Starting /dee2/code/volunteer_pipeline.sh SRR7169769 current disk space = 3050226212864 free memory = 1449038988 SRR7169769 SRAfilesize bf67f9281d9c9c675ede8d35d55057de SRR7169769.sra SRR7169769.sra file validated SRR7169769 is paired end SRR7169769 is conventional basespace SRR7169769 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169769_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.10425 30.0 18.0 33.0 18.0 33.0 2 29.57125 31.0 27.0 33.0 25.0 33.0 3 30.74575 31.0 29.0 33.0 27.0 33.0 4 30.61475 31.0 30.0 33.0 28.0 33.0 5 32.2675 33.0 32.0 33.0 32.0 33.0 6 36.494 38.0 36.0 38.0 34.0 38.0 7 37.1355 38.0 38.0 38.0 36.0 38.0 8 37.52075 38.0 38.0 38.0 37.0 38.0 9 37.62575 38.0 38.0 38.0 37.0 38.0 10-14 37.5955 38.0 38.0 38.0 37.8 38.0 15-19 37.6179 38.0 38.0 38.0 38.0 38.0 20-24 37.64149999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.51049999999999 38.0 38.0 38.0 37.6 38.0 30-34 37.5149 38.0 38.0 38.0 37.8 38.0 35-39 37.350750000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.269999999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.3651 38.0 38.0 38.0 37.0 38.0 50-54 37.41735 38.0 38.0 38.0 37.0 38.0 55-59 37.3715 38.0 38.0 38.0 36.8 38.0 60-64 37.283550000000005 38.0 38.0 38.0 36.8 38.0 65-69 36.97395 38.0 38.0 38.0 35.6 38.0 70-74 37.1753 38.0 38.0 38.0 36.0 38.0 75-79 36.5726 38.0 37.6 38.0 33.8 38.0 80-84 37.000249999999994 38.0 38.0 38.0 35.8 38.0 85-89 36.8312 38.0 38.0 38.0 35.2 38.0 90-94 36.6899 38.0 38.0 38.0 34.8 38.0 95-99 36.7572 38.0 38.0 38.0 35.0 38.0 100-104 36.701800000000006 38.0 38.0 38.0 34.8 38.0 105-109 36.5678 38.0 38.0 38.0 34.4 38.0 110-114 35.91175 38.0 36.8 38.0 31.6 38.0 115-119 35.11185 38.0 35.4 38.0 27.8 38.0 120-124 36.01284999999999 38.0 36.8 38.0 33.0 38.0 125-129 35.744299999999996 38.0 36.6 38.0 31.8 38.0 130-134 35.3848 38.0 35.6 38.0 29.8 38.0 135-139 34.9877 38.0 35.4 38.0 27.4 38.0 140-144 34.26285 38.0 34.6 38.0 25.0 38.0 145-149 34.190250000000006 38.0 35.0 38.0 25.2 38.0 150-151 30.418499999999998 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 2.0 17 1.0 18 4.0 19 4.0 20 1.0 21 6.0 22 2.0 23 3.0 24 3.0 25 6.0 26 12.0 27 14.0 28 20.0 29 23.0 30 38.0 31 56.0 32 71.0 33 105.0 34 181.0 35 318.0 36 973.0 37 2155.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.95953464845726 11.2797167425392 8.674759736975215 40.08598887202833 2 21.975 17.224999999999998 32.975 27.825 3 20.8 21.5 25.124999999999996 32.574999999999996 4 23.45 30.275000000000002 22.525000000000002 23.75 5 22.225 34.725 23.925 19.125 6 20.025000000000002 34.0 25.825 20.150000000000002 7 14.374999999999998 24.85 42.55 18.224999999999998 8 18.8 25.324999999999996 30.5 25.374999999999996 9 17.349999999999998 24.9 32.675 25.074999999999996 10-14 20.18 29.685 27.169999999999998 22.965 15-19 20.14 28.49 27.834999999999997 23.535 20-24 20.305 29.349999999999998 27.26 23.085 25-29 20.47 28.84 27.32 23.369999999999997 30-34 20.150000000000002 28.299999999999997 27.495000000000005 24.055 35-39 20.04 28.835 27.169999999999998 23.955000000000002 40-44 20.26 29.185 27.195000000000004 23.36 45-49 20.46 28.59 27.195000000000004 23.755000000000003 50-54 20.349999999999998 28.725 27.515 23.41 55-59 19.994999999999997 29.354999999999997 27.189999999999998 23.46 60-64 20.31 28.1 27.97 23.62 65-69 20.29 28.455000000000002 27.63 23.625 70-74 20.315 29.04 27.395000000000003 