Starting /dee2/code/volunteer_pipeline.sh SRR7169766 current disk space = 3050119380992 free memory = 1463546864 SRR7169766 SRAfilesize 69b57ef55b861b37a930604914a2de0c SRR7169766.sra SRR7169766.sra file validated SRR7169766 is paired end SRR7169766 is conventional basespace SRR7169766 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169766_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.8095 18.0 18.0 18.0 18.0 32.0 2 25.6845 27.0 25.0 27.0 18.0 32.0 3 25.8085 27.0 25.0 29.0 18.0 31.0 4 27.878 29.0 27.0 31.0 15.0 33.0 5 30.24 32.0 30.0 33.0 25.0 33.0 6 35.0035 37.0 34.0 38.0 30.0 38.0 7 36.33125 38.0 36.0 38.0 34.0 38.0 8 36.574 38.0 37.0 38.0 34.0 38.0 9 37.03625 38.0 38.0 38.0 35.0 38.0 10-14 37.322500000000005 38.0 38.0 38.0 36.4 38.0 15-19 37.3793 38.0 38.0 38.0 37.0 38.0 20-24 37.43125 38.0 38.0 38.0 37.0 38.0 25-29 37.482099999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.43055 38.0 38.0 38.0 37.0 38.0 35-39 37.38205000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.2832 38.0 38.0 38.0 37.0 38.0 45-49 37.36835000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.23595 38.0 38.0 38.0 36.8 38.0 55-59 37.0954 38.0 38.0 38.0 36.2 38.0 60-64 37.02120000000001 38.0 38.0 38.0 36.2 38.0 65-69 37.049600000000005 38.0 38.0 38.0 35.8 38.0 70-74 37.1491 38.0 38.0 38.0 36.0 38.0 75-79 36.9856 38.0 38.0 38.0 35.8 38.0 80-84 36.879149999999996 38.0 38.0 38.0 35.6 38.0 85-89 36.759249999999994 38.0 38.0 38.0 35.0 38.0 90-94 36.65645 38.0 38.0 38.0 34.4 38.0 95-99 36.69945 38.0 38.0 38.0 35.0 38.0 100-104 36.62345 38.0 38.0 38.0 34.6 38.0 105-109 36.345150000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.133500000000005 38.0 37.6 38.0 33.6 38.0 115-119 36.032450000000004 38.0 37.2 38.0 32.6 38.0 120-124 36.050650000000005 38.0 37.0 38.0 33.0 38.0 125-129 36.0191 38.0 37.0 38.0 33.0 38.0 130-134 35.752599999999994 38.0 36.4 38.0 31.8 38.0 135-139 35.33875 38.0 35.8 38.0 30.0 38.0 140-144 34.905899999999995 38.0 35.0 38.0 28.0 38.0 145-149 34.66505 38.0 35.0 38.0 28.2 38.0 150-151 30.81175 36.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 0.0 15 1.0 16 2.0 17 0.0 18 1.0 19 1.0 20 5.0 21 3.0 22 6.0 23 7.0 24 5.0 25 9.0 26 11.0 27 13.0 28 20.0 29 25.0 30 45.0 31 54.0 32 80.0 33 136.0 34 166.0 35 362.0 36 887.0 37 2158.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.202804206309466 17.751627441161745 8.312468703054583 38.73309964947421 2 23.0 16.150000000000002 34.1 26.75 3 20.825 21.425 25.8 31.95 4 22.875 29.099999999999998 22.175 25.85 5 22.05 33.2 23.575 21.175 6 18.75 36.375 25.525 19.35 7 14.374999999999998 25.775 40.75 19.1 8 17.75443860965241 26.156539134783696 29.607401850462615 26.481620405101275 9 16.325 25.0 33.425 25.25 10-14 19.495 30.209999999999997 27.22 23.075000000000003 15-19 19.43 28.625 28.09 23.855 20-24 19.38 28.77 27.87 23.98 25-29 20.05 30.044999999999998 26.99 22.915 30-34 20.0 29.065 27.785 23.150000000000002 35-39 20.055 28.46 27.405 24.08 40-44 20.015 29.615000000000002 26.715 23.655 45-49 19.77 28.62 28.044999999999998 23.565 50-54 19.856985698569858 28.947894789478944 27.357735773577357 