 38.0 38.0 38.0 38.0 9 37.48825 38.0 38.0 38.0 38.0 38.0 10-14 37.419799999999995 38.0 38.0 38.0 37.8 38.0 15-19 37.4185 38.0 38.0 38.0 38.0 38.0 20-24 37.37825 38.0 38.0 38.0 37.8 38.0 25-29 37.3636 38.0 38.0 38.0 37.6 38.0 30-34 37.293 38.0 38.0 38.0 37.0 38.0 35-39 36.9828 38.0 38.0 38.0 36.0 38.0 40-44 37.26835 38.0 38.0 38.0 37.0 38.0 45-49 36.8432 38.0 38.0 38.0 35.4 38.0 50-54 37.080349999999996 38.0 38.0 38.0 36.6 38.0 55-59 36.476350000000004 38.0 37.4 38.0 34.0 38.0 60-64 37.038349999999994 38.0 38.0 38.0 36.2 38.0 65-69 36.9424 38.0 38.0 38.0 36.4 38.0 70-74 36.89059999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.77825 38.0 38.0 38.0 35.8 38.0 80-84 36.75225 38.0 38.0 38.0 35.8 38.0 85-89 35.8324 38.0 36.8 38.0 29.8 38.0 90-94 36.66355 38.0 38.0 38.0 35.4 38.0 95-99 36.667199999999994 38.0 38.0 38.0 35.4 38.0 100-104 36.55925 38.0 38.0 38.0 34.8 38.0 105-109 35.9556 38.0 37.6 38.0 33.0 38.0 110-114 35.09565 38.0 37.0 38.0 29.0 38.0 115-119 34.338550000000005 38.0 36.4 38.0 25.2 38.0 120-124 34.6722 38.0 36.2 38.0 26.6 38.0 125-129 34.5764 38.0 36.0 38.0 25.4 38.0 130-134 34.21195 38.0 35.0 38.0 23.4 38.0 135-139 34.24265 38.0 35.0 38.0 24.6 38.0 140-144 32.8515 37.6 32.0 38.0 19.0 38.0 145-149 32.33995 38.0 32.2 38.0 16.2 38.0 150-151 28.908 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 0.0 5 0.0 6 1.0 7 2.0 8 0.0 9 0.0 10 1.0 11 2.0 12 2.0 13 4.0 14 3.0 15 4.0 16 5.0 17 3.0 18 2.0 19 5.0 20 5.0 21 14.0 22 5.0 23 5.0 24 11.0 25 13.0 26 16.0 27 22.0 28 25.0 29 32.0 30 50.0 31 72.0 32 110.0 33 160.0 34 170.0 35 323.0 36 745.0 37 2182.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.9 18.45 15.55 27.1 2 27.3 25.275 31.075000000000003 16.35 3 20.175 28.775000000000002 31.974999999999998 19.075 4 23.925 34.2 23.25 18.625 5 24.9 35.15 23.0 16.950000000000003 6 21.6 36.1 23.825 18.475 7 20.325 20.25 39.925 19.5 8 22.075 25.3 28.249999999999996 24.375 9 21.55 25.1 30.65 22.7 10-14 23.29 28.384999999999998 26.66 21.665 15-19 23.275000000000002 27.55 28.194999999999997 20.979999999999997 20-24 23.369999999999997 28.225 27.644999999999996 20.76 25-29 22.770000000000003 28.095 27.91 21.224999999999998 30-34 22.99 27.98 28.060000000000002 20.97 35-39 23.04 28.139999999999997 27.93 20.89 40-44 22.919999999999998 27.85 28.485 20.745 45-49 22.985 27.46 29.15 20.405 50-54 23.875 27.650000000000002 27.83 20.645 55-59 23.445 28.27 28.16 20.125 60-64 23.085 27.32 28.965000000000003 20.630000000000003 65-69 23.53 27.67 28.405 20.395 70-74 24.044999999999998 27.185 28.055000000000003 20.715 75-79 23.735 27.384999999999998 28.53 20.349999999999998 80-84 23.52 27.18 28.76 20.54 85-89 23.845 27.365000000000002 28.02 20.77 90-94 23.11 27.279999999999998 28.485 21.125 95-99 23.82 27.944999999999997 28.09 20.145 100-104 23.955000000000002 27.634999999999998 28.610000000000003 19.8 105-109 24.425 27.99 27.534999999999997 20.05 110-114 24.146753313206776 27.749066161797064 27.590441590339253 20.51373893465691 115-119 24.94519260883182 27.61770539722309 27.294080801753832 20.143021192191252 120-124 24.962928874571766 27.24344224574321 27.54512450784885 20.24850437183617 125-129 25.375031782354434 27.348080345792013 27.85151284007119 19.425375031782355 130-134 24.97 27.565 27.694999999999997 19.77 135-139 25.415 27.91 27.38 19.295 140-144 26.505000000000003 27.800000000000004 26.484999999999996 19.21 145-149 26.27 27.825 26.86 19.045 150-151 26.1125 27.8125 27.037499999999998 19.037499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 0.5 25 2.0 26 3.5 27 4.0 28 5.5 29 10.0 30 14.5 31 21.0 32 32.0 33 35.5 34 45.0 35 62.0 36 75.5 37 103.5 38 128.5 39 155.5 40 198.5 41 229.5 42 251.5 43 275.5 44 289.0 45 294.5 46 290.0 47 251.5 48 214.5 49 206.5 50 191.5 51 149.0 52 112.5 53 94.0 54 72.5 55 47.0 56 33.0 57 28.5 58 19.0 59 11.0 60 7.0 61 7.5 62 7.0 63 5.0 64 3.5 65 2.0 66 0.5 67 0.5 68 0.5 69 1.