23.25 75-79 20.474999999999998 28.315 27.235 23.974999999999998 80-84 20.515 28.110000000000003 27.405 23.97 85-89 20.285 28.384999999999998 27.83 23.5 90-94 20.47 28.810000000000002 27.224999999999998 23.494999999999997 95-99 21.02 28.299999999999997 27.365000000000002 23.315 100-104 20.355 29.15 27.275 23.22 105-109 20.285 28.02 27.189999999999998 24.505 110-114 20.925 29.17 26.8 23.105 115-119 20.794999999999998 28.74 26.96 23.505000000000003 120-124 20.997099709971 28.777877787778777 26.567656765676567 23.657365736573656 125-129 21.17 28.199999999999996 26.88 23.75 130-134 20.669999999999998 28.345 27.24 23.745 135-139 21.015 28.645 26.590000000000003 23.75 140-144 21.26 28.18 26.334999999999997 24.224999999999998 145-149 21.125 28.53 26.029999999999998 24.315 150-151 20.349999999999998 27.525 27.400000000000002 24.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 0.0 25 1.5 26 3.5 27 4.0 28 6.5 29 10.0 30 18.5 31 27.5 32 32.5 33 34.0 34 43.5 35 59.5 36 85.0 37 119.0 38 142.0 39 160.0 40 180.5 41 212.0 42 264.0 43 277.5 44 244.5 45 247.5 46 280.5 47 281.0 48 248.0 49 210.0 50 175.5 51 150.0 52 115.0 53 88.5 54 76.5 55 49.5 56 31.5 57 33.0 58 25.0 59 14.0 60 11.0 61 9.5 62 6.5 63 4.5 64 4.0 65 3.0 66 3.0 67 2.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 90-91 0.7875000000000001 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.55 0.0 0.0 0.0 0.0 100-101 1.85 0.0 0.0 0.0 0.0 102-103 2.1875 0.0 0.0 0.0 0.0 104-105 2.5 0.0 0.0 0.0 0.0 106-107 2.8125 0.0 0.0 0.0 0.0 108-109 3.1125 0.0 0.0 0.0 0.0 110-111 3.475 0.0 0.0 0.0 0.0 112-113 4.074999999999999 0.0 0.0 0.0 0.0 114-115 4.574999999999999 0.0 0.0 0.0 0.0 116-117 5.012499999999999 0.0 0.0 0.0 0.0 118-119 5.5125 0.0 0.0 0.0 0.0 120-121 5.8875 0.0 0.0 0.0 0.0 122-123 6.35 0.0 0.0 0.0 0.0 124-125 6.8125 0.0 0.0 0.0 0.0 126-127 7.425 0.0 0.0 0.0 0.0 128-129 8.0375 0.0 0.0 0.0 0.0 130-131 8.5625 0.0 0.0 0.0 0.0 132-133 9.1125 0.0 0.0 0.0 0.0 134-135 9.8125 0.0 0.0 0.0 0.0 136-137 10.3625 0.0 0.0 0.0 0.0 138-139 10.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAATATC 10 0.006832588 144.9875 9 >>END_MODULE SRR7169769 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169769_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9425 33.0 33.0 34.0 32.0 34.0 2 33.106 34.0 33.0 34.0 32.0 34.0 3 33.0995 34.0 33.0 34.0 33.0 34.0 4 33.07275 34.0 33.0 34.0 33.0 34.0 5 33.1395 34.0 33.0 34.0 33.0 34.0 6 37.3275 38.0 38.0 38.0 37.0 38.0 7 37.39125 38.0 38.0 38.0 38.0 38.0 8 37.396 38.0 38.0 38.0 38.0 38.0 9 37.245 38.0 38.0 38.0 37.0 38.0 10-14 37.3404 38.0 38.0 38.0 37.4 38.0 15-19 36.74595 38.0 37.8 38.0 35.0 38.0 20-24 37.1572 38.0 38.0 38.0 36.8 38.0 25-29 35.89309999999999 38.0 37.0 38.0 30.0 38.0 30-34 37.113150000000005 38.0 38.0 38.0 36.8 38.0 35-39 37.22689999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.2054 38.0 38.0 38.0 37.0 38.0 45-49 37.0313 38.0 38.0 38.0 36.4 38.0 50-54 37.1015 38.0 38.0 38.0 36.8 38.0 55-59 36.996700000000004 38.0 38.0 38.0 36.4 38.0 60-64 36.96285 38.0 38.0 38.0 36.2 38.0 65-69 35.28439999999999 38.0 35.6 38.0 27.8 38.0 70-74 35.8571 38.0 36.8 38.0 29.2 38.0 75-79 36.6356 38.0 38.0 38.0 35.2 38.0 80-84 36.469550000000005 38.0 37.8 38.0 34.4 38.0 85-89 36.73694999999999 38.0 38.0 38.0 35.6 38.0 90-94 36.75425 38.0 38.0 38.0 35.6 38.0 95-99 36.6736 38.0 38.0 38.0 35.2 38.0 100-104 