Starting /dee2/code/volunteer_pipeline.sh SRR7169763 current disk space = 3050289897472 free memory = 1365979596 SRR7169763 SRAfilesize d76bb7a143ca06127e53431d3a666168 SRR7169763.sra SRR7169763.sra file validated SRR7169763 is paired end SRR7169763 is conventional basespace SRR7169763 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169763_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.07125 32.0 30.0 33.0 18.0 33.0 2 32.27625 33.0 33.0 33.0 31.0 33.0 3 32.61675 33.0 33.0 34.0 31.0 34.0 4 32.70875 33.0 33.0 34.0 31.0 34.0 5 33.1555 34.0 33.0 34.0 32.0 34.0 6 37.0245 38.0 37.0 38.0 35.0 38.0 7 37.32125 38.0 38.0 38.0 36.0 38.0 8 37.47025 38.0 38.0 38.0 37.0 38.0 9 37.54425 38.0 38.0 38.0 38.0 38.0 10-14 37.5522 38.0 38.0 38.0 38.0 38.0 15-19 37.5435 38.0 38.0 38.0 38.0 38.0 20-24 37.5679 38.0 38.0 38.0 38.0 38.0 25-29 37.578700000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.53425 38.0 38.0 38.0 38.0 38.0 35-39 37.51115 38.0 38.0 38.0 38.0 38.0 40-44 37.54825 38.0 38.0 38.0 38.0 38.0 45-49 37.44455 38.0 38.0 38.0 37.4 38.0 50-54 37.4015 38.0 38.0 38.0 37.2 38.0 55-59 37.382099999999994 38.0 38.0 38.0 37.2 38.0 60-64 36.9218 38.0 38.0 38.0 35.6 38.0 65-69 37.1957 38.0 38.0 38.0 36.6 38.0 70-74 37.230599999999995 38.0 38.0 38.0 37.0 38.0 75-79 37.247550000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.1164 38.0 38.0 38.0 36.0 38.0 85-89 37.0799 38.0 38.0 38.0 36.2 38.0 90-94 36.81525 38.0 38.0 38.0 35.4 38.0 95-99 36.8818 38.0 38.0 38.0 35.6 38.0 100-104 36.91215 38.0 38.0 38.0 36.0 38.0 105-109 36.65915 38.0 38.0 38.0 35.0 38.0 110-114 36.5156 38.0 38.0 38.0 34.8 38.0 115-119 36.713699999999996 38.0 38.0 38.0 35.0 38.0 120-124 36.5253 38.0 38.0 38.0 34.4 38.0 125-129 36.39335 38.0 38.0 38.0 34.0 38.0 130-134 36.080749999999995 38.0 37.8 38.0 33.0 38.0 135-139 35.936 38.0 37.0 38.0 33.0 38.0 140-144 35.790949999999995 38.0 36.8 38.0 32.6 38.0 145-149 35.29815 38.0 36.0 38.0 31.0 38.0 150-151 31.62275 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 3.0 17 0.0 18 0.0 19 5.0 20 2.0 21 3.0 22 3.0 23 3.0 24 2.0 25 6.0 26 10.0 27 16.0 28 12.0 29 21.0 30 39.0 31 39.0 32 54.0 33 73.0 34 115.0 35 202.0 36 495.0 37 2893.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.7264269549912 10.812169977369877 8.649735981895901 36.811667085743025 2 22.125 14.924999999999999 34.4 28.549999999999997 3 18.7 21.025 27.325 32.95 4 22.775000000000002 29.549999999999997 22.925 24.75 5 22.625 33.45 23.325000000000003 20.599999999999998 6 18.9 36.425000000000004 24.575 20.1 7 13.653413353338333 26.331582895723933 42.91072768192048 17.104276069017253 8 16.900000000000002 25.5 30.675 26.924999999999997 9 16.5 24.875 34.2 24.425 10-14 19.77 30.080000000000002 27.08 23.07 15-19 20.035 28.32 28.410000000000004 23.235 20-24 20.11 28.335 28.12 23.435 25-29 19.96 28.89 27.37 23.78 30-34 19.161916191619163 29.15291529152915 27.63776377637764 24.04740474047405 35-39 19.771977197719774 28.842884288428845 27.157715771577156 