Starting /dee2/code/volunteer_pipeline.sh SRR7169765 current disk space = 3050271350784 free memory = 1413085640 SRR7169765 SRAfilesize 66a7947aa2e1f9c0186edc9650ab7f72 SRR7169765.sra SRR7169765.sra file validated SRR7169765 is paired end SRR7169765 is conventional basespace SRR7169765 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169765_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.51075 18.0 18.0 30.0 18.0 33.0 2 29.346 30.0 28.0 33.0 25.0 33.0 3 31.14375 33.0 31.0 33.0 28.0 33.0 4 32.28775 33.0 33.0 33.0 31.0 33.0 5 32.66125 33.0 33.0 34.0 32.0 34.0 6 36.72675 38.0 37.0 38.0 34.0 38.0 7 37.1855 38.0 38.0 38.0 36.0 38.0 8 37.41775 38.0 38.0 38.0 37.0 38.0 9 37.55725 38.0 38.0 38.0 38.0 38.0 10-14 37.59415 38.0 38.0 38.0 38.0 38.0 15-19 37.62755 38.0 38.0 38.0 38.0 38.0 20-24 37.58955 38.0 38.0 38.0 38.0 38.0 25-29 37.626650000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.57985 38.0 38.0 38.0 38.0 38.0 35-39 37.576750000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.578649999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.49805 38.0 38.0 38.0 37.6 38.0 50-54 37.46315 38.0 38.0 38.0 37.2 38.0 55-59 37.414550000000006 38.0 38.0 38.0 37.0 38.0 60-64 36.8391 38.0 37.8 38.0 35.2 38.0 65-69 37.2159 38.0 38.0 38.0 36.6 38.0 70-74 37.32045 38.0 38.0 38.0 37.0 38.0 75-79 37.213499999999996 38.0 38.0 38.0 36.8 38.0 80-84 37.114700000000006 38.0 38.0 38.0 36.6 38.0 85-89 37.080349999999996 38.0 38.0 38.0 36.6 38.0 90-94 36.87505 38.0 38.0 38.0 35.6 38.0 95-99 36.9671 38.0 38.0 38.0 35.8 38.0 100-104 36.99225 38.0 38.0 38.0 36.0 38.0 105-109 36.67895 38.0 38.0 38.0 35.2 38.0 110-114 36.58935 38.0 38.0 38.0 35.0 38.0 115-119 36.7609 38.0 38.0 38.0 35.0 38.0 120-124 36.56745000000001 38.0 38.0 38.0 34.4 38.0 125-129 36.46124999999999 38.0 38.0 38.0 34.4 38.0 130-134 36.17615 38.0 37.8 38.0 33.8 38.0 135-139 35.942699999999995 38.0 37.2 38.0 33.2 38.0 140-144 35.7828 38.0 37.0 38.0 32.6 38.0 145-149 35.2625 38.0 36.0 38.0 31.0 38.0 150-151 31.74825 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 3.0 19 7.0 20 4.0 21 2.0 22 2.0 23 2.0 24 5.0 25 7.0 26 9.0 27 6.0 28 8.0 29 15.0 30 28.0 31 48.0 32 63.0 33 67.0 34 116.0 35 226.0 36 546.0 37 2830.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.79277471149022 14.776718514801807 10.336176618163574 34.094330155544405 2 21.099999999999998 15.299999999999999 34.425 29.175 3 20.325 19.75 26.200000000000003 33.725 4 22.35 26.75 22.225 28.675 5 22.400000000000002 34.025 23.275000000000002 20.3 6 21.85 33.050000000000004 24.25 20.849999999999998 7 14.95 27.575 39.550000000000004 17.925 8 18.5 27.150000000000002 30.075000000000003 24.275 9 16.55 25.35 34.125 23.974999999999998 10-14 20.28 29.525000000000002 27.255000000000003 22.939999999999998 15-19 20.16 28.845 27.04 23.955000000000002 20-24 20.244999999999997 28.660000000000004 27.584999999999997 23.51 25-29 19.66 29.794999999999998 26.884999999999998 23.66 30-34 20.07600380019001 29.081454072703632 27.406370318515926 23.43617180859043 35-39 20.201010050502525 28.7714385719286 27.001350067503378 24.026201310065503 40-44 19.965 28.82 