Starting /dee2/code/volunteer_pipeline.sh SRR7169764 current disk space = 3050123841536 free memory = 1027355956 SRR7169764 SRAfilesize 4d78b5c9ceeef3eac35da934d295b1a5 SRR7169764.sra SRR7169764.sra file validated SRR7169764 is paired end SRR7169764 is conventional basespace SRR7169764 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169764_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.5225 18.0 18.0 30.0 18.0 32.0 2 29.8525 31.0 29.0 33.0 27.0 33.0 3 31.5805 33.0 31.0 33.0 29.0 33.0 4 32.52575 33.0 33.0 33.0 32.0 34.0 5 32.90175 33.0 33.0 34.0 32.0 34.0 6 36.85225 38.0 37.0 38.0 34.0 38.0 7 37.329 38.0 38.0 38.0 36.0 38.0 8 37.44375 38.0 38.0 38.0 37.0 38.0 9 37.57875 38.0 38.0 38.0 37.0 38.0 10-14 37.588649999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.616249999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.5812 38.0 38.0 38.0 38.0 38.0 25-29 37.59755 38.0 38.0 38.0 38.0 38.0 30-34 37.601800000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.556 38.0 38.0 38.0 38.0 38.0 40-44 37.465900000000005 38.0 38.0 38.0 37.8 38.0 45-49 37.45675 38.0 38.0 38.0 38.0 38.0 50-54 37.35965 38.0 38.0 38.0 37.4 38.0 55-59 37.20865 38.0 38.0 38.0 36.6 38.0 60-64 37.108549999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.238350000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.2327 38.0 38.0 38.0 36.6 38.0 75-79 37.0651 38.0 38.0 38.0 36.2 38.0 80-84 37.05855 38.0 38.0 38.0 36.2 38.0 85-89 37.0152 38.0 38.0 38.0 36.2 38.0 90-94 36.8941 38.0 38.0 38.0 35.8 38.0 95-99 36.96365 38.0 38.0 38.0 36.0 38.0 100-104 36.90585 38.0 38.0 38.0 36.0 38.0 105-109 36.7481 38.0 38.0 38.0 35.0 38.0 110-114 36.639149999999994 38.0 38.0 38.0 34.8 38.0 115-119 36.43265 38.0 38.0 38.0 34.2 38.0 120-124 36.2682 38.0 38.0 38.0 34.0 38.0 125-129 36.26084999999999 38.0 38.0 38.0 34.0 38.0 130-134 36.055600000000005 38.0 37.6 38.0 33.2 38.0 135-139 35.782349999999994 38.0 36.8 38.0 32.4 38.0 140-144 35.521699999999996 38.0 36.0 38.0 31.8 38.0 145-149 35.21535 38.0 36.0 38.0 31.0 38.0 150-151 31.604875 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 3.0 9 0.0 10 1.0 11 0.0 12 1.0 13 2.0 14 0.0 15 1.0 16 1.0 17 0.0 18 4.0 19 12.0 20 2.0 21 2.0 22 2.0 23 5.0 24 3.0 25 1.0 26 7.0 27 6.0 28 23.0 29 20.0 30 36.0 31 27.0 32 48.0 33 88.0 34 122.0 35 202.0 36 572.0 37 2808.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.025 13.575000000000001 9.525 35.875 2 21.80545136284071 15.503875968992247 33.00825206301575 29.68242060515129 3 20.549999999999997 20.150000000000002 26.224999999999998 33.074999999999996 4 22.875 26.700000000000003 22.175 28.249999999999996 5 22.775000000000002 31.15 24.425 21.65 6 19.75 33.35 25.5 21.4 7 15.6 28.375 38.725 17.299999999999997 8 17.575 27.425 30.975 24.025 9 17.599999999999998 24.9 33.1 24.4 10-14 19.830000000000002 30.080000000000002 26.590000000000003 23.5 15-19 20.330000000000002 28.449999999999996 27.655 23.565 20-24 20.02 29.45 27.21 23.32 25-29 20.3 29.48 26.57 23.65 30-34 20.185 28.585 27.355 23.875 35-39 19.975 29.025000000000002 27.165 23.835 40-44 19.98 