Starting /dee2/code/volunteer_pipeline.sh SRR7169768 current disk space = 2818991419392 free memory = 1581200680 SRR7169768 SRAfilesize c0ce4ebe45dfba3ec796b793054998ba SRR7169768.sra SRR7169768.sra file validated SRR7169768 is paired end SRR7169768 is conventional basespace SRR7169768 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169768_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.71425 18.0 18.0 18.0 18.0 32.0 2 28.00625 27.0 27.0 30.0 25.0 31.0 3 29.31675 29.0 27.0 31.0 25.0 33.0 4 31.50275 33.0 31.0 33.0 29.0 33.0 5 32.19925 33.0 32.0 33.0 31.0 33.0 6 36.47075 38.0 36.0 38.0 34.0 38.0 7 37.20825 38.0 38.0 38.0 36.0 38.0 8 37.30475 38.0 38.0 38.0 36.0 38.0 9 37.4185 38.0 38.0 38.0 37.0 38.0 10-14 37.58365 38.0 38.0 38.0 37.2 38.0 15-19 37.6083 38.0 38.0 38.0 38.0 38.0 20-24 37.676249999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.65795 38.0 38.0 38.0 38.0 38.0 30-34 37.62384999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.4035 38.0 38.0 38.0 37.6 38.0 40-44 37.156150000000004 38.0 38.0 38.0 36.4 38.0 45-49 37.40985 38.0 38.0 38.0 37.0 38.0 50-54 37.519099999999995 38.0 38.0 38.0 37.2 38.0 55-59 37.43905 38.0 38.0 38.0 37.0 38.0 60-64 37.38945 38.0 38.0 38.0 37.0 38.0 65-69 37.3254 38.0 38.0 38.0 36.8 38.0 70-74 37.286699999999996 38.0 38.0 38.0 36.6 38.0 75-79 37.299150000000004 38.0 38.0 38.0 36.8 38.0 80-84 37.168549999999996 38.0 38.0 38.0 36.2 38.0 85-89 37.0419 38.0 38.0 38.0 35.8 38.0 90-94 36.87695 38.0 38.0 38.0 35.4 38.0 95-99 36.967099999999995 38.0 38.0 38.0 35.6 38.0 100-104 36.80975 38.0 38.0 38.0 35.2 38.0 105-109 36.65005 38.0 38.0 38.0 34.2 38.0 110-114 36.5482 38.0 38.0 38.0 34.0 38.0 115-119 36.394349999999996 38.0 37.8 38.0 34.0 38.0 120-124 36.295 38.0 37.2 38.0 34.0 38.0 125-129 36.12705 38.0 37.0 38.0 33.2 38.0 130-134 35.6749 38.0 36.2 38.0 31.0 38.0 135-139 35.4976 38.0 36.0 38.0 30.4 38.0 140-144 35.17635 38.0 35.2 38.0 30.4 38.0 145-149 34.62165 38.0 35.0 38.0 28.2 38.0 150-151 30.731 36.0 29.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 1.0 18 0.0 19 2.0 20 1.0 21 4.0 22 4.0 23 2.0 24 2.0 25 4.0 26 7.0 27 9.0 28 15.0 29 32.0 30 31.0 31 31.0 32 67.0 33 82.0 34 147.0 35 321.0 36 820.0 37 2416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.52212389380531 19.59544879898862 7.83817951959545 35.04424778761062 2 24.625 13.625000000000002 34.699999999999996 27.05 3 21.15 20.724999999999998 24.625 33.5 4 23.025000000000002 28.175 23.7 25.1 5 23.25 32.800000000000004 23.075000000000003 20.875 6 17.849999999999998 36.65 24.75 20.75 7 13.775 27.3 41.075 17.849999999999998 8 17.575 25.15 31.974999999999998 25.3 9 17.625 25.025 31.924999999999997 25.424999999999997 10-14 19.85 30.535 26.384999999999998 23.23 15-19 20.07 28.860000000000003 27.54 23.53 20-24 20.195 29.244999999999997 27.13 23.43 25-29 20.27 29.685 27.529999999999998 22.515 30-34 20.005 28.939999999999998 27.575 23.48 35-39 20.255000000000003 29.465000000000003 26.895000000000003 