27.255000000000003 23.96 45-49 20.255000000000003 28.1 27.389999999999997 24.255 50-54 20.349999999999998 28.93 27.034999999999997 23.685000000000002 55-59 20.395 28.42 27.250000000000004 23.935000000000002 60-64 20.200000000000003 28.749999999999996 26.575 24.474999999999998 65-69 20.565 28.67 26.96 23.805 70-74 20.125 28.685 26.995 24.195 75-79 20.49 28.050000000000004 27.250000000000004 24.21 80-84 20.11 28.439999999999998 27.02 24.43 85-89 20.705000000000002 28.73 26.68 23.885 90-94 20.695 27.900000000000002 27.0 24.404999999999998 95-99 20.9 28.255000000000003 26.790000000000003 24.055 100-104 21.251375412623787 28.43853155946784 26.698009402820844 23.612083625087525 105-109 21.102251642344918 28.313524898450424 26.44300687026729 24.141216588937365 110-114 21.409200482121335 28.329650462032944 26.290678987545196 23.97047006830052 115-119 21.584999999999997 28.215 25.89 24.310000000000002 120-124 21.005 28.384999999999998 26.284999999999997 24.325 125-129 21.305 28.134999999999998 26.245 24.315 130-134 21.68 28.52 25.645 24.154999999999998 135-139 21.69 27.944999999999997 26.174999999999997 24.19 140-144 21.85 28.09 25.935000000000002 24.125 145-149 22.055 27.634999999999998 25.435000000000002 24.875 150-151 21.965245655706962 27.803475434429302 25.703212901612705 24.52806600825103 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.5 22 2.0 23 1.5 24 2.5 25 4.5 26 6.5 27 7.0 28 7.0 29 15.0 30 20.0 31 20.5 32 29.0 33 37.0 34 46.0 35 59.0 36 77.0 37 104.5 38 135.5 39 154.0 40 169.5 41 195.0 42 225.0 43 244.5 44 256.0 45 258.5 46 256.0 47 253.0 48 244.5 49 222.0 50 181.5 51 147.5 52 137.0 53 123.5 54 96.0 55 72.5 56 49.0 57 39.0 58 29.5 59 16.5 60 12.0 61 8.0 62 7.0 63 6.0 64 3.5 65 3.0 66 2.5 67 1.5 68 1.5 69 2.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.295 110-114 0.44 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62302085951245 99.1 2 0.3518471977883891 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025131942699170642 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 8 0.2 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.15 0.0 0.0 0.0 0.0 92-93 1.425 0.0 0.0 0.0 0.0 94-95 1.7875 0.0 0.0 0.0 0.0 96-97 2.0 0.0 0.0 0.0 0.0 98-99 2.2875 0.0 0.0 0.0 0.0 100-101 2.5625 0.0 0.0 0.0 0.0 102-103 2.925 0.0 0.0 0.0 0.0 104-105 3.25 0.0 0.0 0.0 0.0 106-107 3.6375 0.0 0.0 0.0 0.0 108-109 3.925 0.0 0.0 0.0 0.0 110-111 4.3875 0.0 0.0 0.0 0.0 112-113 4.875 0.0 0.0 0.0 0.0 114-115 5.175 0.0 0.0 0.0 0.0 116-117 5.7375 0.0 0.0 0.0 0.0 118-119 6.4625 0.0 0.0 0.0 0.0 120-121 7.1375 0.0 0.0 0.0 0.0 122-123 7.8 0.0 0.0 0.0 0.0 124-125 8.575 0.0 0.0 0.0 0.0 126-127 9.475 0.0 0.0 0.0 0.0 128-129 10.3125 0.0 0.0 0.0 0.0 130-131 10.9625 0.0 0.0 0.0 0.0 132-133 11.600000000000001 0.0 0.0 0.0 0.0 134-135 12.4125 0.0 0.0 0.0 0.0 136-137 13.337499999999999 0.0 0.0 0.0 0.0 138-139 14.