24.227422742274225 40-44 19.97 28.849999999999998 27.715 23.465 45-49 20.11 28.549999999999997 27.24 24.099999999999998 50-54 20.235 29.445 27.045 23.275000000000002 55-59 19.8 29.195 27.51 23.494999999999997 60-64 20.05 28.455000000000002 27.595 23.9 65-69 20.07 28.4 27.485 24.044999999999998 70-74 20.4 28.835 27.445000000000004 23.32 75-79 20.424999999999997 29.325000000000003 26.765 23.485 80-84 20.325 28.975 27.065 23.635 85-89 20.34 28.9 26.924999999999997 23.835 90-94 20.815 28.565 27.11 23.51 95-99 20.266013300665033 28.536426821341067 27.566378318915945 23.631181559077955 100-104 21.25456455404932 27.972587664449 26.867090190585763 23.905757590915915 105-109 20.794017265609316 28.77434250150572 27.293716121260793 23.137924111624173 110-114 20.487927565392354 28.54627766599598 26.76056338028169 24.205231388329977 115-119 20.674999999999997 29.299999999999997 26.645000000000003 23.380000000000003 120-124 20.93 28.470000000000002 26.375 24.224999999999998 125-129 20.895 28.99 25.91 24.205 130-134 21.235 28.38 26.52 23.865 135-139 21.349999999999998 28.34 26.345000000000002 23.965 140-144 21.05 28.585 26.075 24.29 145-149 21.235 28.96 26.040000000000003 23.765 150-151 20.7551887971993 28.68217054263566 26.469117279319832 24.093523380845213 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 1.0 23 1.0 24 1.0 25 3.0 26 7.5 27 9.5 28 9.0 29 18.5 30 29.5 31 32.5 32 37.0 33 45.5 34 58.0 35 81.5 36 94.5 37 99.0 38 114.5 39 142.5 40 171.5 41 200.5 42 235.0 43 258.0 44 275.5 45 287.0 46 280.5 47 240.0 48 216.5 49 210.5 50 177.5 51 144.0 52 117.0 53 101.0 54 75.0 55 54.0 56 49.5 57 34.5 58 21.0 59 15.5 60 13.0 61 8.5 62 6.0 63 6.0 64 4.0 65 2.5 66 2.0 67 2.5 68 2.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.045 105-109 0.38 110-114 0.6 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.625 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.3125 0.0 0.0 0.0 0.0 102-103 2.675 0.0 0.0 0.0 0.0 104-105 3.15 0.0 0.0 0.0 0.0 106-107 3.575 0.0 0.0 0.0 0.0 108-109 3.9000000000000004 0.0 0.0 0.0 0.0 110-111 4.25 0.0 0.0 0.0 0.0 112-113 4.6 0.0 0.0 0.0 0.0 114-115 5.075 0.0 0.0 0.0 0.0 116-117 5.675000000000001 0.0 0.0 0.0 0.0 118-119 6.45 0.0 0.0 0.0 0.0 120-121 7.050000000000001 0.0 0.0 0.0 0.0 122-123 7.574999999999999 0.0 0.0 0.0 0.0 124-125 8.2 0.0 0.0 0.0 0.0 126-127 8.925 0.0 0.0 0.0 0.0 128-129 9.7 0.0 0.0 0.0 0.0 130-131 10.4 0.0 0.0 0.0 0.0 132-133 11.0625 0.0 0.0 0.0 0.0 134-135 11.7625 0.0 0.0 0.0 0.0 136-137 12.475000000000001 0.0 0.0 0.0 0.0 138-139 13.