28.67 27.355 23.995 45-49 20.995 28.4 27.27 23.335 50-54 20.23 28.37 27.11 24.29 55-59 20.225 28.744999999999997 27.08 23.95 60-64 20.03 28.83 27.08 24.060000000000002 65-69 20.255000000000003 28.105000000000004 27.58 24.060000000000002 70-74 20.349999999999998 29.065 26.529999999999998 24.055 75-79 20.7 28.139999999999997 27.525 23.635 80-84 20.825 27.595 27.33 24.25 85-89 20.655 28.275 27.21 23.86 90-94 20.630000000000003 28.144999999999996 27.334999999999997 23.89 95-99 20.485 27.845 27.189999999999998 24.48 100-104 21.295 28.005000000000003 26.784999999999997 23.915 105-109 20.995 28.34 26.955000000000002 23.71 110-114 21.176352905871763 28.093428028408525 26.78303491047314 23.947184155246575 115-119 20.880000000000003 28.185 26.56 24.375 120-124 21.12 27.98 26.68 24.22 125-129 20.775 28.535 26.195 24.495 130-134 21.029999999999998 28.355000000000004 26.11 24.505 135-139 21.145 27.639999999999997 26.57 24.645 140-144 21.435000000000002 27.855 26.115 24.595 145-149 21.255 28.035 26.169999999999998 24.54 150-151 21.725 28.262500000000003 25.2875 24.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.0 23 1.0 24 2.0 25 2.5 26 3.5 27 4.5 28 8.5 29 12.0 30 14.5 31 18.0 32 26.5 33 35.5 34 39.5 35 62.5 36 88.0 37 105.0 38 120.0 39 139.5 40 175.5 41 198.0 42 216.0 43 237.5 44 274.5 45 289.5 46 272.5 47 270.5 48 246.0 49 206.5 50 181.0 51 151.5 52 137.0 53 122.5 54 96.0 55 70.5 56 40.5 57 28.5 58 22.0 59 20.5 60 16.0 61 7.5 62 7.5 63 6.5 64 3.5 65 2.0 66 2.0 67 2.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.03 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34393136512742 98.425 2 0.6056018168054504 1.2 3 0.025233409033560434 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025233409033560434 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 12 0.3 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.8875 0.0 0.0 0.0 0.0 102-103 2.3125 0.0 0.0 0.0 0.0 104-105 2.75 0.0 0.0 0.0 0.0 106-107 3.175 0.0 0.0 0.0 0.0 108-109 3.4625 0.0 0.0 0.0 0.0 110-111 3.8375 0.0 0.0 0.0 0.0 112-113 4.3625 0.0 0.0 0.0 0.0 114-115 4.8 0.0 0.0 0.0 0.0 116-117 5.1 0.0 0.0 0.0 0.0 118-119 5.625 0.0 0.0 0.0 0.0 120-121 6.1375 0.0 0.0 0.0 0.0 122-123 6.6625 0.0 0.0 0.0 0.0 124-125 7.262499999999999 0.0 0.0 0.0 0.0 126-127 7.862500000000001 0.0 0.0 0.0 0.0 128-129 8.45 0.0 0.0 0.0 0.0 130-131 9.1125 0.0 0.0 0.0 0.0 132-133 9.774999999999999 0.0 0.0 0.0 0.0 134-135 10.4375 0.0 0.0 0.0 0.0 136-137 11.337499999999999 0.0 0.0 0.0 0.0 138-139 12.024999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169764 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169764_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99475 34.0 33.0 34.0 32.0 34.0 2 33.09925 34.0 33.0 34.0 33.0 34.0 3 33.1135 34.0 33.0 34.0 33.0 34.0 4 33.08675 34.0 33.0 34.0 33.0 34.0 5 33.0605 34.0 33.0 34.0 33.0 34.0 6 37.24275 38.0 38.0 38.0 38.0 38.0 7 37.24225 38.0 38.0 38.0 37.0 38.0 8 37.20225 38.0 38.0 38.0 37.0 38.0 9 37.23175 38.0 38.0 38.0 37.0 38.0 10-14 37.2294 38.0 38.0 38.0 37.4 38.0 15-19 37.11025 38.0 38.0 38.0 37.0 38.0 20-24 