Starting /dee2/code/volunteer_pipeline.sh SRR7169771 current disk space = 3049494282240 free memory = 1577954968 SRR7169771 SRAfilesize c5cdc773e08b8969a09a90201121b3d8 SRR7169771.sra SRR7169771.sra file validated SRR7169771 is paired end SRR7169771 is conventional basespace SRR7169771 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169771_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.8755 30.0 18.0 33.0 18.0 33.0 2 30.7085 31.0 29.0 33.0 27.0 34.0 3 31.132 33.0 31.0 33.0 29.0 33.0 4 31.411 33.0 31.0 33.0 29.0 33.0 5 32.5915 33.0 33.0 33.0 32.0 34.0 6 36.68 38.0 37.0 38.0 34.0 38.0 7 37.2285 38.0 38.0 38.0 36.0 38.0 8 36.745 38.0 38.0 38.0 35.0 38.0 9 37.37325 38.0 38.0 38.0 37.0 38.0 10-14 37.50695 38.0 38.0 38.0 37.2 38.0 15-19 36.640800000000006 38.0 37.6 38.0 33.8 38.0 20-24 37.599250000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.52485 38.0 38.0 38.0 38.0 38.0 30-34 37.405899999999995 38.0 38.0 38.0 37.2 38.0 35-39 37.34265 38.0 38.0 38.0 37.0 38.0 40-44 37.10085 38.0 38.0 38.0 36.4 38.0 45-49 36.700599999999994 38.0 37.8 38.0 34.6 38.0 50-54 37.363949999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.360200000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.308350000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.275349999999996 38.0 38.0 38.0 36.8 38.0 70-74 37.167399999999994 38.0 38.0 38.0 36.0 38.0 75-79 37.07275 38.0 38.0 38.0 36.0 38.0 80-84 36.988949999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.88415 38.0 38.0 38.0 35.6 38.0 90-94 36.741200000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.6711 38.0 38.0 38.0 34.8 38.0 100-104 36.695100000000004 38.0 38.0 38.0 34.8 38.0 105-109 36.5243 38.0 38.0 38.0 34.2 38.0 110-114 35.82854999999999 38.0 36.8 38.0 31.6 38.0 115-119 35.98055 38.0 37.0 38.0 33.2 38.0 120-124 36.0985 38.0 37.0 38.0 33.2 38.0 125-129 35.77094999999999 38.0 36.4 38.0 31.8 38.0 130-134 35.051300000000005 38.0 35.6 38.0 27.8 38.0 135-139 34.83495 38.0 35.0 38.0 27.2 38.0 140-144 34.7467 38.0 35.0 38.0 27.8 38.0 145-149 34.115750000000006 38.0 35.0 38.0 24.6 38.0 150-151 30.485500000000002 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 3.0 16 2.0 17 2.0 18 0.0 19 2.0 20 3.0 21 4.0 22 2.0 23 5.0 24 10.0 25 12.0 26 19.0 27 14.0 28 21.0 29 15.0 30 26.0 31 55.0 32 64.0 33 120.0 34 169.0 35 324.0 36 871.0 37 2254.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.92651116127414 10.885377476799599 9.405568096313017 40.78254326561324 2 21.6 16.925 32.75 28.725 3 21.297460397284386 20.66884586371637 25.748051294945938 32.28564244405331 4 22.525000000000002 29.049999999999997 21.55 26.875 5 22.375 34.4 23.05 20.175 6 18.4 36.725 24.675 20.200000000000003 7 14.524999999999999 25.275 42.125 18.075 8 18.575 26.375 28.199999999999996 26.85 9 17.2 24.7 34.225 23.875 10-14 19.845 29.7 27.245 23.21 15-19 20.0 29.220000000000002 27.275 23.505000000000003 20-24 19.735 28.610000000000003 27.625 24.03 25-29 19.955000000000002 29.465000000000003 27.200000000000003 23.380000000000003 30-34 20.205000000000002 29.095 27.584999999999997 23.115 35-39 20.055 28.945 27.305 23.695 40-44 20.34 28.970000000000002 27.605 23.085 45-49 19.96 28.675 27.065 24.3 50-54 20.095 28.294999999999998 27.950000000000003 23.66 55-59 19.900000000000002 28.685 27.33 24.085 60-64 20.03 28.38 27.584999999999997 24.005000000000003 65-69 20.549999999999997 28.915000000000003 26.99 23.544999999999998 70-74 20.549999999999997 28.87 