36.3322 38.0 38.0 38.0 34.0 38.0 105-109 35.3327 38.0 37.0 38.0 28.8 38.0 110-114 35.02955000000001 38.0 37.0 38.0 28.2 38.0 115-119 33.8116 38.0 35.8 38.0 21.4 38.0 120-124 33.81345 38.0 35.4 38.0 19.8 38.0 125-129 34.0622 38.0 35.2 38.0 22.4 38.0 130-134 34.9642 38.0 35.8 38.0 28.0 38.0 135-139 34.876 38.0 35.8 38.0 28.2 38.0 140-144 34.6387 38.0 35.0 38.0 28.0 38.0 145-149 33.87495 38.0 33.8 38.0 23.0 38.0 150-151 29.5955 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 1.0 5 0.0 6 0.0 7 0.0 8 3.0 9 1.0 10 0.0 11 2.0 12 1.0 13 2.0 14 6.0 15 1.0 16 2.0 17 3.0 18 2.0 19 5.0 20 3.0 21 4.0 22 13.0 23 14.0 24 11.0 25 13.0 26 29.0 27 22.0 28 25.0 29 39.0 30 74.0 31 70.0 32 102.0 33 124.0 34 198.0 35 290.0 36 729.0 37 2203.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.61930965482742 19.609804902451224 14.057028514257128 27.71385692846423 2 24.75 25.6 32.775 16.875 3 19.975 27.675 32.05 20.3 4 23.825 33.4 23.275000000000002 19.5 5 23.5 35.425000000000004 22.775000000000002 18.3 6 20.4 37.25 24.099999999999998 18.25 7 19.575 21.325 39.45 19.650000000000002 8 21.075 25.75 27.6 25.575 9 21.8 24.75 29.975 23.474999999999998 10-14 23.785 28.655 26.545 21.015 15-19 23.31 27.694999999999997 28.035 20.96 20-24 23.29 27.994999999999997 27.97 20.745 25-29 23.165 28.46 27.715 20.66 30-34 22.74 27.894999999999996 28.395 20.97 35-39 23.385 27.500000000000004 28.115000000000002 21.0 40-44 22.98 28.565 28.000000000000004 20.455000000000002 45-49 23.46 27.845 27.955000000000002 20.74 50-54 23.36 27.57 28.389999999999997 20.68 55-59 23.445 28.275 28.060000000000002 20.22 60-64 23.015 27.58 28.92 20.485 65-69 23.335 27.55 27.88 21.235 70-74 23.380000000000003 27.975 27.92 20.724999999999998 75-79 23.426274805325296 27.771916603868373 28.20899271539814 20.59281587540819 80-84 23.34 27.97 28.125 20.565 85-89 23.69 28.12 27.400000000000002 20.79 90-94 23.745 27.74 27.860000000000003 20.655 95-99 24.099999999999998 27.744999999999997 27.77 20.385 100-104 24.09095462285886 27.74216167484724 27.88740859461084 20.279475107683062 105-109 23.71481798499572 27.55651779870097 28.352046724736923 20.37661749156639 110-114 24.693063228974832 27.67546552076939 27.35829752404338 20.273173726212402 115-119 24.098801921148468 27.582202987280308 27.930543093893494 20.388451997677734 120-124 24.5744513696119 27.167024563976327 27.648876551615775 20.609647514796 125-129 24.72366459308005 28.11166521001491 26.88807773379261 20.276592463112436 130-134 24.96494391025641 27.463942307692307 27.408854166666668 20.162259615384613 135-139 25.2 27.834999999999997 26.69 20.275000000000002 140-144 25.569999999999997 27.08 27.405 19.945 145-149 25.369999999999997 27.529999999999998 27.584999999999997 19.515 150-151 26.5375 27.500000000000004 26.5125 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 4.5 28 6.5 29 9.5 30 11.0 31 11.5 32 24.5 33 37.0 34 45.0 35 57.5 36 77.5 37 105.0 38 127.0 39 158.5 40 196.5 41 246.5 42 282.5 43 281.5 44 289.5 45 293.0 46 276.5 47 266.5 48 246.0 49 216.0 50 182.0 51 131.5 52 98.0 53 74.5 54 50.5 55 49.0 56 43.5 57 26.5 58 18.5 59 15.5 60 11.5 61 7.0 62 5.0 63 3.0 64 2.0 65 1.5 66 1.