23.837383738373838 55-59 19.985 28.83 27.334999999999997 23.849999999999998 60-64 19.615 28.625 28.095 23.665 65-69 20.226011300565027 29.091454572728637 27.646382319115958 23.03615180759038 70-74 20.080000000000002 28.705000000000002 27.544999999999998 23.669999999999998 75-79 20.271013550677534 28.72143607180359 27.816390819540977 23.1911595579779 80-84 20.185 29.035 27.205000000000002 23.575 85-89 19.97 29.544999999999998 26.775 23.71 90-94 20.816040802040103 28.751437571878597 27.146357317865892 23.286164308215408 95-99 20.325 29.065 27.295 23.315 100-104 20.46102305115256 28.756437821891094 27.366368318415923 23.416170808540425 105-109 20.814729343300055 28.9570059699995 27.18105653940701 23.047208147293432 110-114 20.833542555862415 28.0893798644238 27.496861662063772 23.580215917650012 115-119 20.606030301515077 28.461423071153558 27.51137556877844 23.42117105855293 120-124 20.815 28.765 26.77 23.65 125-129 20.141007050352517 28.63643182159108 27.556377818890944 23.666183309165458 130-134 20.687068706870686 27.82278227822782 27.527752775277527 23.962396239623963 135-139 21.232123212321234 27.96279627962796 26.932693269326936 23.87238723872387 140-144 20.72207220722072 28.517851785178514 26.5976597659766 24.162416241624165 145-149 21.029999999999998 28.51 26.38 24.08 150-151 20.08007006130364 28.662579757287627 26.886025272113102 24.371324909295634 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 3.5 26 7.0 27 11.5 28 11.0 29 9.5 30 15.5 31 24.5 32 37.5 33 42.5 34 51.0 35 78.5 36 95.0 37 115.5 38 137.5 39 171.0 40 198.0 41 218.5 42 245.0 43 277.0 44 284.5 45 261.0 46 259.5 47 245.5 48 214.5 49 194.0 50 182.0 51 146.0 52 117.0 53 98.5 54 68.0 55 47.5 56 35.5 57 24.5 58 19.5 59 15.0 60 8.5 61 5.0 62 3.5 63 4.0 64 3.0 65 1.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.005 105-109 0.335 110-114 0.42500000000000004 115-119 0.005 120-124 0.0 125-129 0.005 130-134 0.01 135-139 0.01 140-144 0.01 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1681371313335 98.35000000000001 2 0.8318628686664987 1.6500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0125 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.037500000000000006 0.025 0.0 0.0 0.0 76-77 0.0625 0.025 0.0 0.0 0.0 78-79 0.0875 0.025 0.0 0.0 0.0 80-81 0.125 0.025 0.0 0.0 0.0 82-83 0.21250000000000002 0.025 0.0 0.0 0.0 84-85 0.2625 0.025 0.0 0.0 0.0 86-87 0.3125 0.025 0.0 0.0 0.0 88-89 0.425 0.025 0.0 0.0 0.0 90-91 0.4875 0.025 0.0 0.0 0.0 92-93 0.575 0.025 0.0 0.0 0.0 94-95 0.7 0.025 0.0 0.0 0.0 96-97 0.7875 0.025 0.0 0.0 0.0 98-99 0.9625 0.025 0.0 0.0 0.0 100-101 1.0875 0.025 0.0 0.0 0.0 102-103 1.2 0.025 0.0 0.0 0.0 104-105 1.3624999999999998 0.025 0.0 0.0 0.0 106-107 1.7375 0.025 0.0 0.0 0.0 108-109 2.05 0.025 0.0 0.0 0.0 110-111 2.4875 0.025 0.0 0.0 0.0 112-113 2.7875 0.025 0.0 0.0 0.0 114-115 3.175 0.025 0.0 0.0 0.0 116-117 3.4375 0.025 0.0 0.0 0.0 118-119 3.7125000000000004 0.025 0.0 0.0 0.0 120-121 4.1 0.025 0.0 0.0 0.0 122-123 4.5625 0.025 0.0 0.0 0.0 124-125 4.8875 0.025 0.0 0.0 0.0 126-127 5.45 0.025 0.0 0.0 0.0 128-129 5.887499999999999 0.025 0.0 0.0 