Starting /dee2/code/volunteer_pipeline.sh SRR7169767 current disk space = 3050265231360 free memory = 1512753864 SRR7169767 SRAfilesize df69c22da88fedab52eea56fbc977e11 SRR7169767.sra SRR7169767.sra file validated SRR7169767 is paired end SRR7169767 is conventional basespace SRR7169767 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169767_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.63325 18.0 18.0 18.0 18.0 32.0 2 27.753 27.0 27.0 30.0 25.0 31.0 3 28.91675 29.0 27.0 31.0 25.0 33.0 4 31.46025 33.0 31.0 33.0 29.0 33.0 5 32.14875 33.0 32.0 33.0 31.0 33.0 6 36.328 37.0 36.0 38.0 34.0 38.0 7 37.16775 38.0 38.0 38.0 36.0 38.0 8 37.3225 38.0 38.0 38.0 36.0 38.0 9 37.441 38.0 38.0 38.0 37.0 38.0 10-14 37.603899999999996 38.0 38.0 38.0 37.4 38.0 15-19 37.61395 38.0 38.0 38.0 37.8 38.0 20-24 37.66545 38.0 38.0 38.0 38.0 38.0 25-29 37.6363 38.0 38.0 38.0 38.0 38.0 30-34 37.5886 38.0 38.0 38.0 38.0 38.0 35-39 37.3472 38.0 38.0 38.0 37.0 38.0 40-44 37.0963 38.0 38.0 38.0 36.2 38.0 45-49 37.37435000000001 38.0 38.0 38.0 36.8 38.0 50-54 37.48479999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.43834999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.37155 38.0 38.0 38.0 37.0 38.0 65-69 37.32495 38.0 38.0 38.0 37.0 38.0 70-74 37.25834999999999 38.0 38.0 38.0 36.6 38.0 75-79 37.195949999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.1293 38.0 38.0 38.0 36.0 38.0 85-89 36.96775 38.0 38.0 38.0 35.8 38.0 90-94 36.82955 38.0 38.0 38.0 35.2 38.0 95-99 36.841449999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.78165 38.0 38.0 38.0 34.8 38.0 105-109 36.54515 38.0 37.8 38.0 34.0 38.0 110-114 36.439800000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.257400000000004 38.0 37.2 38.0 33.8 38.0 120-124 36.099 38.0 37.0 38.0 33.0 38.0 125-129 36.003750000000004 38.0 37.0 38.0 33.0 38.0 130-134 35.5092 38.0 36.2 38.0 30.8 38.0 135-139 35.384150000000005 38.0 35.8 38.0 30.4 38.0 140-144 34.91725 38.0 35.0 38.0 28.8 38.0 145-149 34.5556 38.0 35.0 38.0 27.8 38.0 150-151 30.67875 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 1.0 18 1.0 19 2.0 20 1.0 21 3.0 22 4.0 23 4.0 24 2.0 25 8.0 26 7.0 27 13.0 28 15.0 29 24.0 30 31.0 31 47.0 32 70.0 33 97.0 34 159.0 35 280.0 36 884.0 37 2344.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.146341463414636 20.020325203252032 7.7489837398373975 38.084349593495936 2 22.025 15.125 34.300000000000004 28.549999999999997 3 20.8 19.6 25.1 34.5 4 23.225 26.974999999999998 23.175 26.625 5 24.325 31.15 24.025 20.5 6 20.025000000000002 34.275 25.2 20.5 7 14.774999999999999 25.575 40.949999999999996 18.7 8 18.099999999999998 26.075 30.349999999999998 25.474999999999998 9 16.975 25.275 34.599999999999994 23.150000000000002 10-14 20.225 29.7 26.834999999999997 23.24 15-19 20.215 28.38 27.615000000000002 23.79 20-24 20.119999999999997 29.315 27.005000000000003 23.56 25-29 20.195 28.694999999999997 27.42 23.69 30-34 19.915 29.110000000000003 27.6 23.375 35-39 20.275000000000002 28.275 27.235 24.215 40-44 20.1 29.92 26.85 23.13 45-49 20.119999999999997 28.904999999999998 27.584999999999997 23.39 50-54 20.474999999999998 28.975 27.025 23.525 55-59 20.465 29.025000000000002 27.145000000000003 23.365 60-64 20.064999999999998 28.815 26.685 24.435000000000002 65-69 20.19 28.605000000000004 