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGTAA 10 0.0068608476 144.78749 9 >>END_MODULE SRR7169763 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169763_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15225 33.0 33.0 34.0 33.0 34.0 2 33.23775 34.0 33.0 34.0 33.0 34.0 3 33.261 34.0 33.0 34.0 33.0 34.0 4 33.20525 34.0 33.0 34.0 33.0 34.0 5 33.185 34.0 33.0 34.0 33.0 34.0 6 37.395 38.0 38.0 38.0 38.0 38.0 7 37.414 38.0 38.0 38.0 38.0 38.0 8 37.4035 38.0 38.0 38.0 38.0 38.0 9 37.44225 38.0 38.0 38.0 38.0 38.0 10-14 37.3341 38.0 38.0 38.0 38.0 38.0 15-19 37.328250000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.29885 38.0 38.0 38.0 37.6 38.0 25-29 37.27325 38.0 38.0 38.0 37.8 38.0 30-34 37.253150000000005 38.0 38.0 38.0 37.2 38.0 35-39 36.9011 38.0 38.0 38.0 36.2 38.0 40-44 37.18965 38.0 38.0 38.0 37.2 38.0 45-49 37.22260000000001 38.0 38.0 38.0 37.8 38.0 50-54 37.171 38.0 38.0 38.0 37.4 38.0 55-59 37.07585 38.0 38.0 38.0 37.0 38.0 60-64 37.1362 38.0 38.0 38.0 37.0 38.0 65-69 37.13865 38.0 38.0 38.0 37.0 38.0 70-74 36.74755 38.0 38.0 38.0 36.6 38.0 75-79 35.82765 38.0 38.0 38.0 34.8 38.0 80-84 36.4072 38.0 38.0 38.0 35.0 38.0 85-89 36.9347 38.0 38.0 38.0 36.6 38.0 90-94 36.911249999999995 38.0 38.0 38.0 36.2 38.0 95-99 36.80105 38.0 38.0 38.0 35.8 38.0 100-104 36.58635 38.0 38.0 38.0 35.4 38.0 105-109 35.563 38.0 38.0 38.0 33.2 38.0 110-114 34.411950000000004 38.0 38.0 38.0 26.0 38.0 115-119 33.38265 38.0 37.2 38.0 9.4 38.0 120-124 33.77995 38.0 36.4 38.0 19.4 38.0 125-129 33.89370000000001 38.0 35.8 38.0 22.2 38.0 130-134 35.51625 38.0 37.4 38.0 30.8 38.0 135-139 35.56635 38.0 37.2 38.0 32.8 38.0 140-144 35.23525 38.0 36.0 38.0 31.0 38.0 145-149 34.348349999999996 38.0 35.6 38.0 27.2 38.0 150-151 30.3395 35.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 8.0 4 2.0 5 2.0 6 2.0 7 1.0 8 0.0 9 0.0 10 2.0 11 1.0 12 2.0 13 1.0 14 4.0 15 4.0 16 2.0 17 6.0 18 1.0 19 4.0 20 6.0 21 6.0 22 7.0 23 15.0 24 6.0 25 5.0 26 11.0 27 32.0 28 37.0 29 66.0 30 74.0 31 52.0 32 71.0 33 106.0 34 118.0 35 217.0 36 426.0 37 2698.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.875 19.525000000000002 13.55 26.05 2 29.25 23.474999999999998 30.099999999999998 17.175 3 20.06504878658994 26.670002501876404 32.524393294971226 20.740555416562422 4 23.54265699274456 35.5266449837378 22.066549912434326 18.864148111083313 5 25.137568784392194 36.16808404202101 22.686343171585793 16.008004002001 6 19.725 38.074999999999996 23.200000000000003 19.0 7 19.6 20.9 40.1 19.400000000000002 8 22.400000000000002 24.05 28.225 25.324999999999996 9 21.425 25.224999999999998 29.25 24.099999999999998 10-14 23.827382738273826 28.67286728672867 26.4026402640264 21.097109710971097 15-19 22.856142807140355 28.32641632081604 28.111405570278514 20.706035301765088 20-24 23.22696809042713 28.27848354506352 27.158147444233272 21.336400920276084 25-29 23.06615330766538 27.83639181959098 27.896394819740987 21.20106005300265 30-34 22.68680604181254 27.968390517155147 28.02840852255677 21.31639491847554 35-39 22.845561004904415 27.860074066659994 27.93013712341107 21.364227805024523 40-44 23.758066936815247 27.465105808194508 28.105458001901045 20.6713692530892 45-49 23.78094523630908 27.41685421355339 27.80195048762191 21.00025006251563 50-54 23.311655827913956 27.03351675837919 28.704352176088044 20.95047523761881 55-59 23.579715943188635 27.630526105221044 28.280656131226245 