0.0 130-131 6.45 0.025 0.0 0.0 0.0 132-133 7.025 0.025 0.0 0.0 0.0 134-135 7.675 0.025 0.0 0.0 0.0 136-137 8.3625 0.025 0.0 0.0 0.0 138-139 8.9875 0.037500000000000006 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169766 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169766_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.756 33.0 33.0 34.0 32.0 34.0 2 32.843 33.0 33.0 34.0 32.0 34.0 3 32.93275 34.0 33.0 34.0 32.0 34.0 4 32.921 34.0 33.0 34.0 32.0 34.0 5 32.85075 34.0 33.0 34.0 32.0 34.0 6 37.0265 38.0 38.0 38.0 36.0 38.0 7 37.111 38.0 38.0 38.0 37.0 38.0 8 37.014 38.0 38.0 38.0 36.0 38.0 9 37.11575 38.0 38.0 38.0 36.0 38.0 10-14 36.998900000000006 38.0 38.0 38.0 36.0 38.0 15-19 36.99715 38.0 38.0 38.0 36.0 38.0 20-24 36.995400000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.8823 38.0 38.0 38.0 36.0 38.0 30-34 36.674350000000004 38.0 38.0 38.0 35.4 38.0 35-39 36.5591 38.0 38.0 38.0 34.6 38.0 40-44 36.617200000000004 38.0 38.0 38.0 34.8 38.0 45-49 36.667350000000006 38.0 38.0 38.0 35.2 38.0 50-54 36.17205 38.0 38.0 38.0 32.6 38.0 55-59 35.938250000000004 38.0 37.4 38.0 31.4 38.0 60-64 36.357749999999996 38.0 37.8 38.0 33.4 38.0 65-69 36.71905 38.0 38.0 38.0 35.4 38.0 70-74 36.40045 38.0 38.0 38.0 34.4 38.0 75-79 35.57620000000001 38.0 38.0 38.0 31.8 38.0 80-84 36.13955 38.0 38.0 38.0 33.4 38.0 85-89 36.3425 38.0 38.0 38.0 33.8 38.0 90-94 36.28105 38.0 38.0 38.0 34.0 38.0 95-99 36.1373 38.0 37.8 38.0 33.2 38.0 100-104 35.752 38.0 37.0 38.0 31.4 38.0 105-109 35.002700000000004 38.0 37.0 38.0 28.4 38.0 110-114 33.28385000000001 38.0 35.0 38.0 16.2 38.0 115-119 33.2473 38.0 35.8 38.0 15.0 38.0 120-124 33.3851 38.0 35.0 38.0 18.6 38.0 125-129 33.6905 38.0 35.0 38.0 19.0 38.0 130-134 34.3941 38.0 35.2 38.0 25.0 38.0 135-139 33.9113 38.0 34.4 38.0 22.6 38.0 140-144 33.154399999999995 38.0 33.0 38.0 20.0 38.0 145-149 33.0033 38.0 33.0 38.0 15.4 38.0 150-151 28.4025 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 6.0 4 4.0 5 2.0 6 2.0 7 0.0 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 2.0 14 3.0 15 4.0 16 2.0 17 8.0 18 8.0 19 5.0 20 19.0 21 8.0 22 10.0 23 18.0 24 15.0 25 23.0 26 27.0 27 25.0 28 54.0 29 86.0 30 79.0 31 98.0 32 138.0 33 145.0 34 197.0 35 287.0 36 617.0 37 2102.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.875 19.75 16.025 27.35 2 25.624999999999996 25.374999999999996 32.05 16.950000000000003 3 20.275000000000002 29.875 30.175 19.675 4 24.23105776444111 33.458364591147784 24.23105776444111 18.079519879969993 5 25.46273136568284 34.91745872936468 22.961480740370185 16.65832916458229 6 20.530132533133283 38.30957739434859 23.330832708177045 17.829457364341085 7 20.025000000000002 21.75 38.875 19.35 8 24.20605151287822 25.30632658164541 27.33183295823956 23.15578894723681 9 21.7 25.424999999999997 29.975 22.900000000000002 10-14 23.971198559928 28.15640782039102 26.441322066103307 21.43107155357768 15-19 22.88072018004501 28.16704176044011 27.906976744186046 21.04526131532883 20-24 22.779111644657863 28.836534613845537 27.531012404961984 20.853341336534616 25-29 23.250812703175793 28.06201550387597 