23.385 40-44 20.505000000000003 29.315 27.16 23.02 45-49 20.625 28.58 27.29 23.505000000000003 50-54 19.675 28.925 27.58 23.82 55-59 20.36 29.005 27.235 23.400000000000002 60-64 19.855 28.605000000000004 27.794999999999998 23.745 65-69 20.505000000000003 28.410000000000004 27.375 23.71 70-74 20.119999999999997 28.92 27.310000000000002 23.65 75-79 20.665 28.449999999999996 27.43 23.455000000000002 80-84 20.630000000000003 28.625 27.1 23.645 85-89 20.445 28.345 27.405 23.805 90-94 20.47 28.634999999999998 27.165 23.73 95-99 20.57 29.020000000000003 26.665 23.745 100-104 20.815 28.87 26.695 23.62 105-109 20.605 28.144999999999996 27.245 24.005000000000003 110-114 21.175 28.799999999999997 26.590000000000003 23.435 115-119 21.195 28.244999999999997 27.275 23.285 120-124 21.555 28.04 26.484999999999996 23.919999999999998 125-129 21.19 28.025 26.5 24.285 130-134 20.724999999999998 28.294999999999998 26.484999999999996 24.495 135-139 21.115000000000002 28.494999999999997 26.474999999999998 23.915 140-144 20.705000000000002 28.13 26.665 24.5 145-149 20.96 27.744999999999997 26.765 24.529999999999998 150-151 20.9875 28.425 25.900000000000002 24.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.0 24 2.5 25 4.5 26 4.5 27 5.5 28 9.0 29 15.5 30 18.0 31 21.0 32 38.0 33 45.5 34 49.5 35 63.0 36 85.0 37 106.5 38 128.5 39 152.5 40 173.5 41 222.5 42 261.5 43 279.0 44 286.0 45 268.0 46 265.5 47 243.0 48 220.0 49 219.0 50 175.0 51 138.5 52 121.0 53 101.5 54 85.0 55 53.0 56 27.5 57 25.0 58 19.5 59 15.0 60 16.5 61 11.0 62 5.5 63 3.5 64 2.5 65 1.5 66 1.5 67 2.5 68 1.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.037500000000000006 0.0 0.0 0.025 0.0 62-63 0.05 0.0 0.0 0.025 0.0 64-65 0.05 0.0 0.0 0.025 0.0 66-67 0.075 0.0 0.0 0.025 0.0 68-69 0.1 0.0 0.0 0.025 0.0 70-71 0.15 0.0 0.0 0.025 0.0 72-73 0.16249999999999998 0.0 0.0 0.025 0.0 74-75 0.2 0.0 0.0 0.025 0.0 76-77 0.2625 0.0 0.0 0.025 0.0 78-79 0.325 0.0 0.0 0.025 0.0 80-81 0.3625 0.0 0.0 0.025 0.0 82-83 0.4625 0.0 0.0 0.025 0.0 84-85 0.5375 0.0 0.0 0.025 0.0 86-87 0.625 0.0 0.0 0.025 0.0 88-89 0.8500000000000001 0.0 0.0 0.025 0.0 90-91 1.0625 0.0 0.0 0.025 0.0 92-93 1.2375 0.0 0.0 0.025 0.0 94-95 1.4625 0.0 0.0 0.025 0.0 96-97 1.6375000000000002 0.0 0.0 0.025 0.0 98-99 1.9125 0.0 0.0 0.025 0.0 100-101 2.2 0.0 0.0 0.025 0.0 102-103 2.5125 0.0 0.0 0.025 0.0 104-105 2.9000000000000004 0.0 0.0 0.025 0.0 106-107 3.2125 0.0 0.0 0.025 0.0 108-109 3.5875 0.0 0.0 0.025 0.0 110-111 4.0 0.0 0.0 0.025 0.0 112-113 4.425 0.0 0.0 0.025 0.0 114-115 4.9125 0.0 0.0 0.025 0.0 116-117 5.5625 0.0 0.0 0.025 0.0 118-119 6.0875 0.0 0.0 0.025 0.0 120-121 6.475 0.0 0.0 0.025 0.0 122-123 6.95 0.0 0.0 0.025 0.0 124-125 7.5375 0.0 0.0 0.025 0.0 126-127 8.1125 0.0 0.0 0.025 0.0 128-129 8.850000000000001 0.0 0.0 0.025 0.0 130-131 9.45 0.0 0.0 0.025 0.0 132-133 10.125 0.0 0.0 0.025 0.0 134-135 10.75 0.0 0.0 0.025 0.0 136-137 11.575 0.0 0.0 0.025 0.0 138-139 12.15 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTGAA 