Starting /dee2/code/volunteer_pipeline.sh SRR7169772 current disk space = 3050080002048 free memory = 1412341244 SRR7169772 SRAfilesize 3a1bba305de5bd6c37248fc085513b10 SRR7169772.sra SRR7169772.sra file validated SRR7169772 is paired end SRR7169772 is conventional basespace SRR7169772 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169772_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.873 33.0 31.0 33.0 25.0 34.0 2 32.157 33.0 31.0 33.0 29.0 34.0 3 32.727 33.0 33.0 34.0 31.0 34.0 4 32.6225 33.0 33.0 34.0 31.0 34.0 5 33.15675 33.0 33.0 34.0 33.0 34.0 6 37.21725 38.0 37.0 38.0 36.0 38.0 7 37.536 38.0 38.0 38.0 37.0 38.0 8 37.6885 38.0 38.0 38.0 38.0 38.0 9 37.65525 38.0 38.0 38.0 38.0 38.0 10-14 37.710300000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.7241 38.0 38.0 38.0 38.0 38.0 20-24 37.72965 38.0 38.0 38.0 38.0 38.0 25-29 37.6978 38.0 38.0 38.0 38.0 38.0 30-34 37.69695 38.0 38.0 38.0 38.0 38.0 35-39 37.71205 38.0 38.0 38.0 38.0 38.0 40-44 37.59045 38.0 38.0 38.0 38.0 38.0 45-49 37.6225 38.0 38.0 38.0 38.0 38.0 50-54 37.485299999999995 38.0 38.0 38.0 38.0 38.0 55-59 37.534749999999995 38.0 38.0 38.0 38.0 38.0 60-64 37.38125 38.0 38.0 38.0 37.6 38.0 65-69 37.391799999999996 38.0 38.0 38.0 37.4 38.0 70-74 37.4259 38.0 38.0 38.0 37.2 38.0 75-79 37.14835 38.0 38.0 38.0 37.0 38.0 80-84 37.11345 38.0 38.0 38.0 37.0 38.0 85-89 36.986650000000004 38.0 38.0 38.0 36.6 38.0 90-94 36.845549999999996 38.0 38.0 38.0 35.8 38.0 95-99 36.887049999999995 38.0 38.0 38.0 36.0 38.0 100-104 36.6755 38.0 38.0 38.0 35.8 38.0 105-109 35.9236 38.0 38.0 38.0 34.2 38.0 110-114 35.93305 38.0 38.0 38.0 34.0 38.0 115-119 36.40475 38.0 38.0 38.0 34.4 38.0 120-124 36.459450000000004 38.0 38.0 38.0 34.8 38.0 125-129 36.29145 38.0 38.0 38.0 34.0 38.0 130-134 36.05625 38.0 38.0 38.0 33.8 38.0 135-139 35.769400000000005 38.0 36.8 38.0 33.0 38.0 140-144 35.40735 38.0 36.0 38.0 31.6 38.0 145-149 35.1404 38.0 36.0 38.0 31.4 38.0 150-151 31.524125 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 6.0 19 21.0 20 8.0 21 2.0 22 3.0 23 3.0 24 2.0 25 8.0 26 7.0 27 9.0 28 14.0 29 23.0 30 12.0 31 41.0 32 40.0 33 64.0 34 116.0 35 206.0 36 448.0 37 2963.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.05541561712846 10.554156171284635 7.83375314861461 37.556675062972296 2 22.675 15.9 32.375 29.049999999999997 3 20.075000000000003 20.474999999999998 26.75 32.7 4 22.961480740370185 27.688844422211105 23.411705852926463 25.937968984492244 5 23.825 32.824999999999996 22.900000000000002 20.45 6 19.625 34.849999999999994 24.3 21.224999999999998 7 14.475 26.224999999999998 42.525 16.775000000000002 8 18.35 26.5 30.599999999999998 24.55 9 17.424999999999997 23.150000000000002 34.4 25.025 10-14 19.91 29.81 26.72 23.56 15-19 19.895 28.720000000000002 27.785 23.599999999999998 20-24 20.0 28.71 27.32 23.97 25-29 20.125 28.9 27.560000000000002 23.415 30-34 19.634999999999998 28.64 27.85 23.875 35-39 19.655 28.975 28.044999999999998 23.325000000000003 40-44 19.67 28.77 27.55 24.01 45-49 20.064999999999998 28.665000000000003 27.634999999999998 23.635 50-54 20.09 28.055000000000003 27.994999999999997 23.86 55-59 20.355 28.89 26.955000000000002 23.799999999999997 60-64 20.656428786510087 28.25454180467731 27.66235069758105 23.426678711231556 65-69 19.77 28.575 27.82 23.835 70-74 20.169999999999998 29.065 27.485 23.28 75-79 20.97 29.24 26.945000000000004 22.845 80-84 20.07 28.515 27.33 24.085 85-89 20.41 28.53 27.705000000000002 23.355 90-94 20.080000000000002 28.599999999999998 27.54 23.78 95-99 20.735 28.17 28.03 23.064999999999998 100-104 20.795260568330153 28.747866251631688 27.36218495832915 23.094688221709006 105-109 20.471837818516057 28.963897257825664 27.2123780830312 23.351886840627074 110-114 20.167082675360398 29.142682491976974 