27.701925481370342 20.985246311577892 30-34 23.39786882785532 27.570163589974484 28.18049927460103 20.851468307569164 35-39 23.02420968387355 27.67607042817127 28.051220488195277 21.248499399759904 40-44 22.936881064319294 28.038411523457036 28.253476042812842 20.771231369410824 45-49 23.14272850067537 27.440092050627847 28.385612086647654 21.031567362049127 50-54 22.84441775509183 28.309062703297805 28.22899464544863 20.617524896161736 55-59 23.424595825616898 28.595024776014817 28.204614845587866 19.77576455278042 60-64 23.714485794317728 27.606042416966787 28.886554621848738 19.792917166866747 65-69 24.047214164249276 27.59327798339502 28.443533059917975 19.915974792437733 70-74 23.72472079686085 27.452460006036826 28.106449340979978 20.716369856122345 75-79 23.48776358319224 27.70509465907342 28.23867425991483 20.568467497819505 80-84 22.619107511193842 28.24369874729587 28.062584897117272 21.074608844393016 85-89 23.79165415791054 27.519263484439104 28.389872911037727 20.29920944661263 90-94 23.357518138603954 27.650738053540152 28.55641731298474 20.435326494871152 95-99 24.024609843937576 27.63605442176871 28.38635454181673 19.95298119247699 100-104 23.790928206668667 27.901271653149095 28.341844397717033 19.965955742465205 105-109 24.048044978277535 27.16585739841554 27.94275491949911 20.84334270380782 110-114 24.21285797162597 27.86772849533252 27.894098412530983 20.025315120510523 115-119 24.52921553857742 27.951146023888953 27.805875390078555 19.713763047455075 120-124 24.45054945054945 27.852916314454777 27.810650887573964 19.88588334742181 125-129 24.516498983474953 27.644268362612728 28.144711463274774 19.69452119063754 130-134 24.773914790996784 28.08480707395498 27.42162379421222 19.719654340836012 135-139 24.918721552543392 27.544640624218474 27.469614365027763 20.06702345821037 140-144 25.048786589942456 27.570678008506377 27.15536652489367 20.22516887665749 145-149 25.52786950865606 27.769438607024917 27.093965776043234 19.608726108275793 150-151 26.261109024909253 26.761797471523348 27.587933408436598 19.389160095130805 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 1.5 27 2.5 28 4.5 29 7.5 30 11.5 31 15.5 32 22.5 33 35.5 34 48.0 35 60.0 36 86.0 37 114.5 38 153.0 39 183.0 40 210.5 41 240.0 42 262.0 43 281.0 44 288.0 45 295.5 46 271.0 47 246.0 48 233.5 49 202.0 50 170.0 51 137.0 52 112.5 53 92.0 54 68.0 55 46.5 56 26.5 57 17.5 58 13.0 59 8.0 60 6.0 61 5.5 62 4.0 63 3.5 64 2.0 65 0.5 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.05 6 0.025 7 0.0 8 0.025 9 0.0 10-14 0.005 15-19 0.025 20-24 0.04 25-29 0.025 30-34 0.055 35-39 0.04 40-44 0.03 45-49 0.055 50-54 0.08499999999999999 55-59 0.105 60-64 0.04 65-69 0.03 70-74 0.61 75-79 2.545 80-84 0.615 85-89 0.06999999999999999 90-94 0.075 95-99 0.04 100-104 0.13 105-109 2.175 110-114 5.195 115-119 7.07 120-124 5.36 125-129 4.085 130-134 0.48 135-139 0.034999999999999996 140-144 0.075 145-149 0.06999999999999999 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.0750000000000002 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.3125 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.3 