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 2.2849999999999997 115-119 4.21 120-124 2.215 125-129 1.675 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.125 0.0 0.0 0.0 0.0 94-95 1.3 0.0 0.0 0.0 0.0 96-97 1.5875 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.1625 0.0 0.0 0.0 0.0 102-103 2.425 0.0 0.0 0.0 0.0 104-105 2.725 0.0 0.0 0.0 0.0 106-107 3.175 0.0 0.0 0.0 0.0 108-109 3.6624999999999996 0.0 0.0 0.0 0.0 110-111 4.1875 0.0 0.0 0.0 0.0 112-113 4.7 0.0 0.0 0.0 0.0 114-115 5.05 0.0 0.0 0.0 0.0 116-117 5.525 0.0 0.0 0.0 0.0 118-119 6.025 0.0 0.0 0.0 0.0 120-121 6.7125 0.0 0.0 0.0 0.0 122-123 7.262499999999999 0.0 0.0 0.0 0.0 124-125 7.8875 0.0 0.0 0.0 0.0 126-127 8.4625 0.0 0.0 0.0 0.0 128-129 9.1125 0.0 0.0 0.0 0.0 130-131 9.9125 0.0 0.0 0.0 0.0 132-133 10.575 0.0 0.0 0.0 0.0 134-135 11.175 0.0 0.0 0.0 0.0 136-137 12.0875 0.0 0.0 0.0 0.0 138-139 12.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTCTG 10 0.0069537736 144.1375 1 AAAGGTC 10 0.0069537736 144.1375 4 CCTTTGC 10 0.0069537736 144.1375 5 AAGGTCT 10 0.0069537736 144.1375 5 >>END_MODULE Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780987 spots for SRR7169761.sra Written 780987 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra Read 780970 spots for SRR7169761.sra Written 780970 spots for SRR7169761.sra SRR ids: ['SRR7169761.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cg8ym_8k SRR7169761.sra spots: 15619417 blocks: [[1, 780970], [780971, 1561940], [1561941, 2342910], [2342911, 3123880], [3123881, 3904850], [3904851, 4685820], [4685821, 5466790], [5466791, 6247760], [6247761, 7028730], [7028731, 7809700], [7809701, 8590670], [8590671, 9371640], [9371641, 10152610], [10152611, 10933580], [10933581, 11714550], [11714551, 12495520], [12495521, 13276490], [13276491, 14057460], [14057461, 14838430], [14838431, 15619417]] SRR7169761 file size 5271207 SRR7169761 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169761 SRR7169761_1.fastq SRR7169761_2.fastq Input file: SRR7169761_1.fastq Paired file: SRR7169761_2.fastq trimmed: SRR7169761-trimmed-pair1.fastq, SRR7169761-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:44:02 2025 >> started Tue Feb 11 13:44:19 2025 >> done (16.969s) 15619417 read pairs processed; of these: 11000 ( 0.07%) short read pairs filtered out after trimming by size control 15843 ( 0.10%) empty read pairs filtered out after trimming by size control 15592574 (99.83%) read pairs available; of these: 8037635 (51.55%) trimmed read pairs available after processing 7554939 (48.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 3 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 5 0.00% 25 8 0.00% 26 5 0.00% 27 7 0.00% 28 8 0.00% 29 4 0.00% 30 11 0.00% 31 11 0.00% 32 11 0.00% 33 22 0.00% 34 16 0.00% 35 20 0.00% 36 22 0.00% 37 33 0.00% 38 23 0.00% 39 48 0.00% 40 51 0.00% 41 47 0.00% 42 61 0.00% 43 79 0.00% 44 81 0.00% 45 108 0.00% 46 120 0.00% 47 130 0.00% 48 138 0.00% 49 161 0.00% 50 247 0.00% 51 260 0.00% 52 279 0.00% 53 319 0.00% 54 343 0.00% 55 369 0.00% 56 437 0.00% 57 472 0.00% 58 528 0.00% 59 577 0.00% 60 688 0.00% 61 873 0.01% 62 1038 0.01% 63 1104 0.01% 64 1235 0.01% 65 1379 0.01% 66 1493 0.01% 67 1687 0.01% 68 1896 0.01% 69 2130 0.01% 70 2541 0.02% 71 3010 0.02% 72 3462 0.02% 73 3855 0.02% 74 4314 0.03% 75 4633 0.03% 76 5276 0.03% 77 5694 0.04% 78 5989 0.04% 79 6582 0.04% 80 7315 0.05% 81 8477 0.05% 82 9537 0.06% 83 10670 0.07% 84 