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169765 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169765_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02 33.0 33.0 34.0 32.0 34.0 2 33.096 34.0 33.0 34.0 33.0 34.0 3 33.0995 34.0 33.0 34.0 33.0 34.0 4 33.07025 34.0 33.0 34.0 33.0 34.0 5 33.0805 34.0 33.0 34.0 33.0 34.0 6 37.16175 38.0 38.0 38.0 37.0 38.0 7 37.28125 38.0 38.0 38.0 38.0 38.0 8 37.263 38.0 38.0 38.0 38.0 38.0 9 37.24625 38.0 38.0 38.0 38.0 38.0 10-14 37.1615 38.0 38.0 38.0 37.2 38.0 15-19 37.171749999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.13915 38.0 38.0 38.0 37.4 38.0 25-29 37.05185 38.0 38.0 38.0 37.0 38.0 30-34 36.9634 38.0 38.0 38.0 37.0 38.0 35-39 36.62835 38.0 38.0 38.0 35.2 38.0 40-44 37.001599999999996 38.0 38.0 38.0 36.8 38.0 45-49 36.975849999999994 38.0 38.0 38.0 37.0 38.0 50-54 36.87515 38.0 38.0 38.0 36.8 38.0 55-59 36.8442 38.0 38.0 38.0 36.6 38.0 60-64 36.868649999999995 38.0 38.0 38.0 36.8 38.0 65-69 36.76649999999999 38.0 38.0 38.0 36.4 38.0 70-74 36.4254 38.0 38.0 38.0 36.0 38.0 75-79 35.667699999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.06655 38.0 38.0 38.0 34.0 38.0 85-89 36.54755 38.0 38.0 38.0 35.8 38.0 90-94 36.483999999999995 38.0 38.0 38.0 35.6 38.0 95-99 36.34935 38.0 38.0 38.0 34.8 38.0 100-104 36.1979 38.0 38.0 38.0 34.4 38.0 105-109 35.25475 38.0 38.0 38.0 31.4 38.0 110-114 34.245000000000005 38.0 37.2 38.0 23.4 38.0 115-119 33.58055 38.0 36.6 38.0 14.8 38.0 120-124 33.7467 38.0 36.0 38.0 19.0 38.0 125-129 33.64595 38.0 35.4 38.0 20.8 38.0 130-134 35.07035 38.0 36.0 38.0 28.8 38.0 135-139 34.9822 38.0 36.0 38.0 30.2 38.0 140-144 34.59955 38.0 36.0 38.0 28.2 38.0 145-149 33.5438 38.0 33.6 38.0 21.8 38.0 150-151 29.920875000000002 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 5.0 5 2.0 6 4.0 7 2.0 8 4.0 9 6.0 10 3.0 11 5.0 12 3.0 13 2.0 14 4.0 15 7.0 16 2.0 17 7.0 18 6.0 19 10.0 20 11.0 21 4.0 22 6.0 23 8.0 24 11.0 25 7.0 26 12.0 27 27.0 28 38.0 29 74.0 30 48.0 31 60.0 32 71.0 33 96.0 34 130.0 35 228.0 36 473.0 37 2607.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.35 19.75 16.675 27.224999999999998 2 27.0 25.85 28.525 18.625 3 21.6 29.4 29.95 19.05 4 23.375 33.050000000000004 22.225 21.349999999999998 5 24.975 35.25 22.975 16.8 6 20.474999999999998 36.95 23.1 19.475 7 20.875 22.25 36.525 20.349999999999998 8 22.525000000000002 25.324999999999996 27.1 25.05 9 22.2 24.175 30.275000000000002 23.35 10-14 24.275 28.01 25.405 22.31 15-19 23.78 27.295 27.865000000000002 21.060000000000002 20-24 23.53617680884044 27.336366818340917 27.861393069653484 21.266063303165158 25-29 24.165 27.815 26.685 21.335 30-34 23.48 27.794999999999998 27.474999999999998 21.25 35-39 24.2248449689938 26.760352070414083 27.715543108621727 21.299259851970394 40-44 24.036201810090503 27.411370568528426 27.256362818140907 21.29606480324016 45-49 24.115000000000002 28.000000000000004 27.435 20.45 50-54 23.791189559477974 27.501375068753436 27.716385819290963 20.991049552477623 55-59 24.529999999999998 26.840000000000003 26.955000000000002 21.675 60-64 23.98 27.255000000000003 27.505000000000003 21.26 65-69 24.16 27.455000000000002 27.334999999999997 21.05 70-74 24.451173353520062 27.534695937421144 27.706283118849356 20.307847590209438 75-79 24.14680599166109 27.47207494723838 27.894167910639833 20.4869511504607 80-84 23.756432246998287 27.343355867218243 