Starting /dee2/code/volunteer_pipeline.sh SRR7169762 current disk space = 3050322829312 free memory = 1449315256 SRR7169762 SRAfilesize 500627c9f04ad4439fc34ac725653b42 SRR7169762.sra SRR7169762.sra file validated SRR7169762 is paired end SRR7169762 is conventional basespace SRR7169762 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169762_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.8495 32.0 30.0 33.0 18.0 33.0 2 32.2575 33.0 33.0 33.0 30.0 33.0 3 32.69425 33.0 33.0 34.0 31.0 34.0 4 33.12 34.0 33.0 34.0 33.0 34.0 5 33.4095 34.0 33.0 34.0 33.0 34.0 6 37.28375 38.0 38.0 38.0 36.0 38.0 7 37.53275 38.0 38.0 38.0 37.0 38.0 8 37.56 38.0 38.0 38.0 38.0 38.0 9 37.6575 38.0 38.0 38.0 38.0 38.0 10-14 37.6339 38.0 38.0 38.0 38.0 38.0 15-19 37.623000000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.58925000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.59355 38.0 38.0 38.0 38.0 38.0 30-34 37.605149999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.57555 38.0 38.0 38.0 38.0 38.0 40-44 37.53645 38.0 38.0 38.0 38.0 38.0 45-49 37.47835 38.0 38.0 38.0 37.6 38.0 50-54 37.38015 38.0 38.0 38.0 37.2 38.0 55-59 37.25055 38.0 38.0 38.0 36.6 38.0 60-64 37.0972 38.0 38.0 38.0 36.0 38.0 65-69 37.23545 38.0 38.0 38.0 36.6 38.0 70-74 37.28935 38.0 38.0 38.0 37.0 38.0 75-79 37.114 38.0 38.0 38.0 36.2 38.0 80-84 37.155899999999995 38.0 38.0 38.0 36.4 38.0 85-89 37.088 38.0 38.0 38.0 36.4 38.0 90-94 36.90115 38.0 38.0 38.0 35.6 38.0 95-99 37.0022 38.0 38.0 38.0 36.0 38.0 100-104 36.9821 38.0 38.0 38.0 36.0 38.0 105-109 36.82325 38.0 38.0 38.0 35.2 38.0 110-114 36.7084 38.0 38.0 38.0 35.0 38.0 115-119 36.48385 38.0 38.0 38.0 34.4 38.0 120-124 36.36225 38.0 38.0 38.0 34.2 38.0 125-129 36.278349999999996 38.0 38.0 38.0 34.0 38.0 130-134 36.03855 38.0 37.4 38.0 33.0 38.0 135-139 35.836149999999996 38.0 37.0 38.0 32.4 38.0 140-144 35.661249999999995 38.0 36.0 38.0 32.0 38.0 145-149 35.1592 38.0 35.8 38.0 30.8 38.0 150-151 30.947625000000002 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 2.0 18 1.0 19 5.0 20 1.0 21 4.0 22 1.0 23 2.0 24 3.0 25 11.0 26 9.0 27 7.0 28 16.0 29 20.0 30 35.0 31 41.0 32 54.0 33 89.0 34 121.0 35 188.0 36 503.0 37 2882.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.9 12.375 9.0 36.725 2 21.260630315157577 16.558279139569784 34.242121060530266 27.938969484742373 3 19.425 21.4 28.075 31.1 4 22.400000000000002 28.449999999999996 23.7 25.45 5 22.2 33.050000000000004 24.325 20.424999999999997 6 19.575 35.475 25.525 19.425 7 14.174999999999999 26.450000000000003 40.975 18.4 8 18.625 25.6 30.25 25.525 9 17.349999999999998 24.7 34.025 23.925 10-14 19.81 29.654999999999998 26.505000000000003 24.03 15-19 19.545 28.255000000000003 28.435 23.765 20-24 19.43 28.435 27.92 24.215 25-29 19.82 28.749999999999996 27.96 23.47 30-34 20.0 29.005 27.060000000000002 23.935000000000002 35-39 19.85 28.78 27.79 23.580000000000002 40-44 20.23 29.360000000000003 27.384999999999998 23.025000000000002 45-49 20.34 28.975 26.779999999999998 23.905 50-54 19.88 29.080000000000002 27.435 23.605 55-59 20.150000000000002 29.195 27.275 23.380000000000003 60-64 20.805 28.175 27.91 23.11 65-69 19.82 28.84 27.105 24.235 70-74 20.06 28.645 27.450000000000003 23.845 75-79 20.275000000000002 28.525 27.42 23.78 80-84 20.285 28.544999999999998 27.435 23.735 85-89 19.919999999999998 28.810000000000002 27.075 24.195 90-94 20.605 28.199999999999996 27.155 24.04 95-99 19.905 28.485 28.050000000000004 23.56 