Starting /dee2/code/volunteer_pipeline.sh SRR7169770 current disk space = 3049673306112 free memory = 1573600812 SRR7169770 SRAfilesize e1b0cf6a1b6426b5d9455ae19083ff8a SRR7169770.sra SRR7169770.sra file validated SRR7169770 is paired end SRR7169770 is conventional basespace SRR7169770 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169770_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.88675 27.0 18.0 33.0 18.0 33.0 2 30.083 31.0 29.0 33.0 27.0 33.0 3 30.64025 31.0 30.0 33.0 27.0 33.0 4 30.9705 33.0 31.0 33.0 28.0 33.0 5 32.3595 33.0 33.0 33.0 32.0 33.0 6 36.3675 38.0 36.0 38.0 34.0 38.0 7 37.00425 38.0 37.0 38.0 35.0 38.0 8 36.5505 38.0 38.0 38.0 34.0 38.0 9 37.2885 38.0 38.0 38.0 36.0 38.0 10-14 37.415350000000004 38.0 38.0 38.0 37.0 38.0 15-19 36.56195 38.0 37.2 38.0 33.4 38.0 20-24 37.50984999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.4505 38.0 38.0 38.0 37.0 38.0 30-34 37.31675 38.0 38.0 38.0 36.8 38.0 35-39 37.148199999999996 38.0 38.0 38.0 36.4 38.0 40-44 36.88865 38.0 38.0 38.0 35.4 38.0 45-49 36.6557 38.0 38.0 38.0 34.6 38.0 50-54 37.2873 38.0 38.0 38.0 36.8 38.0 55-59 37.251549999999995 38.0 38.0 38.0 36.2 38.0 60-64 37.2085 38.0 38.0 38.0 36.0 38.0 65-69 37.134949999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.03605 38.0 38.0 38.0 35.8 38.0 75-79 36.84595 38.0 38.0 38.0 35.0 38.0 80-84 36.7727 38.0 38.0 38.0 35.0 38.0 85-89 36.68365 38.0 38.0 38.0 34.6 38.0 90-94 36.4543 38.0 38.0 38.0 34.0 38.0 95-99 36.510450000000006 38.0 37.8 38.0 34.0 38.0 100-104 36.4821 38.0 38.0 38.0 34.0 38.0 105-109 36.2813 38.0 37.2 38.0 33.8 38.0 110-114 35.581 38.0 36.4 38.0 30.4 38.0 115-119 35.70135 38.0 36.6 38.0 31.4 38.0 120-124 35.7051 38.0 36.2 38.0 31.2 38.0 125-129 35.392700000000005 38.0 36.0 38.0 30.2 38.0 130-134 34.617450000000005 38.0 34.6 38.0 26.0 38.0 135-139 34.4813 38.0 34.6 38.0 26.2 38.0 140-144 34.390550000000005 38.0 34.8 38.0 26.2 38.0 145-149 33.81335 38.0 34.6 38.0 22.4 38.0 150-151 30.022375000000004 36.0 27.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 4.0 17 1.0 18 3.0 19 3.0 20 1.0 21 2.0 22 4.0 23 6.0 24 8.0 25 13.0 26 13.0 27 22.0 28 23.0 29 35.0 30 38.0 31 63.0 32 103.0 33 129.0 34 185.0 35 382.0 36 978.0 37 1980.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.984939759036145 11.897590361445783 8.132530120481928 39.984939759036145 2 21.45 17.95 32.074999999999996 28.525 3 19.126506024096386 22.188755020080322 26.229919678714857 32.454819277108435 4 22.375 30.625000000000004 22.775000000000002 24.224999999999998 5 23.125 32.875 24.25 19.75 6 18.725 36.75 24.175 20.349999999999998 7 14.075 27.3 40.65 17.974999999999998 8 18.125 24.65 29.4 27.825 9 18.075 25.650000000000002 32.45 23.825 10-14 20.275000000000002 29.955 26.400000000000002 23.369999999999997 15-19 19.875 29.060000000000002 27.495000000000005 23.57 20-24 20.22 28.375 27.555000000000003 23.849999999999998 25-29 20.01 28.425 27.98 23.585 30-34 19.99 29.14 27.315 23.555 35-39 19.919999999999998 29.5 26.985 23.595 40-44 20.225 28.470000000000002 27.87 23.435 45-49 20.305 28.799999999999997 27.095000000000002 23.799999999999997 50-54 20.285 29.205 27.215 23.294999999999998 55-59 19.919999999999998 28.78 27.195000000000004 24.104999999999997 60-64 20.044999999999998 28.7 27.384999999999998 23.87 65-69 19.715 28.694999999999997 27.74 23.849999999999998 70-74 19.74 29.38 27.13 23.75 