60 0.0044944645 14.498751 130-134 CAGTCAC 65 0.0076419367 13.383461 140-144 >>END_MODULE SRR7169768 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169768_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.827 33.0 33.0 34.0 32.0 34.0 2 31.85625 33.0 33.0 34.0 27.0 34.0 3 32.73425 33.0 33.0 34.0 32.0 34.0 4 32.8885 33.0 33.0 34.0 32.0 34.0 5 33.056 34.0 33.0 34.0 32.0 34.0 6 37.2975 38.0 38.0 38.0 37.0 38.0 7 37.26825 38.0 38.0 38.0 37.0 38.0 8 37.32675 38.0 38.0 38.0 37.0 38.0 9 37.317 38.0 38.0 38.0 37.0 38.0 10-14 37.30219999999999 38.0 38.0 38.0 37.4 38.0 15-19 37.30305 38.0 38.0 38.0 37.4 38.0 20-24 37.274649999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.29225 38.0 38.0 38.0 37.0 38.0 30-34 37.258500000000005 38.0 38.0 38.0 37.0 38.0 35-39 36.84555 38.0 38.0 38.0 35.4 38.0 40-44 37.13405 38.0 38.0 38.0 37.0 38.0 45-49 36.73695 38.0 38.0 38.0 35.4 38.0 50-54 36.9353 38.0 38.0 38.0 36.2 38.0 55-59 36.31935 38.0 37.4 38.0 32.8 38.0 60-64 36.8628 38.0 38.0 38.0 36.0 38.0 65-69 36.85025 38.0 38.0 38.0 35.8 38.0 70-74 36.8236 38.0 38.0 38.0 36.0 38.0 75-79 36.72885 38.0 38.0 38.0 35.4 38.0 80-84 36.77845 38.0 38.0 38.0 35.6 38.0 85-89 35.70415 38.0 36.8 38.0 29.4 38.0 90-94 36.51545 38.0 38.0 38.0 34.8 38.0 95-99 36.5043 38.0 38.0 38.0 34.6 38.0 100-104 36.4029 38.0 38.0 38.0 34.0 38.0 105-109 35.62065 38.0 37.0 38.0 30.8 38.0 110-114 35.0675 38.0 36.8 38.0 28.8 38.0 115-119 34.3537 38.0 36.0 38.0 25.0 38.0 120-124 34.69385 38.0 36.0 38.0 27.0 38.0 125-129 34.623000000000005 38.0 36.0 38.0 25.6 38.0 130-134 34.2149 38.0 34.8 38.0 22.0 38.0 135-139 34.16865 38.0 34.8 38.0 24.0 38.0 140-144 32.78985 37.6 31.6 38.0 19.0 38.0 145-149 32.52405 38.0 32.2 38.0 17.8 38.0 150-151 28.94225 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 1.0 5 2.0 6 1.0 7 3.0 8 1.0 9 1.0 10 1.0 11 3.0 12 3.0 13 2.0 14 2.0 15 1.0 16 2.0 17 4.0 18 2.0 19 9.0 20 2.0 21 8.0 22 13.0 23 6.0 24 10.0 25 10.0 26 21.0 27 28.0 28 27.0 29 31.0 30 44.0 31 54.0 32 111.0 33 154.0 34 208.0 35 344.0 36 813.0 37 2070.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.900000000000006 20.8 11.825 27.474999999999998 2 27.975 26.625 27.55 17.849999999999998 3 19.55 28.549999999999997 32.375 19.525000000000002 4 23.875 34.125 23.625 18.375 5 23.799999999999997 36.925000000000004 22.375 16.900000000000002 6 21.675 37.125 22.75 18.45 7 20.025000000000002 21.15 38.800000000000004 20.025000000000002 8 22.025 25.424999999999997 27.3 25.25 9 20.9 26.025 29.425 23.65 10-14 23.01 28.360000000000003 26.765 21.865000000000002 15-19 23.385 27.66 27.845 21.11 20-24 23.369999999999997 27.595 27.76 21.275 25-29 23.29 27.88 27.284999999999997 21.545 30-34 23.31 28.28 27.639999999999997 20.77 35-39 23.195 27.700000000000003 27.87 21.235 40-44 23.169999999999998 27.925 27.615000000000002 21.29 45-49 23.515 28.1 27.169999999999998 21.215 50-54 23.335 27.735 28.1 20.830000000000002 55-59 23.599999999999998 27.61 27.639999999999997 