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.475 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.16999999999999998 105-109 0.695 110-114 2.26 115-119 5.265000000000001 120-124 4.535 125-129 2.7449999999999997 130-134 0.16 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.1875 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.5125 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 2.0999999999999996 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.675 0.0 0.0 0.0 0.0 108-109 2.9875 0.0 0.0 0.0 0.0 110-111 3.3125 0.0 0.0 0.0 0.0 112-113 3.8125 0.0 0.0 0.0 0.0 114-115 4.275 0.0 0.0 0.0 0.0 116-117 4.6 0.0 0.0 0.0 0.0 118-119 5.0125 0.0 0.0 0.0 0.0 120-121 5.35 0.0 0.0 0.0 0.0 122-123 5.762499999999999 0.0 0.0 0.0 0.0 124-125 6.1625 0.0 0.0 0.0 0.0 126-127 6.737500000000001 0.0 0.0 0.0 0.0 128-129 7.325 0.0 0.0 0.0 0.0 130-131 7.85 0.0 0.0 0.0 0.0 132-133 8.4125 0.0 0.0 0.0 0.0 134-135 9.1375 0.0 0.0 0.0 0.0 136-137 9.6875 0.0 0.0 0.0 0.0 138-139 10.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867976 spots for SRR7169769.sra Written 867976 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra Read 867966 spots for SRR7169769.sra Written 867966 spots for SRR7169769.sra SRR ids: ['SRR7169769.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__viwhcjw SRR7169769.sra spots: 17359330 blocks: [[1, 867966], [867967, 1735932], [1735933, 2603898], [2603899, 3471864], [3471865, 4339830], [4339831, 5207796], [5207797, 6075762], [6075763, 6943728], [6943729, 7811694], [7811695, 8679660], [8679661, 9547626], [9547627, 10415592], [10415593, 11283558], [11283559, 12151524], [12151525, 13019490], [13019491, 13887456], [13887457, 14755422], [14755423, 15623388], [15623389, 16491354], [16491355, 17359330]] SRR7169769 file size 5860806 SRR7169769 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169769 SRR7169769_1.fastq SRR7169769_2.fastq Input file: SRR7169769_1.fastq Paired file: SRR7169769_2.fastq trimmed: SRR7169769-trimmed-pair1.fastq, SRR7169769-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:28:54 2025 >> started Tue Feb 11 14:29:13 2025 >> done (19.143s) 17359330 read pairs processed; of these: 11964 ( 0.07%) short read pairs filtered out after trimming by size control 13724 ( 0.08%) empty read pairs filtered out after trimming by size control 17333642 (99.85%) read pairs available; of these: 8248115 (47.58%) trimmed read pairs available after processing 9085527 (52.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 8 0.00% 23 1 0.00% 24 4 0.00% 25 2 0.00% 26 5 0.00% 27 5 0.00% 28 5 0.00% 29 8 0.00% 30 7 0.00% 31 12 0.00% 32 8 0.00% 33 6 0.00% 34 9 0.00% 35 13 0.00% 36 19 0.00% 37 26 0.00% 38 29 0.00% 39 31 0.00% 40 48 0.00% 41 46 0.00% 42 49 0.00% 43 44 0.00% 44 46 0.00% 45 57 0.00% 46 78 0.00% 47 77 0.00% 48 114 0.00% 49 100 0.00% 50 137 0.00% 51 146 0.00% 52 145 0.00% 53 194 0.00% 54 192 0.00% 55 229 0.00% 56 245 0.00% 57 298 0.00% 58 336 0.00% 59 394 0.00% 60 437 0.00% 61 495 0.00% 62 643 0.00% 63 724 0.00% 64 821 0.00% 65 763 0.00% 66 835 0.00% 67 985 0.01% 68 1108 0.01% 69 1339 0.01% 70 1491 0.01% 71 1772 0.01% 72 2143 0.01% 73 2242 0.01% 74 2680 0.02% 75 2883 0.02% 76 3278 0.02% 77 3667 0.02% 78 3874 0.02% 79 4078 0.02% 80 4694 0.03% 81 5382 0.03% 82 6297 0.04% 83 6970 0.04% 84 8297 0.05% 85 9268 0.05% 86 9829 0.06% 87 10389 0.06% 88 11169 0.06% 89 11741 0.07% 90 12722 0.07% 91 14019 0.08% 92 15019 0.09% 93 16651 0.10% 94 17908 0.10% 95 19100 0.11% 96 20085 0.12% 97 20649 0.12% 98 21336 0.12% 99 22206 0.13% 100 23643 0.14% 101 24959 0.14% 102 26557 0.15% 