27.279999999999998 23.925 70-74 20.79 28.444999999999997 27.3 23.465 75-79 20.305 28.73 27.22 23.745 80-84 19.96 28.455000000000002 27.279999999999998 24.305 85-89 20.525 28.610000000000003 27.52 23.345 90-94 20.26 27.965 27.705000000000002 24.07 95-99 21.125 28.725 27.205000000000002 22.945 100-104 21.02 28.310000000000002 27.500000000000004 23.169999999999998 105-109 20.555 28.634999999999998 27.11 23.7 110-114 20.580000000000002 28.815 26.545 24.060000000000002 115-119 20.985 29.03 26.605 23.380000000000003 120-124 21.26 28.549999999999997 26.595000000000002 23.595 125-129 21.19 28.76 26.450000000000003 23.599999999999998 130-134 20.849999999999998 28.994999999999997 25.785000000000004 24.37 135-139 21.34 28.27 26.555 23.835 140-144 21.42 28.575 26.029999999999998 23.974999999999998 145-149 21.515 28.144999999999996 26.290000000000003 24.05 150-151 21.2875 28.425 26.174999999999997 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 2.0 23 3.0 24 3.0 25 2.5 26 2.5 27 3.0 28 4.5 29 11.0 30 17.5 31 26.0 32 26.5 33 24.5 34 46.5 35 68.0 36 82.5 37 105.0 38 128.5 39 157.0 40 180.0 41 210.5 42 260.0 43 279.5 44 266.5 45 270.0 46 283.5 47 267.0 48 245.5 49 214.5 50 171.0 51 141.5 52 116.5 53 92.0 54 73.5 55 57.5 56 40.5 57 30.5 58 21.0 59 13.5 60 11.0 61 9.0 62 6.0 63 5.0 64 5.0 65 3.0 66 1.0 67 1.5 68 3.0 69 3.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.1749999999999998 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.7625000000000002 0.0 0.0 0.0 0.0 102-103 1.9375 0.0 0.0 0.0 0.0 104-105 2.1625 0.0 0.0 0.0 0.0 106-107 2.5250000000000004 0.0 0.0 0.0 0.0 108-109 2.8625 0.0 0.0 0.0 0.0 110-111 3.2125 0.0 0.0 0.0 0.0 112-113 3.7 0.0 0.0 0.0 0.0 114-115 4.1875 0.0 0.0 0.0 0.0 116-117 4.699999999999999 0.0 0.0 0.0 0.0 118-119 5.325 0.0 0.0 0.0 0.0 120-121 5.7875 0.0 0.0 0.0 0.0 122-123 6.387499999999999 0.0 0.0 0.0 0.0 124-125 7.0125 0.0 0.0 0.0 0.0 126-127 7.3875 0.0 0.0 0.0 0.0 128-129 8.0125 0.0 0.0 0.0 0.0 130-131 8.7625 0.0 0.0 0.0 0.0 132-133 9.5 0.0 0.0 0.0 0.0 134-135 10.375 0.0 0.0 0.0 0.0 136-137 10.95 0.0 0.0 0.0 0.0 138-139 11.649999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGCAA 10 0.006832588 144.9875 9 CGCATTG 10 0.006832588 144.9875 3 AAAAAAA 30 0.0014445208 24.164585 95-99 >>END_MODULE SRR7169767 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169767_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.829 33.0 33.0 34.0 32.0 34.0 2 31.792 33.0 32.0 34.0 27.0 34.0 3 32.78325 33.0 33.0 34.0 32.0 34.0 4 32.892 33.0 33.0 34.0 32.0 34.0 5 33.12425 34.0 33.0 34.0 33.0 34.0 6 37.304 38.0 38.0 38.0 37.0 38.0 7 37.4285 38.0 38.0 38.0 37.0 38.0 8 37.40325 38.0 38.0 38.0 38.0 38.0 9 37.3955 38.0 38.0 38.0 38.0 38.0 10-14 37.40220000000001 38.0 38.0 38.0 37.8 38.0 15-19 37.3874 38.0 38.0 38.0 38.0 38.0 20-24 37.34715 38.0 38.0 38.0 37.6 38.0 25-29 37.32165 38.0 38.0 38.0 37.4 38.0 30-34 37.31835 38.0 38.0 38.0 37.2 38.0 35-39 36.974399999999996 38.0 38.0 38.0 36.2 38.0 40-44 37.2053 38.0 38.0 38.0 37.0 38.0 45-49 36.84825 38.0 38.0 38.0 35.4 38.0 50-54 37.042649999999995 38.0 38.0 38.0 36.6 38.0 55-59 36.4644 38.0 37.8 38.0 33.8 38.0 60-64 37.00865 38.0 38.0 38.0 36.0 38.0 65-69 37.039950000000005 38.0 38.0 38.0 36.4 38.0 70-74 36.8963 38.0 38.0 38.0 36.0 38.0 75-79 36.8147 38.0 38.0 38.0 35.8 38.0 