21.15 60-64 23.125 27.965 27.894999999999996 21.015 65-69 23.189999999999998 28.035 27.815 20.96 70-74 23.985 27.26 27.99 20.765 75-79 23.485 27.134999999999998 28.610000000000003 20.77 80-84 23.595 27.589999999999996 28.065 20.75 85-89 23.76 27.975 28.235 20.03 90-94 23.785 27.13 28.15 20.935000000000002 95-99 24.145 27.805000000000003 28.175 19.875 100-104 24.279999999999998 27.61 27.62 20.49 105-109 24.325 27.794999999999998 26.974999999999998 20.905 110-114 24.43764345830145 28.24789594491201 26.87069625095639 20.443764345830147 115-119 24.323763044494058 27.978817299205648 27.59462125538653 20.102798400913763 120-124 24.983442865148504 27.225024198889397 27.316725253451523 20.47480768251057 125-129 24.93147903766115 28.819409197035835 26.159780732920517 20.0893310323825 130-134 25.665 27.62 27.155 19.56 135-139 24.834999999999997 27.589999999999996 27.455000000000002 20.119999999999997 140-144 25.36 27.615000000000002 26.51 20.515 145-149 25.695 27.02 27.310000000000002 19.975 150-151 26.275 25.900000000000002 27.625 20.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 3.0 27 4.0 28 5.5 29 6.0 30 7.5 31 13.5 32 19.0 33 24.0 34 32.5 35 46.5 36 73.0 37 100.5 38 130.0 39 172.0 40 201.5 41 240.0 42 254.5 43 268.5 44 287.5 45 280.5 46 286.5 47 265.0 48 248.0 49 228.0 50 181.5 51 136.0 52 106.0 53 85.0 54 71.5 55 59.0 56 45.5 57 37.0 58 23.0 59 16.0 60 9.0 61 5.0 62 4.0 63 4.0 64 5.5 65 4.5 66 2.0 67 1.0 68 1.0 69 1.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 1.975 115-119 3.695 120-124 1.855 125-129 1.49 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3766951280763436 0.75 3 0.0 0.0 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.8500000000000001 0.0 0.0 0.0 0.0 90-91 1.0625 0.0 0.0 0.0 0.0 92-93 1.25 0.0 0.0 0.0 0.0 94-95 1.4875 0.0 0.0 0.0 0.0 96-97 1.6625 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.1875 0.0 0.0 0.0 0.0 102-103 2.4875 0.0 0.0 0.0 0.0 104-105 2.8625 0.0 0.0 0.0 0.0 106-107 3.1625 0.0 0.0 0.0 0.0 108-109 3.5 0.0 0.0 0.0 0.0 110-111 3.9 0.0 0.0 0.0 0.0 112-113 4.325 0.0 0.0 0.0 0.0 114-115 4.775 0.0 0.0 0.0 0.0 116-117 5.3875 0.0 0.0 0.0 0.0 118-119 5.925 0.0 0.0 0.0 0.0 120-121 6.3125 0.0 0.0 0.0 0.0 122-123 6.7125 0.0 0.0 0.0 0.0 124-125 7.3125 0.0 0.0 0.0 0.0 126-127 7.875 0.0 0.0 0.0 0.0 128-129 8.575 0.0 0.0 0.0 0.0 130-131 9.175 0.0 0.0 0.0 0.0 132-133 9.7625 0.0 0.0 0.0 0.0 134-135 10.3 0.0 0.0 0.0 0.0 136-137 11.05 0.0 0.0 0.0 0.0 138-139 11.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTTCA 10 0.0069754543 143.9875 145 CATCCGG 10 0.0069754543 143.9875 9 GGCTCCT 10 0.0069754543 143.9875 1 TTTCAAT 30 0.0018480307 71.99375 1 GTCTTCG 50 1.8396128E-4 57.594997 145 AAAAAAA 20 0.006141849 28.797503 130-134 TGTAGGG 55 0.0026365395 15.707727 130-134 GAGTGTC 60 0.004705986 14.39875 140-144 AGAGTGT 60 0.004705986 14.39875 140-144 GTGTAGG 65 0.007999954 13.291155 130-134 >>END_MODULE Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731881 spots for SRR7169768.sra Written 731881 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra Read 731868 spots for SRR7169768.sra Written 731868 spots for SRR7169768.sra SRR ids: ['SRR7169768.