0.0 0.0 0.0 0.0 118-119 3.5875000000000004 0.0 0.0 0.0 0.0 120-121 3.9749999999999996 0.0 0.0 0.0 0.0 122-123 4.4125 0.0 0.0 0.0 0.0 124-125 4.7375 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.6875 0.0 0.0 0.0 0.0 130-131 6.2125 0.0 0.0 0.0 0.0 132-133 6.75 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.662500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAATC 10 0.007085229 143.2375 2 GTATTTG 10 0.007085229 143.2375 4 >>END_MODULE Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600273 spots for SRR7169766.sra Written 600273 spots for SRR7169766.sra Read 600288 spots for SRR7169766.sra Written 600288 spots for SRR7169766.sra SRR ids: ['SRR7169766.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ss9e_5_ SRR7169766.sra spots: 12005475 blocks: [[1, 600273], [600274, 1200546], [1200547, 1800819], [1800820, 2401092], [2401093, 3001365], [3001366, 3601638], [3601639, 4201911], [4201912, 4802184], [4802185, 5402457], [5402458, 6002730], [6002731, 6603003], [6603004, 7203276], [7203277, 7803549], [7803550, 8403822], [8403823, 9004095], [9004096, 9604368], [9604369, 10204641], [10204642, 10804914], [10804915, 11405187], [11405188, 12005475]] SRR7169766 file size 4046561 SRR7169766 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169766 SRR7169766_1.fastq SRR7169766_2.fastq Input file: SRR7169766_1.fastq Paired file: SRR7169766_2.fastq trimmed: SRR7169766-trimmed-pair1.fastq, SRR7169766-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:08:55 2025 >> started Tue Feb 11 14:09:10 2025 >> done (15.078s) 12005475 read pairs processed; of these: 12124 ( 0.10%) short read pairs filtered out after trimming by size control 12478 ( 0.10%) empty read pairs filtered out after trimming by size control 11980873 (99.80%) read pairs available; of these: 5638034 (47.06%) trimmed read pairs available after processing 6342839 (52.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 4 0.00% 24 1 0.00% 25 1 0.00% 26 3 0.00% 27 2 0.00% 28 3 0.00% 29 4 0.00% 30 3 0.00% 31 2 0.00% 32 8 0.00% 33 6 0.00% 34 6 0.00% 35 5 0.00% 36 7 0.00% 37 9 0.00% 38 9 0.00% 39 13 0.00% 40 13 0.00% 41 25 0.00% 42 18 0.00% 43 26 0.00% 44 20 0.00% 45 39 0.00% 46 28 0.00% 47 36 0.00% 48 54 0.00% 49 63 0.00% 50 53 0.00% 51 64 0.00% 52 80 0.00% 53 77 0.00% 54 101 0.00% 55 120 0.00% 56 112 0.00% 57 144 0.00% 58 144 0.00% 59 200 0.00% 60 226 0.00% 61 266 0.00% 62 246 0.00% 63 325 0.00% 64 394 0.00% 65 406 0.00% 66 442 0.00% 67 518 0.00% 68 584 0.00% 69 624 0.01% 70 811 0.01% 71 894 0.01% 72 1018 0.01% 73 1288 0.01% 74 1340 0.01% 75 1474 0.01% 76 1801 0.02% 77 1766 0.01% 78 1991 0.02% 79 2124 0.02% 80 2391 0.02% 81 2823 0.02% 82 3201 0.03% 83 3680 0.03% 84 4656 0.04% 85 5176 0.04% 86 5637 0.05% 87 5999 0.05% 88 6422 0.05% 89 6791 0.06% 90 7221 0.06% 91 7688 0.06% 92 8558 0.07% 93 9348 0.08% 94 10128 0.08% 95 11093 0.09% 96 11679 0.10% 97 12233 0.10% 98 12604 0.11% 99 13279 0.11% 100 14040 0.12% 101 14766 0.12% 102 15683 0.13% 103 17100 0.14% 104 17905 0.15% 105 18986 0.16% 106 19869 0.17% 107 20799 0.17% 108 20837 0.17% 109 21883 0.18% 110 