27.315 23.265 75-79 20.69 28.225 27.544999999999998 23.54 80-84 20.345 28.315 27.735 23.605 85-89 19.975 29.080000000000002 27.315 23.630000000000003 90-94 20.48 28.845 27.355 23.32 95-99 19.925 28.970000000000002 26.88 24.224999999999998 100-104 21.085 28.444999999999997 27.305 23.165 105-109 20.55747385277486 28.45418605814943 27.173097132562678 23.815242956513035 110-114 21.07 28.345 26.900000000000002 23.685000000000002 115-119 20.915 28.749999999999996 26.58 23.755000000000003 120-124 21.23 28.895 26.450000000000003 23.425 125-129 21.21 28.415000000000003 26.525 23.849999999999998 130-134 21.13 28.99 26.205000000000002 23.674999999999997 135-139 21.2 28.605000000000004 26.085 24.11 140-144 21.445 28.415000000000003 26.340000000000003 23.799999999999997 145-149 21.64 28.775000000000002 25.455 24.13 150-151 20.549999999999997 29.1125 25.637500000000003 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 1.5 24 2.5 25 3.0 26 4.5 27 7.0 28 12.5 29 16.5 30 17.0 31 23.0 32 32.0 33 42.5 34 52.5 35 71.0 36 86.5 37 99.0 38 132.5 39 159.0 40 187.0 41 220.5 42 235.5 43 243.5 44 260.5 45 284.5 46 285.5 47 244.5 48 218.0 49 210.5 50 185.5 51 145.5 52 117.0 53 104.0 54 77.5 55 54.0 56 40.5 57 32.5 58 22.0 59 15.5 60 13.0 61 9.5 62 6.5 63 4.0 64 4.5 65 3.0 66 1.5 67 3.0 68 2.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.575 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.08499999999999999 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.1875 0.0 0.0 0.0 0.0 96-97 1.5125 0.0 0.0 0.0 0.0 98-99 1.725 0.0 0.0 0.0 0.0 100-101 2.0625 0.0 0.0 0.0 0.0 102-103 2.3125 0.0 0.0 0.0 0.0 104-105 2.5 0.0 0.0 0.0 0.0 106-107 2.875 0.0 0.0 0.0 0.0 108-109 3.2125000000000004 0.0 0.0 0.0 0.0 110-111 3.55 0.0 0.0 0.0 0.0 112-113 3.9875 0.0 0.0 0.0 0.0 114-115 4.4125 0.0 0.0 0.0 0.0 116-117 4.9375 0.0 0.0 0.0 0.0 118-119 5.487500000000001 0.0 0.0 0.0 0.0 120-121 6.125 0.0 0.0 0.0 0.0 122-123 6.625 0.0 0.0 0.0 0.0 124-125 7.3375 0.0 0.0 0.0 0.0 126-127 7.8125 0.0 0.0 0.0 0.0 128-129 8.3375 0.0 0.0 0.0 0.0 130-131 8.8625 0.0 0.0 0.0 0.0 132-133 9.525 0.0 0.0 0.0 0.0 134-135 10.375 0.0 0.0 0.0 0.0 136-137 11.1875 0.0 0.0 0.0 0.0 138-139 12.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATGTT 10 0.0068484643 144.875 8 TGTATGT 10 0.0068484643 144.875 7 >>END_MODULE SRR7169771 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169771_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66175 33.0 33.0 34.0 32.0 34.0 2 32.828 33.0 33.0 34.0 32.0 34.0 3 32.815 33.0 33.0 34.0 32.0 34.0 4 32.79625 34.0 33.0 34.0 32.0 34.0 5 32.782 34.0 33.0 34.0 32.0 34.0 6 36.98825 38.0 38.0 38.0 36.0 38.0 7 37.009 38.0 38.0 38.0 36.0 38.0 8 36.94425 38.0 38.0 38.0 36.0 38.0 9 36.92575 38.0 38.0 38.0 36.0 38.0 10-14 36.4632 38.0 37.8 38.0 33.8 38.0 15-19 36.809450000000005 38.0 38.0 38.0 35.8 38.0 20-24 36.6737 38.0 38.0 38.0 35.2 38.0 25-29 36.773250000000004 38.0 38.0 38.0 35.8 38.0 30-34 36.1688 38.0 37.6 38.0 32.8 38.0 35-39 36.64855 38.0 38.0 38.0 35.4 38.0 40-44 35.94825 38.0 37.0 38.0 30.2 38.0 45-49 36.7705 38.0 38.0 38.0 35.8 38.0 50-54 36.39565 38.0 37.6 38.0 33.6 38.0 55-59 36.358999999999995 38.0 37.8 38.0 33.8 38.0 60-64 36.55459999999999 38.0 38.0 38.0 34.6 38.0 65-69 36.206399999999995 38.0 38.0 38.0 33.4 38.0 70-74 36.1309 38.0 38.0 38.0 33.2 38.0 75-79 36.12505 38.0 38.0 38.0 32.8 38.0 80-84 36.001599999999996 38.0 37.4 38.0 32.0 38.0 85-89 36.359300000000005 38.0 38.0 38.0 34.0 38.0 