11968 0.08% 85 13254 0.09% 86 13853 0.09% 87 14588 0.09% 88 15569 0.10% 89 16079 0.10% 90 17238 0.11% 91 18822 0.12% 92 20338 0.13% 93 21981 0.14% 94 23620 0.15% 95 24737 0.16% 96 25771 0.17% 97 26558 0.17% 98 26944 0.17% 99 28049 0.18% 100 29310 0.19% 101 30263 0.19% 102 32128 0.21% 103 34042 0.22% 104 35557 0.23% 105 37156 0.24% 106 38285 0.25% 107 38646 0.25% 108 39187 0.25% 109 40013 0.26% 110 40679 0.26% 111 42120 0.27% 112 43701 0.28% 113 45537 0.29% 114 47339 0.30% 115 48972 0.31% 116 50167 0.32% 117 50532 0.32% 118 50927 0.33% 119 50802 0.33% 120 51935 0.33% 121 53069 0.34% 122 54759 0.35% 123 57147 0.37% 124 58882 0.38% 125 60656 0.39% 126 62508 0.40% 127 63818 0.41% 128 64279 0.41% 129 65190 0.42% 130 66547 0.43% 131 67019 0.43% 132 69391 0.45% 133 71596 0.46% 134 73913 0.47% 135 76200 0.49% 136 79207 0.51% 137 81902 0.53% 138 85097 0.55% 139 87649 0.56% 140 91165 0.58% 141 98132 0.63% 142 104872 0.67% 143 114491 0.73% 144 129845 0.83% 145 149749 0.96% 146 179340 1.15% 147 231965 1.49% 148 338044 2.17% 149 642174 4.12% 150 3362401 21.56% 151 7554939 48.45% 15592574 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.7 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=279.13 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=19.2 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=29 prefix-density=0.23 prefix-fanout=2.8 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.03 sequence-density-rank=42 fanout-score=91.04 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=12.6 sequence=CTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169761 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:45:08 Started mapping on | Feb 11 13:45:09 Finished on | Feb 11 13:46:33 Mapping speed, Million of reads per hour | 668.25 Number of input reads | 15592574 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14949436 Uniquely mapped reads % | 95.88% Average mapped length | 288.54 Number of splices: Total | 13154700 Number of splices: Annotated (sjdb) | 12931136 Number of splices: GT/AG | 12962086 Number of splices: GC/AG | 152507 Number of splices: AT/AC | 10660 Number of splices: Non-canonical | 29447 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254938 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 18247 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.34% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 398758 398758 398758 N_multimapping 254938 254938 254938 N_noFeature 412057 14743201 515317 N_ambiguous 159850 948 56103 UnstrandedReadsAssigned:14377529 PositiveStrandReadsAssigned:205287 NegativeStrandReadsAssigned:14378016 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169761 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169761-trimmed-pair1.fastq SRR7169761-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,592,574 reads, 14,290,616 reads pseudoaligned [quant] estimated average fragment length: 209.453 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR7169761.ke.tsv 34699 SRR7169761.se.tsv 87100 total ==> SRR7169761.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.55 300 13.06 Potri.005G024800.1.v4.1 1035 826.547 26 2.47799 Potri.004G059700.1.v4.1 961 752.547 1 0.104679 Potri.007G009000.2.v4.1 1416 1207.55 0 0 Potri.003G141000.2.v4.1 2943 2734.55 280.064 8.06799 Potri.016G087400.1.v4.1 270 95.8191 1328 1091.79 Potri.015G069301.1.v4.1 564 357.594 0 0 Potri.010G195200.1.v4.1 1773 1564.55 26 1.30912 Potri.012G127500.1.v4.1 977 768.547 5725 586.811 ==> SRR7169761.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1470 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169761 completed mapping pipeline successfully