22187 0.19% 111 23468 0.20% 112 24214 0.20% 113 25575 0.21% 114 27128 0.23% 115 28379 0.24% 116 29082 0.24% 117 30312 0.25% 118 30218 0.25% 119 31317 0.26% 120 31738 0.26% 121 33095 0.28% 122 33538 0.28% 123 35345 0.30% 124 37005 0.31% 125 38728 0.32% 126 40720 0.34% 127 41243 0.34% 128 42550 0.36% 129 42995 0.36% 130 43840 0.37% 131 44830 0.37% 132 45429 0.38% 133 47910 0.40% 134 49944 0.42% 135 51833 0.43% 136 54601 0.46% 137 57065 0.48% 138 58968 0.49% 139 62151 0.52% 140 66079 0.55% 141 70303 0.59% 142 75713 0.63% 143 83764 0.70% 144 94694 0.79% 145 110684 0.92% 146 133569 1.11% 147 175416 1.46% 148 256758 2.14% 149 490976 4.10% 150 2562149 21.39% 151 6342839 52.94% 11980873 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=106.16 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=16.8 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=35 prefix-density=0.31 prefix-fanout=2.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=264.88 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=28.7 sequence=AAGAAGAAGAAA SRR7169766 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:09:55 Started mapping on | Feb 11 14:09:56 Finished on | Feb 11 14:10:55 Mapping speed, Million of reads per hour | 731.04 Number of input reads | 11980873 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11558038 Uniquely mapped reads % | 96.47% Average mapped length | 291.99 Number of splices: Total | 10710077 Number of splices: Annotated (sjdb) | 10538570 Number of splices: GT/AG | 10554620 Number of splices: GC/AG | 125238 Number of splices: AT/AC | 8590 Number of splices: Non-canonical | 21629 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 197820 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 14788 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.72% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 234917 234917 234917 N_multimapping 197820 197820 197820 N_noFeature 289702 11439716 340255 N_ambiguous 111959 680 43787 UnstrandedReadsAssigned:11156377 PositiveStrandReadsAssigned:117642 NegativeStrandReadsAssigned:11173996 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169766 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169766-trimmed-pair1.fastq SRR7169766-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,980,873 reads, 11,093,617 reads pseudoaligned [quant] estimated average fragment length: 219.376 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR7169766.ke.tsv 34699 SRR7169766.se.tsv 87100 total ==> SRR7169766.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.62 190 10.1748 Potri.005G024800.1.v4.1 1035 816.624 21 2.4783 Potri.004G059700.1.v4.1 961 742.638 0 0 Potri.007G009000.2.v4.1 1416 1197.62 0 0 Potri.003G141000.2.v4.1 2943 2724.62 234 8.27685 Potri.016G087400.1.v4.1 270 88.2222 851.048 929.676 Potri.015G069301.1.v4.1 564 348.238 0 0 Potri.010G195200.1.v4.1 1773 1554.62 54 3.34753 Potri.012G127500.1.v4.1 977 758.631 3548 450.722 ==> SRR7169766.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1502 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169766 completed mapping pipeline successfully