75-79 20.155 28.78 27.029999999999998 24.035 80-84 20.53 28.705000000000002 26.650000000000002 24.115000000000002 85-89 20.015 28.499999999999996 27.295 24.19 90-94 20.330000000000002 28.955 27.205000000000002 23.51 95-99 20.145 28.634999999999998 27.339999999999996 23.880000000000003 100-104 20.64 28.12 27.77 23.47 105-109 20.893357342937176 28.60144057623049 26.745698279311725 23.75950380152061 110-114 20.325 28.645 27.339999999999996 23.69 115-119 20.59 28.499999999999996 27.05 23.86 120-124 21.310000000000002 28.575 26.55 23.565 125-129 21.09 28.095 27.045 23.77 130-134 20.880000000000003 28.854999999999997 26.590000000000003 23.674999999999997 135-139 21.055 27.875 26.715 24.355 140-144 21.515 28.225 26.634999999999998 23.625 145-149 21.085 27.865000000000002 26.655 24.395 150-151 20.1625 29.062500000000004 26.25 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 0.5 24 1.5 25 2.0 26 2.5 27 3.5 28 8.0 29 18.5 30 21.5 31 20.5 32 28.5 33 43.0 34 58.5 35 70.0 36 79.5 37 99.5 38 136.5 39 161.0 40 183.0 41 202.0 42 224.5 43 266.5 44 287.0 45 279.0 46 272.5 47 270.5 48 245.5 49 203.5 50 165.5 51 132.5 52 115.0 53 102.5 54 82.0 55 58.0 56 39.5 57 32.0 58 22.5 59 15.5 60 10.5 61 7.5 62 5.5 63 3.5 64 2.5 65 2.5 66 3.0 67 1.5 68 0.5 69 1.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.4 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.04 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.9125000000000001 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.2374999999999998 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.825 0.0 0.0 0.0 0.0 104-105 2.0125 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.8875 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 3.7875 0.0 0.0 0.0 0.0 118-119 4.2125 0.0 0.0 0.0 0.0 120-121 4.975 0.0 0.0 0.0 0.0 122-123 5.4 0.0 0.0 0.0 0.0 124-125 5.75 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.975 0.0 0.0 0.0 0.0 130-131 7.55 0.0 0.0 0.0 0.0 132-133 8.225000000000001 0.0 0.0 0.0 0.0 134-135 9.025 0.0 0.0 0.0 0.0 136-137 9.6625 0.0 0.0 0.0 0.0 138-139 10.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGCTT 10 0.006577216 146.82278 1 GAAATGA 10 0.006832588 144.9875 4 >>END_MODULE SRR7169770 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169770_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8235 33.0 33.0 34.0 32.0 34.0 2 32.98225 34.0 33.0 34.0 32.0 34.0 3 33.02375 34.0 33.0 34.0 32.0 34.0 4 32.99825 34.0 33.0 34.0 32.0 34.0 5 32.98725 34.0 33.0 34.0 32.0 34.0 6 37.1855 38.0 38.0 38.0 37.0 38.0 7 37.2455 38.0 38.0 38.0 37.0 38.0 8 37.23125 38.0 38.0 38.0 37.0 38.0 9 37.10675 38.0 38.0 38.0 37.0 38.0 10-14 36.8383 38.0 38.0 38.0 35.6 38.0 15-19 37.0467 38.0 38.0 38.0 36.4 38.0 20-24 36.9452 38.0 38.0 38.0 36.0 38.0 25-29 37.0017 38.0 38.0 38.0 36.6 38.0 30-34 36.4778 38.0 37.8 38.0 33.6 38.0 35-39 36.8395 38.0 38.0 38.0 35.6 38.0 40-44 36.08774999999999 38.0 37.0 38.0 30.4 38.0 45-49 36.97045 38.0 38.0 38.0 36.0 38.0 50-54 36.65275 38.0 37.8 38.0 34.4 38.0 55-59 36.63545 38.0 38.0 38.0 34.6 38.0 60-64 36.751549999999995 38.0 38.0 38.0 35.4 38.0 65-69 36.4982 38.0 38.0 38.0 34.2 38.0 70-74 36.442400000000006 38.0 38.0 38.0 34.2 38.0 75-79 36.41015 38.0 38.0 38.0 34.2 38.0 80-84 36.173500000000004 38.0 37.6 38.0 33.0 38.0 85-89 36.494150000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.18045 38.0 37.6 38.0 33.4 38.0 95-99 