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qyypo_0z SRR7169768.sra spots: 14637373 blocks: [[1, 731868], [731869, 1463736], [1463737, 2195604], [2195605, 2927472], [2927473, 3659340], [3659341, 4391208], [4391209, 5123076], [5123077, 5854944], [5854945, 6586812], [6586813, 7318680], [7318681, 8050548], [8050549, 8782416], [8782417, 9514284], [9514285, 10246152], [10246153, 10978020], [10978021, 11709888], [11709889, 12441756], [12441757, 13173624], [13173625, 13905492], [13905493, 14637373]] SRR7169768 file size 4938425 SRR7169768 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169768 SRR7169768_1.fastq SRR7169768_2.fastq Input file: SRR7169768_1.fastq Paired file: SRR7169768_2.fastq trimmed: SRR7169768-trimmed-pair1.fastq, SRR7169768-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:46:20 2025 >> started Thu Apr 10 15:46:36 2025 >> done (15.620s) 14637373 read pairs processed; of these: 12681 ( 0.09%) short read pairs filtered out after trimming by size control 18727 ( 0.13%) empty read pairs filtered out after trimming by size control 14605965 (99.79%) read pairs available; of these: 7515117 (51.45%) trimmed read pairs available after processing 7090848 (48.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 0 0.00% 24 3 0.00% 25 3 0.00% 26 3 0.00% 27 5 0.00% 28 6 0.00% 29 8 0.00% 30 12 0.00% 31 11 0.00% 32 8 0.00% 33 14 0.00% 34 11 0.00% 35 16 0.00% 36 27 0.00% 37 29 0.00% 38 20 0.00% 39 31 0.00% 40 42 0.00% 41 56 0.00% 42 38 0.00% 43 44 0.00% 44 45 0.00% 45 57 0.00% 46 84 0.00% 47 83 0.00% 48 111 0.00% 49 124 0.00% 50 152 0.00% 51 154 0.00% 52 195 0.00% 53 211 0.00% 54 235 0.00% 55 236 0.00% 56 293 0.00% 57 332 0.00% 58 369 0.00% 59 435 0.00% 60 478 0.00% 61 601 0.00% 62 690 0.00% 63 849 0.01% 64 794 0.01% 65 1008 0.01% 66 1067 0.01% 67 1108 0.01% 68 1264 0.01% 69 1422 0.01% 70 1707 0.01% 71 1974 0.01% 72 2378 0.02% 73 2702 0.02% 74 2952 0.02% 75 3412 0.02% 76 3901 0.03% 77 4137 0.03% 78 4297 0.03% 79 4548 0.03% 80 5149 0.04% 81 5870 0.04% 82 6686 0.05% 83 7689 0.05% 84 9049 0.06% 85 10046 0.07% 86 10733 0.07% 87 11238 0.08% 88 11934 0.08% 89 12459 0.09% 90 13384 0.09% 91 14480 0.10% 92 16031 0.11% 93 17230 0.12% 94 18787 0.13% 95 19856 0.14% 96 20635 0.14% 97 21414 0.15% 98 22076 0.15% 99 22556 0.15% 100 24024 0.16% 101 24876 0.17% 102 26624 0.18% 103 28171 0.19% 104 29940 0.20% 105 31391 0.21% 106 32455 0.22% 107 33043 0.23% 108 33818 0.23% 109 34524 0.24% 110 34932 0.24% 111 36287 0.25% 112 37552 0.26% 113 39736 0.27% 114 41510 0.28% 115 43176 0.30% 116 44037 0.30% 117 45252 0.31% 118 45754 0.31% 119 45933 0.31% 120 46776 0.32% 121 47365 0.32% 122 48710 0.33% 123 50352 0.34% 124 52568 0.36% 125 54762 0.37% 126 56511 0.39% 127 57682 0.39% 128 59127 0.40% 129 59931 0.41% 130 60986 0.42% 