28.06982141055393 20.830390475229542 85-89 24.755 27.265 27.450000000000003 20.53 90-94 24.215 27.91 27.200000000000003 20.674999999999997 95-99 24.385 27.91 27.400000000000002 20.305 100-104 25.41016406562625 27.270908363345335 27.200880352140857 20.118047218887554 105-109 24.64629895427517 26.99405372155013 27.67069920032807 20.688948123846625 110-114 25.22475159034751 26.702066137427057 27.34871983597077 20.724462436254665 115-119 24.958366908407196 27.300564061240934 27.14477571850658 20.596293311845287 120-124 25.067257477448962 27.762831671678008 27.029593290077543 20.140317560795484 125-129 25.062396006655575 27.272254575707155 26.9134775374376 20.75187188019967 130-134 25.7549201261956 27.748009414592616 26.54614652711703 19.950923932094746 135-139 25.974999999999998 26.884999999999998 27.05 20.09 140-144 26.400000000000002 27.6 26.3 19.7 145-149 27.21 27.295 26.39 19.105 150-151 26.489734601902853 27.503755633450176 26.61492238357536 19.391587381071606 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.0 14 1.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.0 24 0.5 25 2.0 26 2.5 27 2.5 28 5.0 29 6.5 30 5.0 31 6.5 32 11.0 33 20.5 34 31.5 35 45.0 36 60.5 37 82.0 38 103.5 39 129.5 40 167.0 41 216.0 42 255.5 43 284.5 44 302.5 45 289.0 46 299.0 47 290.0 48 247.5 49 217.0 50 174.0 51 147.5 52 131.5 53 106.5 54 80.5 55 58.5 56 50.5 57 43.5 58 34.0 59 24.0 60 15.0 61 12.0 62 9.5 63 5.0 64 3.5 65 3.5 66 3.5 67 2.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.005 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.9249999999999999 75-79 2.8649999999999998 80-84 0.89 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 2.46 110-114 4.8950000000000005 115-119 6.925000000000001 120-124 5.215 125-129 3.84 130-134 0.155 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.5033979360684621 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025169896803423106 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.38749999999999996 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.15 0.0 0.0 0.0 0.0 92-93 1.425 0.0 0.0 0.0 0.0 94-95 1.8125 0.0 0.0 0.0 0.0 96-97 2.025 0.0 0.0 0.0 0.0 98-99 2.2625 0.0 0.0 0.0 0.0 100-101 2.5374999999999996 0.0 0.0 0.0 0.0 102-103 2.9000000000000004 0.0 0.0 0.0 0.0 104-105 3.1625 0.0 0.0 0.0 0.0 106-107 3.5625 0.0 0.0 0.0 0.0 108-109 3.8499999999999996 0.0 0.0 0.0 0.0 110-111 4.262499999999999 0.0 0.0 0.0 0.0 112-113 4.737500000000001 0.0 0.0 0.0 0.0 114-115 5.0375 0.0 0.0 0.0 0.0 116-117 5.6 0.0 0.0 0.0 0.0 118-119 6.25 0.0 0.0 0.0 0.0 120-121 6.9 0.0 0.0 0.0 0.0 122-123 7.5 0.0 0.0 0.0 0.0 124-125 8.2 0.0 0.0 0.0 0.0 126-127 9.0875 0.0 0.0 0.0 0.0 128-129 9.9125 0.0 0.0 0.0 0.0 130-131 10.575 0.0 0.0 0.0 0.0 132-133 11.2375 0.0 0.0 0.0 0.0 134-135 12.0625 0.0 0.0 0.0 0.0 136-137 13.0125 0.0 0.0 0.0 0.0 138-139 14.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGAGAG 10 0.0070686177 143.35 7 >>END_MODULE Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605632 spots for SRR7169765.sra Written 605632 spots for SRR7169765.sra Read 605640 spots for SRR7169765.sra Written 605640 spots for SRR7169765.sra SRR ids: ['SRR7169765.