20.509101820364073 60-64 23.22 27.615000000000002 28.68 20.485 65-69 23.96 27.13 28.389999999999997 20.52 70-74 23.462897526501767 27.80413932357395 28.12720848056537 20.60575466935891 75-79 23.568327475708085 27.548066983667564 28.63345048583833 20.250155054786024 80-84 22.637695805962608 27.852450732693278 28.797372410308235 20.712481051035876 85-89 24.477447744774476 27.11271127112711 28.202820282028203 20.207020702070206 90-94 23.535 27.61 27.950000000000003 20.905 95-99 23.62 27.944999999999997 28.249999999999996 20.185 100-104 24.712356178089045 27.503751875937972 27.453726863431715 20.33016508254127 105-109 24.26534918429314 27.72888683032268 27.842107971797642 20.163656013586536 110-114 24.33538919608677 28.13164610803913 27.70097830710336 19.831986388770737 115-119 24.95204691182112 27.878555378966407 27.47848961473119 19.690908094481287 120-124 24.37840145128588 28.027958595667485 27.55308931810906 20.040550634937574 125-129 25.281457820600096 27.51217468712363 27.632612452217625 19.57375504005865 130-134 24.95240004008418 27.673113538430705 27.688145104719915 19.68634131676521 135-139 26.02 27.445000000000004 27.605 18.93 140-144 25.845000000000002 27.76 27.145000000000003 19.25 145-149 26.195 27.975 26.97 18.86 150-151 27.12692645031951 28.229545169778227 27.089337175792505 17.554191204109763 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 2.0 26 5.0 27 7.0 28 10.0 29 16.5 30 21.0 31 23.0 32 23.5 33 31.0 34 47.5 35 69.5 36 95.5 37 111.5 38 131.0 39 152.0 40 177.0 41 217.5 42 256.0 43 260.5 44 260.0 45 280.5 46 276.0 47 256.0 48 243.5 49 208.5 50 170.0 51 147.0 52 119.5 53 101.0 54 80.5 55 55.0 56 36.0 57 29.5 58 25.0 59 14.0 60 8.5 61 7.0 62 5.5 63 5.0 64 4.0 65 2.5 66 2.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.075 4 0.075 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.005 20-24 0.03 25-29 0.005 30-34 0.03 35-39 0.09 40-44 0.055 45-49 0.025 50-54 0.05 55-59 0.02 60-64 0.0 65-69 0.0 70-74 0.95 75-79 3.26 80-84 1.05 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.05 105-109 2.8449999999999998 110-114 5.96 115-119 8.765 120-124 6.29 125-129 4.515000000000001 130-134 0.21 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.275 0.0 0.0 0.0 0.0 96-97 1.65 0.0 0.0 0.0 0.0 98-99 2.0 0.0 0.0 0.0 0.0 100-101 2.375 0.0 0.0 0.0 0.0 102-103 2.7249999999999996 0.0 0.0 0.0 0.0 104-105 3.1624999999999996 0.0 0.0 0.0 0.0 106-107 3.5375 0.0 0.0 0.0 0.0 108-109 3.8 0.0 0.0 0.0 0.0 110-111 4.1 0.0 0.0 0.0 0.0 112-113 4.4125 0.0 0.0 0.0 0.0 114-115 4.8375 0.0 0.0 0.0 0.0 116-117 5.35 0.0 0.0 0.0 0.0 118-119 5.9875 0.0 0.0 0.0 0.0 120-121 6.525 0.0 0.0 0.0 0.0 122-123 6.9625 0.0 0.0 0.0 0.0 124-125 7.5125 0.0 0.0 0.0 0.0 126-127 8.175 0.0 0.0 0.0 0.0 128-129 8.9125 0.0 0.0 0.0 0.0 130-131 9.6125 0.0 0.0 0.0 0.0 132-133 10.2875 0.0 0.0 0.0 0.0 134-135 11.0 0.0 0.0 0.0 0.0 136-137 11.6875 0.0 0.0 0.0 0.0 138-139 12.