80-84 36.7881 38.0 38.0 38.0 35.6 38.0 85-89 35.817699999999995 38.0 36.8 38.0 29.6 38.0 90-94 36.65415 38.0 38.0 38.0 35.2 38.0 95-99 36.6386 38.0 38.0 38.0 35.0 38.0 100-104 36.47505 38.0 38.0 38.0 34.4 38.0 105-109 35.7737 38.0 37.2 38.0 31.8 38.0 110-114 34.91205 38.0 37.0 38.0 28.2 38.0 115-119 34.08240000000001 38.0 36.2 38.0 22.6 38.0 120-124 34.5598 38.0 36.0 38.0 26.6 38.0 125-129 34.4697 38.0 35.8 38.0 25.0 38.0 130-134 34.15635 38.0 35.0 38.0 23.0 38.0 135-139 33.97860000000001 38.0 34.4 38.0 23.2 38.0 140-144 32.652950000000004 37.6 31.6 38.0 19.0 38.0 145-149 32.30930000000001 37.8 32.2 38.0 16.6 38.0 150-151 28.782000000000004 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 2.0 9 0.0 10 2.0 11 2.0 12 1.0 13 3.0 14 2.0 15 4.0 16 5.0 17 1.0 18 7.0 19 5.0 20 3.0 21 10.0 22 5.0 23 8.0 24 14.0 25 11.0 26 14.0 27 16.0 28 21.0 29 31.0 30 46.0 31 77.0 32 112.0 33 170.0 34 203.0 35 353.0 36 806.0 37 2056.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.875 22.2 14.774999999999999 26.150000000000002 2 27.150000000000002 26.700000000000003 30.049999999999997 16.1 3 21.125 27.325 30.9 20.65 4 23.5 35.05 23.075000000000003 18.375 5 23.775 34.849999999999994 22.8 18.575 6 20.8 36.1 24.4 18.7 7 19.3 21.925 39.775 19.0 8 22.675 24.474999999999998 26.900000000000002 25.95 9 22.3 24.8 29.9 23.0 10-14 23.27 29.080000000000002 25.91 21.740000000000002 15-19 23.5 27.54 28.02 20.94 20-24 23.455000000000002 28.475 27.02 21.05 25-29 23.64 28.050000000000004 27.915 20.395 30-34 23.380000000000003 28.395 27.560000000000002 20.665 35-39 23.325000000000003 27.860000000000003 27.615000000000002 21.2 40-44 23.015 27.639999999999997 28.189999999999998 21.154999999999998 45-49 23.26 27.650000000000002 28.09 21.0 50-54 23.830000000000002 27.73 27.595 20.845 55-59 23.0 27.935 28.255000000000003 20.810000000000002 60-64 23.494999999999997 27.900000000000002 27.279999999999998 21.325 65-69 23.5 27.860000000000003 28.035 20.605 70-74 23.445 27.339999999999996 28.27 20.945 75-79 23.785 27.49 28.03 20.695 80-84 23.62 27.36 27.79 21.23 85-89 23.345 28.415000000000003 28.025 20.215 90-94 23.21 27.029999999999998 28.794999999999998 20.965 95-99 23.905 27.439999999999998 27.939999999999998 20.715 100-104 24.310000000000002 27.62 27.405 20.665 105-109 24.175 27.560000000000002 27.935 20.330000000000002 110-114 24.10443542169913 27.254972503469187 28.097856812458243 20.542735262373437 115-119 24.524924988156023 27.546454703374216 27.40959098805075 20.519029320419012 120-124 24.940946903563727 27.852521310465235 27.35442127965492 19.852110506316116 125-129 25.19902020820576 27.107572974076344 27.847519902020824 19.84588691569708 130-134 25.205 27.3 27.744999999999997 19.75 135-139 25.55 27.625 26.575 20.25 140-144 25.669999999999998 27.48 26.834999999999997 20.015 145-149 25.47 27.05 27.575 19.905 150-151 25.4625 26.8 27.5875 20.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.5 27 3.0 28 4.0 29 7.0 30 10.5 31 14.5 32 16.0 33 18.5 34 35.5 35 60.0 36 83.0 37 114.0 38 138.0 39 154.0 40 189.0 41 226.5 42 245.0 43 276.0 44 286.5 45 290.5 46 304.0 47 275.5 48 237.0 49 213.5 50 185.0 51 142.0 52 108.5 53 95.0 54 76.0 55 49.5 56 34.0 57 25.5 58 16.0 59 14.0 60 14.5 61 7.5 62 7.5 63 6.5 64 2.0 65 2.0 66 1.0 67 1.0 68 1.