36.257250000000006 38.0 38.0 38.0 34.0 38.0 100-104 35.82055 38.0 37.0 38.0 32.2 38.0 105-109 34.46635 38.0 36.2 38.0 25.4 38.0 110-114 33.7529 38.0 35.4 38.0 20.0 38.0 115-119 33.20989999999999 38.0 35.6 38.0 13.6 38.0 120-124 32.69545 38.0 33.8 38.0 13.8 38.0 125-129 33.7093 38.0 34.8 38.0 19.4 38.0 130-134 33.79 38.0 34.2 38.0 21.8 38.0 135-139 33.855599999999995 38.0 34.6 38.0 21.8 38.0 140-144 33.77284999999999 38.0 34.2 38.0 22.6 38.0 145-149 33.0707 38.0 33.4 38.0 19.4 38.0 150-151 28.789125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 2.0 5 2.0 6 0.0 7 1.0 8 3.0 9 0.0 10 1.0 11 2.0 12 0.0 13 2.0 14 5.0 15 2.0 16 3.0 17 3.0 18 8.0 19 13.0 20 8.0 21 12.0 22 12.0 23 14.0 24 25.0 25 21.0 26 25.0 27 31.0 28 34.0 29 48.0 30 79.0 31 108.0 32 128.0 33 146.0 34 216.0 35 340.0 36 684.0 37 2016.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.325 19.45 13.4 25.825 2 27.175 25.775 30.5 16.55 3 21.13028257064266 28.00700175043761 30.08252063015754 20.78019504876219 4 24.0 35.449999999999996 22.75 17.8 5 24.349999999999998 35.9 21.8 17.95 6 20.225 38.0 23.9 17.875 7 20.75 20.599999999999998 38.074999999999996 20.575 8 21.2 25.4 27.700000000000003 25.7 9 22.35 25.874999999999996 28.675 23.1 10-14 23.674999999999997 28.405 26.35 21.57 15-19 23.165 28.065 27.779999999999998 20.990000000000002 20-24 23.025000000000002 27.900000000000002 27.805000000000003 21.27 25-29 23.225 28.285 27.295 21.195 30-34 23.16 28.375 27.839999999999996 20.625 35-39 23.445 28.265 27.62 20.669999999999998 40-44 23.405 27.82 28.044999999999998 20.73 45-49 23.965 28.02 27.395000000000003 20.62 50-54 23.285 27.62 27.73 21.365000000000002 55-59 23.505000000000003 27.74 27.83 20.925 60-64 23.365 28.21 28.015 20.41 65-69 23.285 28.025 27.865000000000002 20.825 70-74 23.54770743453396 27.866960971204975 28.122805257349253 20.46252633691181 75-79 23.427483974358974 27.734375 28.395432692307693 20.442708333333336 80-84 23.637091127338202 27.96338901670501 27.738321496448936 20.66119835950785 85-89 23.785 27.529999999999998 27.98 20.705000000000002 90-94 23.674999999999997 27.634999999999998 28.105000000000004 20.585 95-99 23.665 27.755000000000003 28.189999999999998 20.39 100-104 23.969175340272216 27.99239391513211 27.48698959167334 20.551441152922337 105-109 23.996514071871637 27.738760444968474 28.015584149279743 20.249141333880146 110-114 24.362458193979933 27.848035117056856 27.586747491638796 20.202759197324415 115-119 24.689706826449818 27.75518938583351 27.546543976032527 20.008559811684144 120-124 24.068601583113455 27.382585751978894 28.39050131926121 20.15831134564644 125-129 24.09965213832617 28.100061387354202 27.67546552076939 20.124820953550234 130-134 25.14895108396335 27.17668852951485 27.116607420017026 20.55775296650478 135-139 25.115 27.405 27.405 20.075000000000003 140-144 25.790000000000003 27.405 27.29 19.515 145-149 26.045 26.779999999999998 27.189999999999998 19.985 150-151 25.974999999999998 26.375 27.8125 19.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 1.5 24 0.0 25 0.5 26 1.5 27 2.5 28 5.0 29 6.5 30 10.0 31 16.0 32 23.0 33 32.5 34 44.0 35 56.5 36 80.0 37 98.5 38 120.5 39 172.0 40 196.0 41 220.5 42 268.5 43 280.5 44 286.0 45 279.5 46 274.0 47 271.0 48 232.5 49 208.0 50 187.5 51 149.5 52 114.5 53 91.0 54 72.0 55 50.0 56 40.5 57 30.5 58 18.0 59 14.0 60 10.5 61 7.0 62 4.5 63 4.5 64 4.5 65 3.0 66 2.5 67 2.0 68 1.