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_355qmt36 SRR7169765.sra spots: 12112648 blocks: [[1, 605632], [605633, 1211264], [1211265, 1816896], [1816897, 2422528], [2422529, 3028160], [3028161, 3633792], [3633793, 4239424], [4239425, 4845056], [4845057, 5450688], [5450689, 6056320], [6056321, 6661952], [6661953, 7267584], [7267585, 7873216], [7873217, 8478848], [8478849, 9084480], [9084481, 9690112], [9690113, 10295744], [10295745, 10901376], [10901377, 11507008], [11507009, 12112648]] SRR7169765 file size 4082878 SRR7169765 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169765 SRR7169765_1.fastq SRR7169765_2.fastq Input file: SRR7169765_1.fastq Paired file: SRR7169765_2.fastq trimmed: SRR7169765-trimmed-pair1.fastq, SRR7169765-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:54:33 2025 >> started Tue Feb 11 13:54:46 2025 >> done (13.803s) 12112648 read pairs processed; of these: 26805 ( 0.22%) short read pairs filtered out after trimming by size control 42018 ( 0.35%) empty read pairs filtered out after trimming by size control 12043825 (99.43%) read pairs available; of these: 5900456 (48.99%) trimmed read pairs available after processing 6143369 (51.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 6 0.00% 22 2 0.00% 23 4 0.00% 24 6 0.00% 25 9 0.00% 26 7 0.00% 27 2 0.00% 28 10 0.00% 29 7 0.00% 30 8 0.00% 31 11 0.00% 32 9 0.00% 33 7 0.00% 34 7 0.00% 35 8 0.00% 36 9 0.00% 37 11 0.00% 38 19 0.00% 39 18 0.00% 40 24 0.00% 41 29 0.00% 42 32 0.00% 43 31 0.00% 44 38 0.00% 45 59 0.00% 46 53 0.00% 47 70 0.00% 48 62 0.00% 49 90 0.00% 50 114 0.00% 51 131 0.00% 52 123 0.00% 53 161 0.00% 54 152 0.00% 55 214 0.00% 56 237 0.00% 57 234 0.00% 58 293 0.00% 59 340 0.00% 60 413 0.00% 61 453 0.00% 62 560 0.00% 63 633 0.01% 64 682 0.01% 65 797 0.01% 66 908 0.01% 67 1016 0.01% 68 1080 0.01% 69 1318 0.01% 70 1461 0.01% 71 1780 0.01% 72 2004 0.02% 73 2361 0.02% 74 2657 0.02% 75 3195 0.03% 76 5236 0.04% 77 5111 0.04% 78 4001 0.03% 79 4493 0.04% 80 4789 0.04% 81 5429 0.05% 82 6089 0.05% 83 6832 0.06% 84 8712 0.07% 85 9946 0.08% 86 10555 0.09% 87 11269 0.09% 88 12091 0.10% 89 12668 0.11% 90 13275 0.11% 91 14199 0.12% 92 15374 0.13% 93 16359 0.14% 94 17968 0.15% 95 19017 0.16% 96 19919 0.17% 97 21000 0.17% 98 21500 0.18% 99 21885 0.18% 100 23232 0.19% 101 24319 0.20% 102 25762 0.21% 103 27196 0.23% 104 28479 0.24% 105 30645 0.25% 106 31495 0.26% 107 32373 0.27% 108 32975 0.27% 109 33856 0.28% 110 34473 0.29% 111 35775 0.30% 112 36475 0.30% 113 39088 0.32% 114 39883 0.33% 115 41790 0.35% 116 42744 0.35% 117 43498 0.36% 118 44172 0.37% 119 44231 0.37% 120 44461 0.37% 121 46198 0.38% 122 46910 0.39% 123 48657 0.40% 124 50424 0.42% 125 51871 0.43% 126 54011 0.45% 127 55166 0.46% 128 55813 0.46% 129 55571 0.46% 130 57349 0.48% 131 57839 0.48% 132 58849 0.49% 133 60283 0.50% 134 61361 0.51% 135 64083 0.53% 136 65571 0.54% 137 67871 0.56% 138 70096 0.58% 139 71189 0.59% 140 73895 0.61% 141 77376 0.64% 142 80638 0.67% 143 85508 0.71% 144 94241 0.78% 145 107658 0.89% 146 120108 1.00% 147 151446 1.26% 148 211504 1.76% 149 389413 3.23% 150 2360947 19.60% 151 