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 2.715 115-119 5.015 120-124 2.63 125-129 2.02 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.45 0.0 0.0 0.0 0.0 100-101 1.7374999999999998 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.1375 0.0 0.0 0.0 0.0 106-107 2.5 0.0 0.0 0.0 0.0 108-109 2.7625 0.0 0.0 0.0 0.0 110-111 3.0374999999999996 0.0 0.0 0.0 0.0 112-113 3.4875 0.0 0.0 0.0 0.0 114-115 3.95 0.0 0.0 0.0 0.0 116-117 4.4125 0.0 0.0 0.0 0.0 118-119 4.9875 0.0 0.0 0.0 0.0 120-121 5.4 0.0 0.0 0.0 0.0 122-123 5.8875 0.0 0.0 0.0 0.0 124-125 6.487500000000001 0.0 0.0 0.0 0.0 126-127 6.8375 0.0 0.0 0.0 0.0 128-129 7.425 0.0 0.0 0.0 0.0 130-131 8.162500000000001 0.0 0.0 0.0 0.0 132-133 8.875 0.0 0.0 0.0 0.0 134-135 9.675 0.0 0.0 0.0 0.0 136-137 10.2 0.0 0.0 0.0 0.0 138-139 10.899999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845850 spots for SRR7169767.sra Written 845850 spots for SRR7169767.sra Read 845853 spots for SRR7169767.sra Written 845853 spots for SRR7169767.sra SRR ids: ['SRR7169767.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3yiiy8me SRR7169767.sra spots: 16917003 blocks: [[1, 845850], [845851, 1691700], [1691701, 2537550], [2537551, 3383400], [3383401, 4229250], [4229251, 5075100], [5075101, 5920950], [5920951, 6766800], [6766801, 7612650], [7612651, 8458500], [8458501, 9304350], [9304351, 10150200], [10150201, 10996050], [10996051, 11841900], [11841901, 12687750], [12687751, 13533600], [13533601, 14379450], [14379451, 15225300], [15225301, 16071150], [16071151, 16917003]] SRR7169767 file size 5710916 SRR7169767 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169767 SRR7169767_1.fastq SRR7169767_2.fastq Input file: SRR7169767_1.fastq Paired file: SRR7169767_2.fastq trimmed: SRR7169767-trimmed-pair1.fastq, SRR7169767-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:28:17 2025 >> started Tue Feb 11 14:28:35 2025 >> done (17.601s) 16917003 read pairs processed; of these: 12047 ( 0.07%) short read pairs filtered out after trimming by size control 24505 ( 0.14%) empty read pairs filtered out after trimming by size control 16880451 (99.78%) read pairs available; of these: 8542838 (50.61%) trimmed read pairs available after processing 8337613 (49.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 10 0.00% 24 6 0.00% 25 2 0.00% 26 6 0.00% 27 4 0.00% 28 8 0.00% 29 10 0.00% 30 4 0.00% 31 11 0.00% 32 11 0.00% 33 9 0.00% 34 17 0.00% 35 16 0.00% 36 20 0.00% 37 24 0.00% 38 24 0.00% 39 29 0.00% 40 47 0.00% 41 48 0.00% 42 45 0.00% 43 61 0.00% 44 54 0.00% 45 75 0.00% 46 68 0.00% 47 88 0.00% 48 127 0.00% 49 132 0.00% 50 138 0.00% 51 199 0.00% 52 182 0.00% 53 213 0.00% 54 204 0.00% 55 250 0.00% 56 246 0.00% 57 327 0.00% 58 367 0.00% 59 396 0.00% 60 533 0.00% 61 585 0.00% 62 638 0.00% 63 714 0.00% 64 890 0.01% 65 869 0.01% 66 922 0.01% 67 1075 0.01% 68 1201 0.01% 69 1354 0.01% 70 1644 0.01% 71 1825 0.01% 72 2207 0.01% 73 2547 0.02% 74 2810 0.02% 75 3060 0.02% 76 3713 0.02% 77 4033 0.02% 78 4194 0.02% 79 4491 0.03% 80 5078 0.03% 81 5592 0.03% 82 6490 0.04% 83 7362 0.04% 84 8799 0.05% 85 9915 0.06% 86 10359 0.06% 87 11038 0.07% 88 11910 0.07% 89 12494 0.07% 90 13453 0.08% 91 14767 0.09% 92 16153 0.10% 93 17616 0.10% 94 18677 0.11% 95 20133 0.12% 96 21236 0.13% 97 21928 0.13% 98 22890 0.14% 99 23620 0.14% 100 25067 0.15% 101 26151 