131 62103 0.43% 132 63366 0.43% 133 65708 0.45% 134 67759 0.46% 135 70712 0.48% 136 72896 0.50% 137 75748 0.52% 138 79448 0.54% 139 82438 0.56% 140 85947 0.59% 141 92316 0.63% 142 98693 0.68% 143 108548 0.74% 144 122344 0.84% 145 144251 0.99% 146 173665 1.19% 147 225850 1.55% 148 332822 2.28% 149 634484 4.34% 150 3226110 22.09% 151 7090848 48.55% 14605965 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=35 prefix-density=0.19 prefix-fanout=2.6 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=232.79 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=35 prefix-density=0.23 prefix-fanout=2.8 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.03 sequence-density-rank=42 fanout-score=80.99 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=12.1 sequence=CTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCAACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169768 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:47:17 Started mapping on | Apr 10 15:47:17 Finished on | Apr 10 15:48:39 Mapping speed, Million of reads per hour | 641.24 Number of input reads | 14605965 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13903586 Uniquely mapped reads % | 95.19% Average mapped length | 289.68 Number of splices: Total | 12562507 Number of splices: Annotated (sjdb) | 12344812 Number of splices: GT/AG | 12375429 Number of splices: GC/AG | 146798 Number of splices: AT/AC | 10682 Number of splices: Non-canonical | 29598 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275982 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 19985 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 437827 437827 437827 N_multimapping 275982 275982 275982 N_noFeature 325018 13730175 410317 N_ambiguous 142626 797 53971 UnstrandedReadsAssigned:13435942 PositiveStrandReadsAssigned:172614 NegativeStrandReadsAssigned:13439298 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169768 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169768-trimmed-pair1.fastq SRR7169768-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,605,965 reads, 13,394,132 reads pseudoaligned [quant] estimated average fragment length: 213.557 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52401 SRR7169768.ke.tsv 34699 SRR7169768.se.tsv 87100 total ==> SRR7169768.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.44 256 11.0629 Potri.005G024800.1.v4.1 1035 822.443 47 4.45867 Potri.004G059700.1.v4.1 961 748.448 0 0 Potri.007G009000.2.v4.1 1416 1203.44 0 0 Potri.003G141000.2.v4.1 2943 2730.44 234.067 6.68836 Potri.016G087400.1.v4.1 270 93.6897 1291.68 1075.66 Potri.015G069301.1.v4.1 564 353.923 0 0 Potri.010G195200.1.v4.1 1773 1560.44 65 3.24996 Potri.012G127500.1.v4.1 977 764.443 4588 468.265 ==> SRR7169768.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2195 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 328 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169768 completed mapping pipeline successfully