100-104 20.755000000000003 28.215 27.355 23.674999999999997 105-109 20.915 28.26 27.089999999999996 23.735 110-114 20.76434395477965 28.81796808563854 27.06217798009104 23.355509979490773 115-119 21.195 28.59 26.655 23.56 120-124 20.805 28.63 27.1 23.465 125-129 21.335 28.105000000000004 27.055 23.505000000000003 130-134 21.325 28.54 26.745 23.39 135-139 20.895 28.415000000000003 27.015 23.674999999999997 140-144 20.825 28.360000000000003 27.029999999999998 23.785 145-149 20.815 28.575 26.0 24.610000000000003 150-151 21.55 27.275 27.3 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 1.0 23 0.0 24 1.5 25 3.0 26 3.0 27 2.0 28 5.5 29 16.0 30 21.5 31 25.5 32 35.0 33 49.0 34 55.5 35 61.0 36 89.5 37 117.0 38 129.5 39 148.5 40 190.5 41 207.5 42 242.5 43 270.0 44 271.5 45 277.0 46 256.5 47 255.5 48 236.5 49 208.0 50 181.5 51 149.5 52 113.5 53 90.0 54 79.0 55 56.0 56 39.5 57 25.0 58 16.5 59 13.5 60 11.5 61 12.0 62 9.5 63 4.5 64 2.5 65 1.5 66 0.5 67 2.0 68 3.0 69 2.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.045 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.11249999999999999 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.95 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 2.6 0.0 0.0 0.0 0.0 108-109 3.0125 0.0 0.0 0.0 0.0 110-111 3.3875 0.0 0.0 0.0 0.0 112-113 3.7874999999999996 0.0 0.0 0.0 0.0 114-115 4.275 0.0 0.0 0.0 0.0 116-117 4.625 0.0 0.0 0.0 0.0 118-119 5.0 0.0 0.0 0.0 0.0 120-121 5.425 0.0 0.0 0.0 0.0 122-123 5.9875 0.0 0.0 0.0 0.0 124-125 6.4 0.0 0.0 0.0 0.0 126-127 6.9 0.0 0.0 0.0 0.0 128-129 7.375 0.0 0.0 0.0 0.0 130-131 7.975 0.0 0.0 0.0 0.0 132-133 8.7 0.0 0.0 0.0 0.0 134-135 9.3625 0.0 0.0 0.0 0.0 136-137 9.9875 0.0 0.0 0.0 0.0 138-139 10.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169762 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169762_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.122 33.0 33.0 34.0 33.0 34.0 2 33.15125 34.0 33.0 34.0 33.0 34.0 3 33.1795 34.0 33.0 34.0 33.0 34.0 4 33.13125 34.0 33.0 34.0 33.0 34.0 5 33.20625 34.0 33.0 34.0 33.0 34.0 6 37.4195 38.0 38.0 38.0 38.0 38.0 7 37.402 38.0 38.0 38.0 38.0 38.0 8 37.42125 38.0 38.0 38.0 38.0 38.0 9 37.41675 38.0 38.0 38.0 38.0 38.0 10-14 37.42925000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.29135 38.0 38.0 38.0 37.6 38.0 20-24 37.33839999999999 38.0 38.0 38.0 37.8 38.0 25-29 37.316849999999995 38.0 38.0 38.0 37.4 38.0 30-34 37.2032 38.0 38.0 38.0 37.4 38.0 35-39 37.298 38.0 38.0 38.0 37.4 38.0 40-44 37.3467 38.0 38.0 38.0 38.0 38.0 45-49 37.30929999999999 38.0 38.0 38.0 38.0 38.0 50-54 37.21195 38.0 38.0 38.0 37.0 38.0 55-59 37.0132 38.0 38.0 38.0 36.8 38.0 60-64 36.883799999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.15255 38.0 38.0 38.0 36.8 38.0 70-74 37.114 38.0 38.0 38.0 37.0 38.0 75-79 36.0669 38.0 38.0 38.0 34.8 38.0 80-84 36.73010000000001 38.0 38.0 38.0 35.8 38.0 85-89 36.788650000000004 38.0 37.8 38.0 35.2 38.0 90-94 36.8587 38.0 38.0 38.0 35.8 38.0 95-99 36.88485 38.0 38.0 38.0 36.0 38.0 100-104 36.7164 38.0 38.0 38.0 35.6 38.0 105-109 35.182300000000005 38.0 37.2 38.0 28.2 38.0 110-114 34.4529 38.0 38.0 38.0 25.8 38.0 115-119 33.62835 38.0 37.6 38.0 15.6 38.0 120-124 33.920500000000004 38.0 37.0 38.0 19.8 38.0 125-129 34.39534999999999 38.0 36.8 38.0 24.0 38.0 130-134 35.3786 38.0 36.6 38.0 29.4 38.0 135-139 35.171350000000004 38.0 36.4 38.0 27.8 38.0 140-144 35.417300000000004 38.0 36.6 38.0 31.8 38.0 145-149 34.1097 38.0 35.0 38.0 25.2 38.0 150-151 31.154125 35.5 30.