90-94 35.92365 38.0 37.2 38.0 32.2 38.0 95-99 36.018600000000006 38.0 37.8 38.0 33.0 38.0 100-104 35.5735 38.0 37.0 38.0 30.6 38.0 105-109 34.1957 38.0 35.6 38.0 21.2 38.0 110-114 33.470200000000006 38.0 35.0 38.0 18.2 38.0 115-119 33.1531 38.0 35.0 38.0 14.4 38.0 120-124 32.5024 38.0 33.6 38.0 15.4 38.0 125-129 33.394549999999995 38.0 34.0 38.0 17.8 38.0 130-134 33.48285 38.0 33.8 38.0 21.0 38.0 135-139 33.696799999999996 38.0 34.6 38.0 20.6 38.0 140-144 33.45205 38.0 34.0 38.0 18.6 38.0 145-149 32.7746 38.0 33.2 38.0 16.2 38.0 150-151 28.256625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 4.0 5 0.0 6 3.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 4.0 15 4.0 16 9.0 17 9.0 18 9.0 19 11.0 20 10.0 21 16.0 22 11.0 23 10.0 24 25.0 25 23.0 26 28.0 27 39.0 28 49.0 29 56.0 30 84.0 31 116.0 32 134.0 33 145.0 34 216.0 35 355.0 36 699.0 37 1915.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.324999999999996 18.625 15.375 26.674999999999997 2 26.8 25.424999999999997 30.575000000000003 17.2 3 21.530382595648913 28.657164291072768 30.50762690672668 19.30482620655164 4 23.35 33.925 23.799999999999997 18.925 5 23.75 36.175000000000004 21.85 18.224999999999998 6 19.625 36.1 24.2 20.075000000000003 7 20.125 21.175 37.875 20.825 8 22.400000000000002 25.650000000000002 26.974999999999998 24.975 9 22.3 25.05 28.599999999999998 24.05 10-14 23.585 29.195 25.8 21.42 15-19 23.64 27.525 27.41 21.425 20-24 23.26 28.439999999999998 27.284999999999997 21.015 25-29 22.875 28.255000000000003 27.63 21.240000000000002 30-34 22.71 28.175 27.88 21.235 35-39 23.595 27.495000000000005 28.060000000000002 20.849999999999998 40-44 23.355 27.57 27.825 21.25 45-49 23.505000000000003 27.694999999999997 27.939999999999998 20.86 50-54 22.985 28.23 28.075 20.71 55-59 23.05 27.565 28.355000000000004 21.029999999999998 60-64 23.655 26.705000000000002 28.65 20.990000000000002 65-69 24.01 28.03 27.77 20.19 70-74 24.189663823381835 27.67185148018063 28.098344204716508 20.040140491721022 75-79 23.745367124110988 27.702093559050383 28.318140839427024 20.2343984774116 80-84 23.65854878231735 27.614142121318196 28.27924188628294 20.44806721008151 85-89 24.125 27.495000000000005 27.685 20.695 90-94 23.435 27.51 28.32 20.735 95-99 23.84 28.07 28.299999999999997 19.79 100-104 23.88126939633597 27.680448493342674 28.3411752928221 20.09710681749925 105-109 23.89122196046297 27.942230871658303 27.619584144217967 20.546963023660762 110-114 24.371019939450882 27.502870863346907 27.878692974214424 20.247416222987784 115-119 24.729636140855575 26.935165947472168 27.760907783282722 20.574290128389535 120-124 24.97896065642752 27.33536713654534 27.230170418682935 20.455501788344204 125-129 25.745105055978733 27.820663565257398 26.977148407545627 19.457082971218238 130-134 25.219089588862737 27.83314136912214 26.82157343883019 20.12619560318494 135-139 24.79 27.26 27.700000000000003 20.25 140-144 25.430000000000003 28.365000000000002 27.025 19.18 145-149 25.590000000000003 27.805000000000003 26.745 19.86 150-151 26.1625 25.937500000000004 28.000000000000004 19.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 1.5 26 3.5 27 5.0 28 6.0 29 6.0 30 12.0 31 18.0 32 27.5 33 37.0 34 46.0 35 55.5 36 66.0 37 99.0 38 136.5 39 155.0 40 183.5 41 222.0 42 249.0 43 280.5 44 293.0 45 285.5 46 273.0 47 261.0 48 244.5 49 218.5 50 180.5 51 138.0 52 120.0 53 98.0 54 72.0 55 53.5 56 35.0 57 30.0 58 24.5 59 15.5 60 12.0 61 9.5 62 7.5 63 5.0 64 2.5 65 1.0 66 1.5 67 2.