6143369 51.01% 12043825 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=42 prefix-density=0.27 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=120.40 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.7 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=18.51 fanout-score-rank=5 prefix-density=0.48 prefix-fanout=7.8 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=45 fanout-score=30.58 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=2.8 sequence=AGCCATCATTTAAAGAAAGCGTAATAGCTCACTGGTCGAGTCGGCCTGCGCGGAAGATGTAACGGGGCTAAACCATGCACCGAAGCTGCGGCAGCGACGCTTATGCGTTGTTGGGTAGGGGAGCGTTCTGTAAGCCTGCGAAGGTGTGCTGTGAGGCATGCTGGAGGTATCAGAAGTGCGAATGCTGACATAAGTAACGATAAAGCGGGTGAAAAGCCCGCTCGCCGGAAGACCAAGGGTTCCTGTCCAACGTTAATCGGGGCAGGGTGAGTCGACCCCTAAGGCGAGGCCGAAAGGCGTAGTCGATGGGAAACAGGTTAATATTCCTGTACTTGGTGTTACTGCGAAGGGGGGACGGAGAAGGCTATGTTGGCCGGGCGACGGTTGTCCCGGTTTAAGCGTGTAGGCTGGTTTTCCAGGCAAATCCGGAAAATCAAGGCTGAGGCGTGATGACGAGGCACTACGGTGCTGAAGCAACAAATGCCCTGCTTCCAGGAAAAGCCTCTAAGCA SRR7169765 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:56:21 Started mapping on | Feb 11 13:56:22 Finished on | Feb 11 13:57:40 Mapping speed, Million of reads per hour | 555.87 Number of input reads | 12043825 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 11435194 Uniquely mapped reads % | 94.95% Average mapped length | 288.35 Number of splices: Total | 9915948 Number of splices: Annotated (sjdb) | 9742244 Number of splices: GT/AG | 9775445 Number of splices: GC/AG | 109665 Number of splices: AT/AC | 8823 Number of splices: Non-canonical | 22015 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217611 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 16666 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.06% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 410362 410362 410362 N_multimapping 217611 217611 217611 N_noFeature 250695 11293459 301617 N_ambiguous 131404 734 40095 UnstrandedReadsAssigned:11053095 PositiveStrandReadsAssigned:141001 NegativeStrandReadsAssigned:11093482 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7169765 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169765-trimmed-pair1.fastq SRR7169765-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,043,825 reads, 11,044,961 reads pseudoaligned [quant] estimated average fragment length: 200.353 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR7169765.ke.tsv 34699 SRR7169765.se.tsv 87100 total ==> SRR7169765.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1818.65 240 11.4036 Potri.005G024800.1.v4.1 1035 835.647 27 2.79204 Potri.004G059700.1.v4.1 961 761.665 3 0.34036 Potri.007G009000.2.v4.1 1416 1216.65 0 0 Potri.003G141000.2.v4.1 2943 2743.65 180 5.66925 Potri.016G087400.1.v4.1 270 96.7343 1659 1482 Potri.015G069301.1.v4.1 564 365.972 0 0 Potri.010G195200.1.v4.1 1773 1573.65 11 0.604041 Potri.012G127500.1.v4.1 977 777.653 3021 335.696 ==> SRR7169765.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 695 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 301 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169765 completed mapping pipeline successfully