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 3.0 9 1.0 10 2.0 11 2.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 4.0 19 6.0 20 6.0 21 2.0 22 7.0 23 6.0 24 13.0 25 11.0 26 13.0 27 23.0 28 29.0 29 79.0 30 60.0 31 77.0 32 96.0 33 102.0 34 118.0 35 199.0 36 488.0 37 2638.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.675 21.075 13.200000000000001 27.05 2 26.307884856070086 26.783479349186486 30.78848560700876 16.12015018773467 3 20.34068136272545 29.383767535070138 30.38577154308617 19.88977955911824 4 22.781954887218046 34.18546365914787 23.533834586466167 19.49874686716792 5 23.804755944931163 36.2953692115144 23.30413016270338 16.595744680851062 6 22.400000000000002 36.875 23.35 17.375 7 19.8 21.825 38.025 20.349999999999998 8 20.7 26.125 28.449999999999996 24.725 9 21.75 26.1 29.299999999999997 22.85 10-14 22.99 28.375 26.555 22.08 15-19 23.127720246135375 28.39061483816099 27.740257141427787 20.741407774275853 20-24 22.795 28.470000000000002 27.48 21.255 25-29 22.895 28.23 27.435 21.44 30-34 23.083462519377907 28.489273391008652 28.264239635945394 20.16302445366805 35-39 22.88 28.449999999999996 27.48 21.19 40-44 23.315 28.625 27.415 20.645 45-49 23.190435696063226 27.787504376969636 27.967585413436048 21.054474513531087 50-54 22.855425910160747 28.454103860984524 27.577745505533578 21.112724723321147 55-59 22.912601931062085 27.825303917154436 28.38060933513432 20.881484816649156 60-64 23.66591647911978 27.311827956989248 28.41210302575644 20.610152538134532 65-69 23.705000000000002 27.62 28.34 20.335 70-74 23.39327756349246 28.39252617342083 27.646145368932523 20.568050894154187 75-79 23.366834170854272 27.140806071172186 28.966259870782483 20.52609988719106 80-84 22.964488422321562 28.208347983324124 27.77135968657391 21.0558039077804 85-89 23.625 27.525 28.705000000000002 20.145 90-94 23.71592898224556 27.781945486371594 28.092023005751436 20.41010252563141 95-99 24.050632911392405 27.57292239955971 27.73802971931756 20.638414969730327 100-104 24.769907963185275 28.031212484994 27.150860344137655 20.048019207683073 105-109 24.247569069300816 28.049596131090187 27.082368678293978 20.62046612131502 110-114 24.249189390315205 27.991282623717638 27.62451496305746 20.13501302290969 115-119 24.431137724550897 27.52313554708764 27.87697332607512 20.168753402286335 120-124 25.01205593955956 28.02336173176874 27.33751272571398 19.627069602957725 125-129 24.811794228356337 27.498954412379756 27.619196988707657 20.070054370556253 130-134 25.117676514772157 28.352528793189784 26.97045568352529 19.55933900851277 135-139 25.535000000000004 28.205000000000002 26.834999999999997 19.425 140-144 25.985000000000003 27.68 27.01 19.325 145-149 25.796289814490724 28.23141157057853 26.711335566778338 19.26096304815241 150-151 25.72723838307518 28.636191915375896 26.79763253998237 18.838937161566555 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.5 24 1.5 25 1.5 26 2.5 27 5.0 28 6.0 29 8.5 30 16.5 31 18.5 32 22.0 33 36.5 34 47.5 35 59.0 36 83.0 37 110.5 38 140.0 39 165.5 40 200.5 41 246.5 42 276.5 43 291.0 44 288.0 45 273.5 46 263.5 47 247.0 48 212.0 49 199.0 50 175.5 51 144.0 52 132.0 53 92.0 54 56.5 55 52.0 56 37.0 57 18.5 58 15.0 59 11.0 60 8.5 61 9.0 62 8.0 63 4.5 64 2.0 65 1.0 66 2.0 67 2.5 68 1.