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.35000000000000003 75-79 0.16999999999999998 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.11 105-109 2.37 110-114 4.21 115-119 6.145 120-124 4.9399999999999995 125-129 2.1950000000000003 130-134 0.155 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.65 0.0 0.0 0.0 0.0 100-101 1.9625 0.0 0.0 0.0 0.0 102-103 2.2125 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.7375 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.3125 0.0 0.0 0.0 0.0 112-113 3.6875 0.0 0.0 0.0 0.0 114-115 4.050000000000001 0.0 0.0 0.0 0.0 116-117 4.5875 0.0 0.0 0.0 0.0 118-119 5.137499999999999 0.0 0.0 0.0 0.0 120-121 5.75 0.0 0.0 0.0 0.0 122-123 6.225 0.0 0.0 0.0 0.0 124-125 6.95 0.0 0.0 0.0 0.0 126-127 7.4375 0.0 0.0 0.0 0.0 128-129 7.925 0.0 0.0 0.0 0.0 130-131 8.425 0.0 0.0 0.0 0.0 132-133 9.0625 0.0 0.0 0.0 0.0 134-135 9.899999999999999 0.0 0.0 0.0 0.0 136-137 10.725000000000001 0.0 0.0 0.0 0.0 138-139 11.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775360 spots for SRR7169771.sra Written 775360 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra Read 775344 spots for SRR7169771.sra Written 775344 spots for SRR7169771.sra SRR ids: ['SRR7169771.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mqe2pkm_ SRR7169771.sra spots: 15506896 blocks: [[1, 775344], [775345, 1550688], [1550689, 2326032], [2326033, 3101376], [3101377, 3876720], [3876721, 4652064], [4652065, 5427408], [5427409, 6202752], [6202753, 6978096], [6978097, 7753440], [7753441, 8528784], [8528785, 9304128], [9304129, 10079472], [10079473, 10854816], [10854817, 11630160], [11630161, 12405504], [12405505, 13180848], [13180849, 13956192], [13956193, 14731536], [14731537, 15506896]] SRR7169771 file size 5233077 SRR7169771 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169771 SRR7169771_1.fastq SRR7169771_2.fastq Input file: SRR7169771_1.fastq Paired file: SRR7169771_2.fastq trimmed: SRR7169771-trimmed-pair1.fastq, SRR7169771-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:52:25 2025 >> started Tue Feb 11 15:52:42 2025 >> done (17.106s) 15506896 read pairs processed; of these: 14982 ( 0.10%) short read pairs filtered out after trimming by size control 21019 ( 0.14%) empty read pairs filtered out after trimming by size control 15470895 (99.77%) read pairs available; of these: 7937601 (51.31%) trimmed read pairs available after processing 7533294 (48.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 5 0.00% 23 3 0.00% 24 5 0.00% 25 8 0.00% 26 3 0.00% 27 4 0.00% 28 10 0.00% 29 14 0.00% 30 10 0.00% 31 16 0.00% 32 20 0.00% 33 22 0.00% 34 19 0.00% 35 26 0.00% 36 23 0.00% 37 33 0.00% 38 36 0.00% 39 60 0.00% 40 66 0.00% 41 79 0.00% 42 86 0.00% 43 85 0.00% 44 82 0.00% 45 94 0.00% 46 129 0.00% 47 136 0.00% 48 154 0.00% 49 187 0.00% 50 215 0.00% 51 261 0.00% 52 261 0.00% 53 331 0.00% 54 332 0.00% 55 335 0.00% 56 421 0.00% 57 488 0.00% 58 512 0.00% 59 616 0.00% 60 697 0.00% 61 816 0.01% 62 980 0.01% 63 1075 0.01% 64 1202 0.01% 65 1282 0.01% 66 1361 0.01% 67 1466 0.01% 68 1691 0.01% 69 1977 0.01% 70 2225 0.01% 71 2503 0.02% 72 2963 0.02% 73 3364 0.02% 74 3668 0.02% 75 4011 0.03% 76 4851 0.03% 77 4924 0.03% 78 5108 0.03% 79 5652 0.04% 80 6136 0.04% 81 6984 0.05% 82 7926 0.05% 83 8878 0.06% 84 10349 0.07% 85 11317 0.07% 86 12194 0.08% 87 12805 0.08% 88 13680 0.09% 89 14289 0.09% 90 15208 0.10% 91 16111 0.10% 92 17715 0.11% 