0.15% 102 28059 0.17% 103 29950 0.18% 104 31164 0.18% 105 33058 0.20% 106 34356 0.20% 107 35448 0.21% 108 36333 0.22% 109 37340 0.22% 110 37810 0.22% 111 39587 0.23% 112 41199 0.24% 113 43338 0.26% 114 44796 0.27% 115 46347 0.27% 116 47611 0.28% 117 49132 0.29% 118 50017 0.30% 119 50276 0.30% 120 51122 0.30% 121 52753 0.31% 122 54056 0.32% 123 56155 0.33% 124 58617 0.35% 125 60426 0.36% 126 62630 0.37% 127 64075 0.38% 128 65055 0.39% 129 66212 0.39% 130 67868 0.40% 131 68759 0.41% 132 70479 0.42% 133 73566 0.44% 134 74968 0.44% 135 78092 0.46% 136 81519 0.48% 137 85333 0.51% 138 88057 0.52% 139 92169 0.55% 140 96577 0.57% 141 102968 0.61% 142 110695 0.66% 143 121492 0.72% 144 137775 0.82% 145 161859 0.96% 146 196483 1.16% 147 257024 1.52% 148 379954 2.25% 149 735273 4.36% 150 3781486 22.40% 151 8337613 49.39% 16880451 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=244.50 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=18.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=43 prefix-density=0.19 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=226.57 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=24.7 sequence=GAAGAAGAAGAAA SRR7169767 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:29:19 Started mapping on | Feb 11 14:29:19 Finished on | Feb 11 14:30:42 Mapping speed, Million of reads per hour | 732.16 Number of input reads | 16880451 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16071806 Uniquely mapped reads % | 95.21% Average mapped length | 290.49 Number of splices: Total | 14607196 Number of splices: Annotated (sjdb) | 14357659 Number of splices: GT/AG | 14392644 Number of splices: GC/AG | 170927 Number of splices: AT/AC | 12296 Number of splices: Non-canonical | 31329 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 315380 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 141243 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.96% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 505003 505003 505003 N_multimapping 315380 315380 315380 N_noFeature 391125 15888443 469021 N_ambiguous 165611 1681 58782 UnstrandedReadsAssigned:15515070 PositiveStrandReadsAssigned:181682 NegativeStrandReadsAssigned:15544003 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169767 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169767-trimmed-pair1.fastq SRR7169767-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,880,451 reads, 15,559,994 reads pseudoaligned [quant] estimated average fragment length: 213.927 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR7169767.ke.tsv 34699 SRR7169767.se.tsv 87100 total ==> SRR7169767.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.07 314 11.4872 Potri.005G024800.1.v4.1 1035 822.073 40 3.21313 Potri.004G059700.1.v4.1 961 748.079 0 0 Potri.007G009000.2.v4.1 1416 1203.07 0 0 Potri.003G141000.2.v4.1 2943 2730.07 319.043 7.71707 Potri.016G087400.1.v4.1 270 91.9219 924 663.791 Potri.015G069301.1.v4.1 564 353.004 0 0 Potri.010G195200.1.v4.1 1773 1560.07 17 0.719585 Potri.012G127500.1.v4.1 977 764.079 7715 666.77 ==> SRR7169767.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1960 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 321 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169767 completed mapping pipeline successfully