103 28210 0.16% 104 30190 0.17% 105 31717 0.18% 106 32581 0.19% 107 33413 0.19% 108 34234 0.20% 109 35122 0.20% 110 36175 0.21% 111 37492 0.22% 112 39422 0.23% 113 41213 0.24% 114 42876 0.25% 115 44806 0.26% 116 45785 0.26% 117 46755 0.27% 118 47672 0.28% 119 47881 0.28% 120 48546 0.28% 121 50521 0.29% 122 51704 0.30% 123 54016 0.31% 124 55563 0.32% 125 57749 0.33% 126 60137 0.35% 127 61807 0.36% 128 62195 0.36% 129 63416 0.37% 130 64428 0.37% 131 65782 0.38% 132 67214 0.39% 133 70236 0.41% 134 72117 0.42% 135 75140 0.43% 136 78110 0.45% 137 80905 0.47% 138 83124 0.48% 139 86956 0.50% 140 90676 0.52% 141 96918 0.56% 142 104544 0.60% 143 114668 0.66% 144 130729 0.75% 145 150932 0.87% 146 182667 1.05% 147 238571 1.38% 148 353316 2.04% 149 693611 4.00% 150 3747947 21.62% 151 9085527 52.42% 17333642 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=103.61 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=16.7 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=26 prefix-density=0.23 prefix-fanout=2.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=40 fanout-score=72.71 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.8 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7169769 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:29:57 Started mapping on | Feb 11 14:29:57 Finished on | Feb 11 14:31:27 Mapping speed, Million of reads per hour | 693.35 Number of input reads | 17333642 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16716505 Uniquely mapped reads % | 96.44% Average mapped length | 291.22 Number of splices: Total | 15332823 Number of splices: Annotated (sjdb) | 15085919 Number of splices: GT/AG | 15116592 Number of splices: GC/AG | 173571 Number of splices: AT/AC | 11736 Number of splices: Non-canonical | 30924 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 301292 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 17697 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.70% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 327757 327757 327757 N_multimapping 301292 301292 301292 N_noFeature 450213 16511136 554493 N_ambiguous 166699 860 65114 UnstrandedReadsAssigned:16099593 PositiveStrandReadsAssigned:204509 NegativeStrandReadsAssigned:16096898 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169769 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169769-trimmed-pair1.fastq SRR7169769-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,333,642 reads, 15,991,393 reads pseudoaligned [quant] estimated average fragment length: 217.544 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,016 rounds 52401 SRR7169769.ke.tsv 34699 SRR7169769.se.tsv 87100 total ==> SRR7169769.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.46 333.508 12.8012 Potri.005G024800.1.v4.1 1035 818.456 35 2.95693 Potri.004G059700.1.v4.1 961 744.456 3 0.278645 Potri.007G009000.2.v4.1 1416 1199.46 0 0 Potri.003G141000.2.v4.1 2943 2726.46 266 6.74609 Potri.016G087400.1.v4.1 270 90.4039 1451.64 1110.3 Potri.015G069301.1.v4.1 564 349.548 0 0 Potri.010G195200.1.v4.1 1773 1556.46 14 0.621956 Potri.012G127500.1.v4.1 977 760.456 6754 614.124 ==> SRR7169769.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1574 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 219 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169769 completed mapping pipeline successfully