37.16825 38.0 38.0 38.0 37.0 38.0 25-29 37.1017 38.0 38.0 38.0 37.0 38.0 30-34 37.03565 38.0 38.0 38.0 36.8 38.0 35-39 37.070299999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.149 38.0 38.0 38.0 37.0 38.0 45-49 37.0668 38.0 38.0 38.0 37.0 38.0 50-54 36.97315 38.0 38.0 38.0 37.0 38.0 55-59 36.83975 38.0 38.0 38.0 36.2 38.0 60-64 36.69865 38.0 38.0 38.0 35.8 38.0 65-69 36.809999999999995 38.0 38.0 38.0 36.2 38.0 70-74 36.87795 38.0 38.0 38.0 36.4 38.0 75-79 36.14125 38.0 38.0 38.0 34.4 38.0 80-84 36.4755 38.0 38.0 38.0 35.6 38.0 85-89 36.41225 38.0 37.8 38.0 34.6 38.0 90-94 36.45425 38.0 38.0 38.0 35.2 38.0 95-99 36.45465 38.0 38.0 38.0 35.4 38.0 100-104 36.340250000000005 38.0 38.0 38.0 34.8 38.0 105-109 35.15985 38.0 37.2 38.0 28.6 38.0 110-114 34.66795 38.0 37.8 38.0 28.2 38.0 115-119 34.027049999999996 38.0 37.2 38.0 19.8 38.0 120-124 34.14765 38.0 37.0 38.0 23.6 38.0 125-129 34.506150000000005 38.0 36.4 38.0 25.2 38.0 130-134 34.978049999999996 38.0 36.0 38.0 28.2 38.0 135-139 34.6871 38.0 35.8 38.0 26.2 38.0 140-144 34.7462 38.0 36.0 38.0 28.6 38.0 145-149 33.670300000000005 38.0 34.4 38.0 22.4 38.0 150-151 30.693875 35.5 29.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 3.0 5 1.0 6 0.0 7 1.0 8 2.0 9 1.0 10 3.0 11 3.0 12 3.0 13 8.0 14 1.0 15 1.0 16 3.0 17 7.0 18 7.0 19 12.0 20 10.0 21 8.0 22 11.0 23 10.0 24 13.0 25 13.0 26 11.0 27 18.0 28 25.0 29 35.0 30 66.0 31 79.0 32 84.0 33 84.0 34 104.0 35 235.0 36 505.0 37 2617.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.324999999999996 19.400000000000002 14.799999999999999 26.474999999999998 2 25.894420815611706 26.695021265949464 28.77157868401301 18.638979234425822 3 22.62828535669587 28.986232790988737 28.1351689612015 20.250312891113893 4 24.486730095142715 33.32498748122183 23.234852278417627 18.953430145217826 5 25.725725725725724 34.55955955955956 22.7977977977978 16.916916916916914 6 22.05 37.574999999999996 22.7 17.675 7 21.2 22.075 36.675000000000004 20.05 8 23.1 25.025 26.85 25.025 9 22.900000000000002 25.75 28.325 23.025000000000002 10-14 23.830000000000002 28.395 25.835 21.94 15-19 23.949579831932773 28.016206482593038 26.90576230492197 21.12845138055222 20-24 23.68 28.294999999999998 26.490000000000002 21.535 25-29 24.125 27.544999999999998 26.939999999999998 21.39 30-34 23.830000000000002 27.889999999999997 27.084999999999997 21.195 35-39 23.765 27.584999999999997 27.02 21.63 40-44 24.25 27.97 26.82 20.96 45-49 24.059811962392477 27.665533106621325 27.330466093218643 20.944188837767552 50-54 23.35452224836078 28.109514990740276 27.443816006807147 21.092146754091797 55-59 24.608613014555093 27.494623118091333 26.98944630620717 20.907317561146403 60-64 24.167416741674167 27.59275927592759 27.732773277327734 20.507050705070505 65-69 24.104999999999997 27.834999999999997 27.634999999999998 20.424999999999997 70-74 23.76138524672205 27.45971374236813 27.48974076669002 21.289160244219797 75-79 23.83493418712202 27.793871016923312 27.22467855872338 21.146516237231285 80-84 23.735271997994484 27.811481574329406 27.641012785159187 