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.33 75-79 0.16 80-84 0.03 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08 105-109 2.465 110-114 4.32 115-119 6.54 120-124 5.25 125-129 2.26 130-134 0.135 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.9125000000000001 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.5499999999999998 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.8375000000000004 0.0 0.0 0.0 0.0 112-113 3.05 0.0 0.0 0.0 0.0 114-115 3.3499999999999996 0.0 0.0 0.0 0.0 116-117 3.6125 0.0 0.0 0.0 0.0 118-119 4.0125 0.0 0.0 0.0 0.0 120-121 4.6875 0.0 0.0 0.0 0.0 122-123 5.0625 0.0 0.0 0.0 0.0 124-125 5.4 0.0 0.0 0.0 0.0 126-127 5.9125 0.0 0.0 0.0 0.0 128-129 6.5875 0.0 0.0 0.0 0.0 130-131 7.137499999999999 0.0 0.0 0.0 0.0 132-133 7.8 0.0 0.0 0.0 0.0 134-135 8.525 0.0 0.0 0.0 0.0 136-137 9.1625 0.0 0.0 0.0 0.0 138-139 9.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969262 spots for SRR7169770.sra Written 969262 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra Read 969258 spots for SRR7169770.sra Written 969258 spots for SRR7169770.sra SRR ids: ['SRR7169770.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xaye7q7y SRR7169770.sra spots: 19385164 blocks: [[1, 969258], [969259, 1938516], [1938517, 2907774], [2907775, 3877032], [3877033, 4846290], [4846291, 5815548], [5815549, 6784806], [6784807, 7754064], [7754065, 8723322], [8723323, 9692580], [9692581, 10661838], [10661839, 11631096], [11631097, 12600354], [12600355, 13569612], [13569613, 14538870], [14538871, 15508128], [15508129, 16477386], [16477387, 17446644], [17446645, 18415902], [18415903, 19385164]] SRR7169770 file size 6547295 SRR7169770 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169770 SRR7169770_1.fastq SRR7169770_2.fastq Input file: SRR7169770_1.fastq Paired file: SRR7169770_2.fastq trimmed: SRR7169770-trimmed-pair1.fastq, SRR7169770-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:24:58 2025 >> started Tue Feb 11 15:25:20 2025 >> done (22.267s) 19385164 read pairs processed; of these: 17928 ( 0.09%) short read pairs filtered out after trimming by size control 21533 ( 0.11%) empty read pairs filtered out after trimming by size control 19345703 (99.80%) read pairs available; of these: 9738095 (50.34%) trimmed read pairs available after processing 9607608 (49.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 7 0.00% 22 3 0.00% 23 12 0.00% 24 3 0.00% 25 7 0.00% 26 7 0.00% 27 4 0.00% 28 4 0.00% 29 7 0.00% 30 9 0.00% 31 13 0.00% 32 16 0.00% 33 12 0.00% 34 19 0.00% 35 16 0.00% 36 11 0.00% 37 30 0.00% 38 29 0.00% 39 23 0.00% 40 45 0.00% 41 45 0.00% 42 50 0.00% 43 72 0.00% 44 66 0.00% 45 76 0.00% 46 86 0.00% 47 103 0.00% 48 100 0.00% 49 106 0.00% 50 172 0.00% 51 172 0.00% 52 227 0.00% 53 180 0.00% 54 256 0.00% 55 281 0.00% 56 313 0.00% 57 356 0.00% 58 361 0.00% 59 450 0.00% 60 500 0.00% 61 591 0.00% 62 687 0.00% 63 830 0.00% 64 943 0.00% 65 953 0.00% 66 1054 0.01% 67 1205 0.01% 68 1353 0.01% 69 1568 0.01% 70 1750 0.01% 71 2068 0.01% 72 2485 0.01% 73 2891 0.01% 74 3018 0.02% 75 3556 0.02% 76 4038 0.02% 77 4204 0.02% 78 4443 0.02% 79 5150 0.03% 80 5665 0.03% 81 6444 0.03% 82 7422 0.04% 83 8409 0.04% 84 10004 0.05% 85 11327 0.06% 86 12019 0.06% 87 12649 0.07% 88 13415 0.07% 89 14286 0.07% 90 15255 0.08% 91 16585 0.09% 92 17952 0.09% 93 20114 0.10% 94 21222 0.11% 95 22700 