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.125 3 0.2 4 0.25 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.055 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.0 40-44 0.0 45-49 0.045 50-54 0.155 55-59 0.055 60-64 0.025 65-69 0.0 70-74 0.185 75-79 2.4899999999999998 80-84 0.455 85-89 0.0 90-94 0.025 95-99 0.065 100-104 0.04 105-109 2.815 110-114 5.935 115-119 8.15 120-124 6.6850000000000005 125-129 4.36 130-134 0.15 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.7374999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.11249999999999999 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.6375000000000002 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.1500000000000004 0.0 0.0 0.0 0.0 112-113 3.5 0.0 0.0 0.0 0.0 114-115 3.9250000000000003 0.0 0.0 0.0 0.0 116-117 4.2625 0.0 0.0 0.0 0.0 118-119 4.6 0.0 0.0 0.0 0.0 120-121 5.012499999999999 0.0 0.0 0.0 0.0 122-123 5.525 0.0 0.0 0.0 0.0 124-125 5.925 0.0 0.0 0.0 0.0 126-127 6.425 0.0 0.0 0.0 0.0 128-129 6.875 0.0 0.0 0.0 0.0 130-131 7.487500000000001 0.0 0.0 0.0 0.0 132-133 8.2 0.0 0.0 0.0 0.0 134-135 8.8875 0.0 0.0 0.0 0.0 136-137 9.475 0.0 0.0 0.0 0.0 138-139 10.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTACTT 10 0.007114892 143.0375 1 >>END_MODULE Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715731 spots for SRR7169762.sra Written 715731 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra Read 715714 spots for SRR7169762.sra Written 715714 spots for SRR7169762.sra SRR ids: ['SRR7169762.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d8dx1twt SRR7169762.sra spots: 14314297 blocks: [[1, 715714], [715715, 1431428], [1431429, 2147142], [2147143, 2862856], [2862857, 3578570], [3578571, 4294284], [4294285, 5009998], [5009999, 5725712], [5725713, 6441426], [6441427, 7157140], [7157141, 7872854], [7872855, 8588568], [8588569, 9304282], [9304283, 10019996], [10019997, 10735710], [10735711, 11451424], [11451425, 12167138], [12167139, 12882852], [12882853, 13598566], [13598567, 14314297]] SRR7169762 file size 4828945 SRR7169762 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169762 SRR7169762_1.fastq SRR7169762_2.fastq Input file: SRR7169762_1.fastq Paired file: SRR7169762_2.fastq trimmed: SRR7169762-trimmed-pair1.fastq, SRR7169762-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:31:58 2025 >> started Tue Feb 11 13:32:20 2025 >> done (22.235s) 14314297 read pairs processed; of these: 10028 ( 0.07%) short read pairs filtered out after trimming by size control 12839 ( 0.09%) empty read pairs filtered out after trimming by size control 14291430 (99.84%) read pairs available; of these: 6378340 (44.63%) trimmed read pairs available after processing 7913090 (55.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 5 0.00% 22 4 0.00% 23 5 0.00% 24 5 0.00% 25 8 0.00% 26 8 0.00% 27 8 0.00% 28 4 0.00% 29 2 0.00% 30 4 0.00% 31 8 0.00% 32 8 0.00% 33 13 0.00% 34 14 0.00% 35 17 0.00% 36 17 0.00% 37 20 0.00% 38 29 0.00% 39 26 0.00% 40 45 0.00% 41 39 0.00% 42 33 0.00% 43 39 0.00% 44 38 0.00% 45 50 0.00% 46 56 0.00% 47 71 0.00% 48 83 0.00% 49 98 0.00% 50 101 0.00% 51 132 0.00% 52 144 0.00% 53 131 0.00% 54 165 0.00% 55 195 0.00% 56 175 0.00% 57 220 0.00% 58 282 0.00% 59 297 0.00% 60 373 0.00% 61 443 0.00% 62 474 0.00% 63 572 0.00% 64 598 0.00% 65 638 0.00% 66 727 0.01% 67 833 0.01% 68 912 0.01% 69 1000 0.01% 70 1204 0.01% 71 1461 0.01% 72 1678 0.01% 73 1804 0.01% 74 2020 0.01% 75 2284 0.02% 76 2507 0.02% 77 2826 0.02% 78 2897 0.02% 79 3191 0.02% 80 3695 0.03% 81 4254 0.03% 82 4927 0.03% 83 5498 0.04% 84 6545 0.05% 85 7490 0.05% 86 7909 0.06% 87 8225 0.06% 