20.812233642516922 85-89 24.12 27.365000000000002 27.815 20.7 90-94 24.012401240124014 27.512751275127513 27.587758775877585 20.887088708870888 95-99 24.759903961584634 27.826130452180877 27.410964385754298 20.003001200480192 100-104 24.173460711248936 27.81973690791777 27.00945330865803 20.99734907217526 105-109 23.74617737003058 27.05402650356779 28.073394495412845 21.126401630988788 110-114 24.847346171911695 27.822138719273525 27.01320390376285 20.317311205051926 115-119 25.106202209005946 27.118734069668648 27.288657604078164 20.48640611724724 120-124 25.124626121635096 27.533189903972293 26.98221126095398 20.35997271343863 125-129 24.647089129314786 27.779495105615666 26.877897990726428 20.695517774343124 130-134 25.90072057646117 27.35188150520416 27.24679743795036 19.500600480384307 135-139 25.465 27.66 26.935 19.939999999999998 140-144 25.82 26.865 27.200000000000003 20.115 145-149 25.88 28.144999999999996 26.935 19.040000000000003 150-151 26.072772898368886 26.76286072772898 27.452948557089087 19.711417816813046 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 1.5 24 1.0 25 2.0 26 2.5 27 2.5 28 3.0 29 3.0 30 6.0 31 9.5 32 13.5 33 18.0 34 30.5 35 46.0 36 56.5 37 70.0 38 102.5 39 136.0 40 176.5 41 218.5 42 260.5 43 288.0 44 279.5 45 286.5 46 286.0 47 280.0 48 266.5 49 229.0 50 204.0 51 172.0 52 131.5 53 107.5 54 78.5 55 56.0 56 41.5 57 28.0 58 22.0 59 17.5 60 16.5 61 10.5 62 5.0 63 6.0 64 6.0 65 4.0 66 2.0 67 2.5 68 2.5 69 2.0 70 2.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.075 3 0.125 4 0.15 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.04 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.105 55-59 0.034999999999999996 60-64 0.01 65-69 0.0 70-74 0.09 75-79 1.6150000000000002 80-84 0.27499999999999997 85-89 0.0 90-94 0.01 95-99 0.04 100-104 0.034999999999999996 105-109 1.9 110-114 4.195 115-119 5.84 120-124 4.715 125-129 2.9499999999999997 130-134 0.08 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47103274559194 98.725 2 0.5037783375314862 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025188916876574305 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 11 0.27499999999999997 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.8999999999999999 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2625000000000002 0.0 0.0 0.0 0.0 98-99 1.45 0.0 0.0 0.0 0.0 100-101 1.7375 0.0 0.0 0.0 0.0 102-103 2.1624999999999996 0.0 0.0 0.0 0.0 104-105 2.5875 0.0 0.0 0.0 0.0 106-107 2.9625000000000004 0.0 0.0 0.0 0.0 108-109 3.2125 0.0 0.0 0.0 0.0 110-111 3.5875 0.0 0.0 0.0 0.0 112-113 4.075 0.0 0.0 0.0 0.0 114-115 4.4875 0.0 0.0 0.0 0.0 116-117 4.737500000000001 0.0 0.0 0.0 0.0 118-119 5.2125 0.0 0.0 0.0 0.0 120-121 5.725 0.0 0.0 0.0 0.0 122-123 6.2375 0.0 0.0 0.0 0.0 124-125 6.762499999999999 0.0 0.0 0.0 0.0 126-127 7.2375 0.0 0.0 0.0 0.0 128-129 7.7375 0.0 0.0 0.0 0.0 130-131 8.3875 0.0 0.0 0.0 0.0 132-133 9.05 0.0 0.0 0.0 0.0 134-135 9.662500000000001 0.0 0.0 0.0 0.0 136-137 10.55 0.0 0.0 0.0 0.0 138-139 11.