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670071 spots for SRR7169763.sra Written 670071 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra Read 670055 spots for SRR7169763.sra Written 670055 spots for SRR7169763.sra SRR ids: ['SRR7169763.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_14f90vr1 SRR7169763.sra spots: 13401116 blocks: [[1, 670055], [670056, 1340110], [1340111, 2010165], [2010166, 2680220], [2680221, 3350275], [3350276, 4020330], [4020331, 4690385], [4690386, 5360440], [5360441, 6030495], [6030496, 6700550], [6700551, 7370605], [7370606, 8040660], [8040661, 8710715], [8710716, 9380770], [9380771, 10050825], [10050826, 10720880], [10720881, 11390935], [11390936, 12060990], [12060991, 12731045], [12731046, 13401116]] SRR7169763 file size 4519498 SRR7169763 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169763 SRR7169763_1.fastq SRR7169763_2.fastq Input file: SRR7169763_1.fastq Paired file: SRR7169763_2.fastq trimmed: SRR7169763-trimmed-pair1.fastq, SRR7169763-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:29:29 2025 >> started Tue Feb 11 13:29:44 2025 >> done (14.663s) 13401116 read pairs processed; of these: 12264 ( 0.09%) short read pairs filtered out after trimming by size control 13526 ( 0.10%) empty read pairs filtered out after trimming by size control 13375326 (99.81%) read pairs available; of these: 6240779 (46.66%) trimmed read pairs available after processing 7134547 (53.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 3 0.00% 21 3 0.00% 22 3 0.00% 23 4 0.00% 24 3 0.00% 25 3 0.00% 26 4 0.00% 27 1 0.00% 28 2 0.00% 29 12 0.00% 30 8 0.00% 31 11 0.00% 32 10 0.00% 33 11 0.00% 34 15 0.00% 35 18 0.00% 36 13 0.00% 37 25 0.00% 38 20 0.00% 39 28 0.00% 40 25 0.00% 41 34 0.00% 42 54 0.00% 43 60 0.00% 44 50 0.00% 45 59 0.00% 46 77 0.00% 47 79 0.00% 48 94 0.00% 49 108 0.00% 50 154 0.00% 51 161 0.00% 52 172 0.00% 53 174 0.00% 54 205 0.00% 55 227 0.00% 56 234 0.00% 57 289 0.00% 58 362 0.00% 59 392 0.00% 60 478 0.00% 61 573 0.00% 62 640 0.00% 63 720 0.01% 64 805 0.01% 65 821 0.01% 66 938 0.01% 67 1043 0.01% 68 1221 0.01% 69 1342 0.01% 70 1620 0.01% 71 1878 0.01% 72 2154 0.02% 73 2483 0.02% 74 2787 0.02% 75 3134 0.02% 76 3449 0.03% 77 3895 0.03% 78 4032 0.03% 79 4538 0.03% 80 4990 0.04% 81 5659 0.04% 82 6491 0.05% 83 7261 0.05% 84 8569 0.06% 85 9601 0.07% 86 10018 0.07% 87 10701 0.08% 88 11392 0.09% 89 12272 0.09% 90 13095 0.10% 91 14222 0.11% 92 15293 0.11% 93 16661 0.12% 94 17793 0.13% 95 19061 0.14% 96 19959 0.15% 97 20742 0.16% 98 21239 0.16% 99 22163 0.17% 100 23585 0.18% 101 24120 0.18% 102 25790 0.19% 103 27563 0.21% 104 28970 0.22% 105 30941 0.23% 106 31629 0.24% 107 32102 0.24% 108 32640 0.24% 109 33352 0.25% 110 34164 0.26% 111 35414 0.26% 112 36869 0.28% 113 38591 0.29% 114 40313 0.30% 115 41341 0.31% 116 42538 0.32% 117 42987 0.32% 118 43866 0.33% 119 43871 0.33% 120 44559 0.33% 121 45541 0.34% 122 47037 0.35% 123 48055 0.36% 124 50463 0.38% 125 51918 0.39% 126 53909 0.40% 127 54688 0.41% 128 55123 0.41% 129 55373 0.41% 