93 19421 0.13% 94 20430 0.13% 95 21697 0.14% 96 22773 0.15% 97 23149 0.15% 98 23875 0.15% 99 24977 0.16% 100 26277 0.17% 101 27127 0.18% 102 29297 0.19% 103 30683 0.20% 104 32347 0.21% 105 33831 0.22% 106 35178 0.23% 107 35447 0.23% 108 36110 0.23% 109 36544 0.24% 110 37887 0.24% 111 38986 0.25% 112 40726 0.26% 113 42541 0.27% 114 43694 0.28% 115 46117 0.30% 116 47058 0.30% 117 48536 0.31% 118 48645 0.31% 119 48737 0.32% 120 49708 0.32% 121 51450 0.33% 122 52603 0.34% 123 54850 0.35% 124 57390 0.37% 125 59564 0.39% 126 60781 0.39% 127 62548 0.40% 128 63401 0.41% 129 64870 0.42% 130 65901 0.43% 131 67462 0.44% 132 69568 0.45% 133 71554 0.46% 134 73605 0.48% 135 76554 0.49% 136 79854 0.52% 137 82445 0.53% 138 85426 0.55% 139 89745 0.58% 140 93396 0.60% 141 100584 0.65% 142 108458 0.70% 143 119121 0.77% 144 136063 0.88% 145 159629 1.03% 146 195816 1.27% 147 256010 1.65% 148 359727 2.33% 149 684802 4.43% 150 3252022 21.02% 151 7533294 48.69% 15470895 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=217.21 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=26.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=33 prefix-density=0.27 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=141.95 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=13.8 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169771 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:53:25 Started mapping on | Feb 11 15:53:26 Finished on | Feb 11 15:54:38 Mapping speed, Million of reads per hour | 773.54 Number of input reads | 15470895 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14795956 Uniquely mapped reads % | 95.64% Average mapped length | 289.08 Number of splices: Total | 13204209 Number of splices: Annotated (sjdb) | 12974570 Number of splices: GT/AG | 13011319 Number of splices: GC/AG | 151641 Number of splices: AT/AC | 10875 Number of splices: Non-canonical | 30374 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 288501 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 26287 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.29% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 400169 400169 400169 N_multimapping 288501 288501 288501 N_noFeature 397522 14627942 475756 N_ambiguous 145037 864 54656 UnstrandedReadsAssigned:14253397 PositiveStrandReadsAssigned:167150 NegativeStrandReadsAssigned:14265544 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169771 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169771-trimmed-pair1.fastq SRR7169771-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,470,895 reads, 14,210,139 reads pseudoaligned [quant] estimated average fragment length: 211.7 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7169771.ke.tsv 34699 SRR7169771.se.tsv 87100 total ==> SRR7169771.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.3 235 9.901 Potri.005G024800.1.v4.1 1035 824.3 13 1.20088 Potri.004G059700.1.v4.1 961 750.322 0 0 Potri.007G009000.2.v4.1 1416 1205.3 0 0 Potri.003G141000.2.v4.1 2943 2732.3 269.067 7.49849 Potri.016G087400.1.v4.1 270 93.736 1288 1046.29 Potri.015G069301.1.v4.1 564 355.355 0 0 Potri.010G195200.1.v4.1 1773 1562.3 39 1.90082 Potri.012G127500.1.v4.1 977 766.305 5646 561.023 ==> SRR7169771.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1672 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 298 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169771 completed mapping pipeline successfully