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACCT 10 0.007057572 143.42499 7 CATTCAC 10 0.007057572 143.42499 9 GACACCA 10 0.007057572 143.42499 7 >>END_MODULE Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504117 spots for SRR7169764.sra Written 504117 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra Read 504116 spots for SRR7169764.sra Written 504116 spots for SRR7169764.sra SRR ids: ['SRR7169764.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pscoxket SRR7169764.sra spots: 10082321 blocks: [[1, 504116], [504117, 1008232], [1008233, 1512348], [1512349, 2016464], [2016465, 2520580], [2520581, 3024696], [3024697, 3528812], [3528813, 4032928], [4032929, 4537044], [4537045, 5041160], [5041161, 5545276], [5545277, 6049392], [6049393, 6553508], [6553509, 7057624], [7057625, 7561740], [7561741, 8065856], [8065857, 8569972], [8569973, 9074088], [9074089, 9578204], [9578205, 10082321]] SRR7169764 file size 3394867 SRR7169764 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169764 SRR7169764_1.fastq SRR7169764_2.fastq Input file: SRR7169764_1.fastq Paired file: SRR7169764_2.fastq trimmed: SRR7169764-trimmed-pair1.fastq, SRR7169764-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:08:01 2025 >> started Tue Feb 11 14:08:12 2025 >> done (11.260s) 10082321 read pairs processed; of these: 19267 ( 0.19%) short read pairs filtered out after trimming by size control 38453 ( 0.38%) empty read pairs filtered out after trimming by size control 10024601 (99.43%) read pairs available; of these: 4712138 (47.01%) trimmed read pairs available after processing 5312463 (52.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 3 0.00% 21 4 0.00% 22 7 0.00% 23 6 0.00% 24 10 0.00% 25 4 0.00% 26 7 0.00% 27 10 0.00% 28 5 0.00% 29 6 0.00% 30 3 0.00% 31 9 0.00% 32 7 0.00% 33 10 0.00% 34 7 0.00% 35 11 0.00% 36 19 0.00% 37 7 0.00% 38 13 0.00% 39 21 0.00% 40 13 0.00% 41 25 0.00% 42 33 0.00% 43 38 0.00% 44 39 0.00% 45 55 0.00% 46 49 0.00% 47 66 0.00% 48 83 0.00% 49 91 0.00% 50 99 0.00% 51 112 0.00% 52 144 0.00% 53 130 0.00% 54 183 0.00% 55 212 0.00% 56 198 0.00% 57 258 0.00% 58 299 0.00% 59 331 0.00% 60 420 0.00% 61 409 0.00% 62 494 0.00% 63 612 0.01% 64 652 0.01% 65 725 0.01% 66 789 0.01% 67 901 0.01% 68 981 0.01% 69 1079 0.01% 70 1306 0.01% 71 1464 0.01% 72 1801 0.02% 73 1979 0.02% 74 2317 0.02% 75 2839 0.03% 76 4507 0.04% 77 4526 0.05% 78 3436 0.03% 79 3610 0.04% 80 3918 0.04% 81 4215 0.04% 82 4925 0.05% 83 5480 0.05% 84 6959 0.07% 85 7748 0.08% 86 8209 0.08% 87 8802 0.09% 88 9410 0.09% 89 9890 0.10% 90 10289 0.10% 91 10738 0.11% 92 11545 0.12% 93 12341 0.12% 94 13089 0.13% 95 14141 0.14% 96 14792 0.15% 97 15436 0.15% 98 15590 0.16% 99 16143 0.16% 100 16918 0.17% 101 17620 0.18% 102 18588 0.19% 103 19522 0.19% 104 20532 0.20% 105 21415 0.21% 106 22095 0.22% 107 22573 0.23% 108 23300 0.23% 109 23827 0.24% 110 24390 0.24% 111 25299 0.25% 112 25744 0.26% 113 27335 0.27% 114 28062 0.28% 115 29146 0.29% 116 29859 0.30% 117 30081 0.30% 118 31076 0.31% 119 31191 0.31% 120 31629 0.32% 121 32563 0.32% 122 33163 0.33% 123 34386 0.34% 124 35272 0.35% 125 36588 