0.12% 96 23864 0.12% 97 24549 0.13% 98 25112 0.13% 99 26318 0.14% 100 27588 0.14% 101 29280 0.15% 102 31382 0.16% 103 33271 0.17% 104 35366 0.18% 105 36945 0.19% 106 38153 0.20% 107 39175 0.20% 108 40082 0.21% 109 41106 0.21% 110 42215 0.22% 111 43954 0.23% 112 45645 0.24% 113 48784 0.25% 114 50379 0.26% 115 52733 0.27% 116 54081 0.28% 117 54643 0.28% 118 55402 0.29% 119 56552 0.29% 120 57183 0.30% 121 58975 0.30% 122 60680 0.31% 123 63186 0.33% 124 66382 0.34% 125 69591 0.36% 126 71438 0.37% 127 73107 0.38% 128 74603 0.39% 129 75949 0.39% 130 76988 0.40% 131 78424 0.41% 132 81695 0.42% 133 84301 0.44% 134 86910 0.45% 135 90757 0.47% 136 95196 0.49% 137 97952 0.51% 138 102024 0.53% 139 106706 0.55% 140 111573 0.58% 141 119856 0.62% 142 129509 0.67% 143 143114 0.74% 144 163602 0.85% 145 193832 1.00% 146 239752 1.24% 147 317526 1.64% 148 452378 2.34% 149 878858 4.54% 150 4196957 21.69% 151 9607608 49.66% 19345703 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=261.14 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=17.9 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=5.90 fanout-score-rank=21 prefix-density=0.30 prefix-fanout=3.9 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.13 sequence-density-rank=10 fanout-score=48.18 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=13.0 sequence=TGTTGGTGGTGG SRR7169770 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:26:12 Started mapping on | Feb 11 15:26:12 Finished on | Feb 11 15:27:57 Mapping speed, Million of reads per hour | 663.28 Number of input reads | 19345703 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 18464687 Uniquely mapped reads % | 95.45% Average mapped length | 290.51 Number of splices: Total | 16816083 Number of splices: Annotated (sjdb) | 16543240 Number of splices: GT/AG | 16577322 Number of splices: GC/AG | 190435 Number of splices: AT/AC | 13414 Number of splices: Non-canonical | 34912 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309671 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 67342 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 588309 588309 588309 N_multimapping 309671 309671 309671 N_noFeature 473767 18229488 590294 N_ambiguous 187232 1014 67820 UnstrandedReadsAssigned:17803688 PositiveStrandReadsAssigned:234185 NegativeStrandReadsAssigned:17806573 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169770 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169770-trimmed-pair1.fastq SRR7169770-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,345,703 reads, 17,712,952 reads pseudoaligned [quant] estimated average fragment length: 214.746 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52401 SRR7169770.ke.tsv 34699 SRR7169770.se.tsv 87100 total ==> SRR7169770.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.25 280 9.42592 Potri.005G024800.1.v4.1 1035 821.254 48 3.54999 Potri.004G059700.1.v4.1 961 747.254 1 0.0812821 Potri.007G009000.2.v4.1 1416 1202.25 0 0 Potri.003G141000.2.v4.1 2943 2729.25 357.128 7.94772 Potri.016G087400.1.v4.1 270 91.4707 1541 1023.26 Potri.015G069301.1.v4.1 564 352.35 0 0 Potri.010G195200.1.v4.1 1773 1559.25 18 0.701163 Potri.012G127500.1.v4.1 977 763.254 5797 461.315 ==> SRR7169770.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1162 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169770 completed mapping pipeline successfully