88 8998 0.06% 89 9489 0.07% 90 10406 0.07% 91 11180 0.08% 92 12272 0.09% 93 13776 0.10% 94 14402 0.10% 95 15561 0.11% 96 16351 0.11% 97 16752 0.12% 98 17369 0.12% 99 18225 0.13% 100 19102 0.13% 101 20153 0.14% 102 21552 0.15% 103 23408 0.16% 104 24505 0.17% 105 25869 0.18% 106 26823 0.19% 107 27345 0.19% 108 27884 0.20% 109 28617 0.20% 110 29396 0.21% 111 31024 0.22% 112 32170 0.23% 113 33831 0.24% 114 35287 0.25% 115 37123 0.26% 116 37969 0.27% 117 38928 0.27% 118 39211 0.27% 119 39243 0.27% 120 40428 0.28% 121 41507 0.29% 122 42577 0.30% 123 44310 0.31% 124 46707 0.33% 125 48395 0.34% 126 49530 0.35% 127 50171 0.35% 128 51001 0.36% 129 51926 0.36% 130 52499 0.37% 131 52963 0.37% 132 55067 0.39% 133 56506 0.40% 134 58417 0.41% 135 60773 0.43% 136 62936 0.44% 137 64748 0.45% 138 66657 0.47% 139 69256 0.48% 140 72512 0.51% 141 75718 0.53% 142 80398 0.56% 143 86275 0.60% 144 96279 0.67% 145 109401 0.77% 146 128547 0.90% 147 163986 1.15% 148 240268 1.68% 149 521370 3.65% 150 2893402 20.25% 151 7913090 55.37% 14291430 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=39 prefix-density=0.18 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=262.31 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=28.8 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=37 prefix-density=0.28 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=231.61 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=25.5 sequence=GAAGAAGAAGAAA SRR7169762 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:33:03 Started mapping on | Feb 11 13:33:04 Finished on | Feb 11 13:34:23 Mapping speed, Million of reads per hour | 651.26 Number of input reads | 14291430 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13645811 Uniquely mapped reads % | 95.48% Average mapped length | 291.43 Number of splices: Total | 12774061 Number of splices: Annotated (sjdb) | 12560884 Number of splices: GT/AG | 12589412 Number of splices: GC/AG | 147335 Number of splices: AT/AC | 11150 Number of splices: Non-canonical | 26164 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 246306 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 55514 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 408985 408985 408985 N_multimapping 246306 246306 246306 N_noFeature 331739 13489035 410318 N_ambiguous 132475 655 53811 UnstrandedReadsAssigned:13181597 PositiveStrandReadsAssigned:156121 NegativeStrandReadsAssigned:13181682 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169762 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169762-trimmed-pair1.fastq SRR7169762-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,291,430 reads, 13,120,937 reads pseudoaligned [quant] estimated average fragment length: 217.56 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7169762.ke.tsv 34699 SRR7169762.se.tsv 87100 total ==> SRR7169762.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.44 253 11.3422 Potri.005G024800.1.v4.1 1035 818.44 29 2.86158 Potri.004G059700.1.v4.1 961 744.458 3 0.325444 Potri.007G009000.2.v4.1 1416 1199.44 0 0 Potri.003G141000.2.v4.1 2943 2726.44 274.129 8.11997 Potri.016G087400.1.v4.1 270 91.104 1178 1044.25 Potri.015G069301.1.v4.1 564 350.282 0 0 Potri.010G195200.1.v4.1 1773 1556.44 30 1.55662 Potri.012G127500.1.v4.1 977 760.458 5160 547.986 ==> SRR7169762.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1225 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169762 completed mapping pipeline successfully