0.36% 126 37480 0.37% 127 38996 0.39% 128 39051 0.39% 129 39863 0.40% 130 40574 0.40% 131 40678 0.41% 132 41986 0.42% 133 43016 0.43% 134 44240 0.44% 135 45647 0.46% 136 47008 0.47% 137 48704 0.49% 138 50177 0.50% 139 52154 0.52% 140 53825 0.54% 141 56834 0.57% 142 60558 0.60% 143 64581 0.64% 144 71216 0.71% 145 80444 0.80% 146 93992 0.94% 147 119992 1.20% 148 175199 1.75% 149 377874 3.77% 150 2014739 20.10% 151 5312463 52.99% 10024601 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=38 prefix-density=0.27 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=241.38 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=16.2 sequence=CTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTCTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=44 prefix-density=0.27 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=140.61 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.0 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169764 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:08:55 Started mapping on | Feb 11 14:08:56 Finished on | Feb 11 14:10:14 Mapping speed, Million of reads per hour | 462.67 Number of input reads | 10024601 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 9378272 Uniquely mapped reads % | 93.55% Average mapped length | 289.85 Number of splices: Total | 8340291 Number of splices: Annotated (sjdb) | 8204057 Number of splices: GT/AG | 8220449 Number of splices: GC/AG | 95173 Number of splices: AT/AC | 6947 Number of splices: Non-canonical | 17722 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 174021 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 23225 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.42% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 487420 487420 487420 N_multimapping 174021 174021 174021 N_noFeature 178884 9268880 219175 N_ambiguous 105303 514 35883 UnstrandedReadsAssigned:9094085 PositiveStrandReadsAssigned:108878 NegativeStrandReadsAssigned:9123214 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169764 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169764-trimmed-pair1.fastq SRR7169764-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,024,601 reads, 9,099,027 reads pseudoaligned [quant] estimated average fragment length: 208.436 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR7169764.ke.tsv 34699 SRR7169764.se.tsv 87100 total ==> SRR7169764.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.56 175 10.079 Potri.005G024800.1.v4.1 1035 827.564 20 2.52012 Potri.004G059700.1.v4.1 961 753.573 0 0 Potri.007G009000.2.v4.1 1416 1208.56 0 0 Potri.003G141000.2.v4.1 2943 2735.56 160 6.09911 Potri.016G087400.1.v4.1 270 92.5118 1009.46 1137.85 Potri.015G069301.1.v4.1 564 357.948 0 0 Potri.010G195200.1.v4.1 1773 1565.56 19 1.26554 Potri.012G127500.1.v4.1 977 769.573 3503 474.661 ==> SRR7169764.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 499 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 187 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169764 completed mapping pipeline successfully