130 56250 0.42% 131 56654 0.42% 132 57874 0.43% 133 59361 0.44% 134 60419 0.45% 135 62636 0.47% 136 64801 0.48% 137 66364 0.50% 138 68934 0.52% 139 69934 0.52% 140 73148 0.55% 141 76407 0.57% 142 80367 0.60% 143 85725 0.64% 144 95375 0.71% 145 110633 0.83% 146 124083 0.93% 147 159159 1.19% 148 224808 1.68% 149 420331 3.14% 150 2661255 19.90% 151 7134547 53.34% 13375326 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=39 prefix-density=0.18 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=309.14 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=17.1 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=6.57 fanout-score-rank=21 prefix-density=0.27 prefix-fanout=4.5 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=38 fanout-score=58.97 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=13.4 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCG SRR7169763 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:30:26 Started mapping on | Feb 11 13:30:26 Finished on | Feb 11 13:31:43 Mapping speed, Million of reads per hour | 625.34 Number of input reads | 13375326 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 12805699 Uniquely mapped reads % | 95.74% Average mapped length | 289.34 Number of splices: Total | 11380921 Number of splices: Annotated (sjdb) | 11192865 Number of splices: GT/AG | 11216769 Number of splices: GC/AG | 129294 Number of splices: AT/AC | 9556 Number of splices: Non-canonical | 25302 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 233436 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 39169 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 346867 346867 346867 N_multimapping 233436 233436 233436 N_noFeature 359014 12617117 464313 N_ambiguous 130638 829 46747 UnstrandedReadsAssigned:12316047 PositiveStrandReadsAssigned:187753 NegativeStrandReadsAssigned:12294639 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169763 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169763-trimmed-pair1.fastq SRR7169763-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,375,326 reads, 12,247,700 reads pseudoaligned [quant] estimated average fragment length: 210.762 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52401 SRR7169763.ke.tsv 34699 SRR7169763.se.tsv 87100 total ==> SRR7169763.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.24 224 11.0645 Potri.005G024800.1.v4.1 1035 825.238 19 2.05643 Potri.004G059700.1.v4.1 961 751.244 1 0.118894 Potri.007G009000.2.v4.1 1416 1206.24 0 0 Potri.003G141000.2.v4.1 2943 2733.24 290.157 9.4819 Potri.016G087400.1.v4.1 270 96.0182 964.956 897.623 Potri.015G069301.1.v4.1 564 357.217 0 0 Potri.010G195200.1.v4.1 1773 1563.24 13 0.742776 Potri.012G127500.1.v4.1 977 767.238 2966 345.287 ==> SRR7169763.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1071 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 190 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169763 completed mapping pipeline successfully