27.42091589832408 23.269318934338546 115-119 20.71 28.405 27.525 23.36 120-124 20.669999999999998 28.655 26.735 23.94 125-129 20.68 29.375 26.810000000000002 23.135 130-134 20.73 29.015 26.38 23.875 135-139 20.89 28.689999999999998 26.63 23.79 140-144 20.7 28.470000000000002 26.450000000000003 24.38 145-149 21.075 28.24 26.56 24.125 150-151 20.2875 29.15 26.025 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 0.5 25 0.0 26 3.5 27 6.5 28 7.5 29 11.5 30 18.0 31 28.0 32 33.5 33 42.0 34 55.0 35 72.0 36 81.0 37 99.0 38 134.5 39 165.0 40 202.5 41 218.5 42 226.5 43 261.5 44 260.5 45 266.5 46 282.0 47 263.0 48 246.0 49 214.0 50 175.0 51 135.5 52 109.5 53 93.5 54 69.5 55 58.5 56 50.0 57 27.0 58 18.5 59 18.0 60 11.0 61 5.5 62 2.5 63 5.0 64 6.0 65 3.0 66 2.0 67 1.0 68 1.5 69 2.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.37 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.41000000000000003 105-109 2.085 110-114 1.8450000000000002 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44374209860936 98.32499999999999 2 0.5309734513274336 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025284450063211124 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 25 0.625 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.2125 0.0 0.0 0.0 0.0 92-93 1.4875 0.0 0.0 0.0 0.0 94-95 1.85 0.0 0.0 0.0 0.0 96-97 2.1125 0.0 0.0 0.0 0.0 98-99 2.3625 0.0 0.0 0.0 0.0 100-101 2.8 0.0 0.0 0.0 0.0 102-103 3.05 0.0 0.0 0.0 0.0 104-105 3.4875 0.0 0.0 0.0 0.0 106-107 3.9625000000000004 0.0 0.0 0.0 0.0 108-109 4.25 0.0 0.0 0.0 0.0 110-111 4.6375 0.0 0.0 0.0 0.0 112-113 5.15 0.0 0.0 0.0 0.0 114-115 5.699999999999999 0.0 0.0 0.0 0.0 116-117 6.375 0.0 0.0 0.0 0.0 118-119 6.9625 0.0 0.0 0.0 0.0 120-121 7.6 0.0 0.0 0.0 0.0 122-123 8.125 0.0 0.0 0.0 0.0 124-125 8.6375 0.0 0.0 0.0 0.0 126-127 9.4375 0.0 0.0 0.0 0.0 128-129 10.287500000000001 0.0 0.0 0.0 0.0 130-131 11.1 0.0 0.0 0.0 0.0 132-133 11.8 0.0 0.0 0.0 0.0 134-135 12.3375 0.0 0.0 0.0 0.0 136-137 13.175 0.0 0.0 0.0 0.0 138-139 14.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCATT 10 0.006973645 144.0 4 TTCTGGT 10 0.006973645 144.0 7 >>END_MODULE SRR7169772 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169772_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.222 34.0 33.0 34.0 33.0 34.0 2 33.23175 34.0 33.0 34.0 33.0 34.0 3 33.32925 34.0 33.0 34.0 33.0 34.0 4 33.194 34.0 33.0 34.0 33.0 34.0 5 33.21625 34.0 33.0 34.0 33.0 34.0 6 37.4545 38.0 38.0 38.0 38.0 38.0 7 37.546 38.0 38.0 38.0 38.0 38.0 8 37.53225 38.0 38.0 38.0 38.0 38.0 9 37.56125 38.0 38.0 38.0 38.0 38.0 10-14 37.510650000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.5153 38.0 38.0 38.0 38.0 38.0 20-24 37.461400000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.43925 38.0 38.0 38.0 38.0 38.0 30-34 37.4286 38.0 38.0 38.0 38.0 38.0 35-39 37.3728 38.0 38.0 38.0 38.0 38.0 40-44 37.397850000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.35455 38.0 38.0 38.0 38.0 38.0 50-54 37.298649999999995 38.0 38.0 38.0 37.2 38.0 55-59 37.1996 38.0 38.0 38.0 37.2 38.0 60-64 36.603449999999995 38.0 37.8 38.0 34.2 38.0 65-69 37.3214 38.0 38.0 38.0 37.2 38.0 70-74 36.739850000000004 38.0 38.0 38.0 36.8 38.0 75-79 35.023999999999994 38.0 38.0 38.0 31.0 38.0 80-84 36.02525000000001 38.0 38.0 38.0 32.6 38.0 85-89 36.8753 38.0 38.0 38.0 36.6 38.0 90-94 36.82165 38.0 38.0 38.0 36.8 38.0 95-99 36.728300000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.36135 38.0 38.0 38.0 35.2 38.0 105-109 33.86375 38.0 37.8 38.0 14.6 38.0 110-114 31.7357 38.0 36.0 38.0 2.0 38.0 115-119 30.526699999999998 38.0 34.0 38.0 2.0 38.0 120-124 30.93445 38.0 33.6 38.0 2.0 38.0 125-129 32.1273 38.0 34.8 38.0 2.0 38.0 130-134 34.2598 38.0 36.0 38.0 25.0 38.0 135-139 34.9011 38.0 36.2 38.0 30.6 38.0 140-144 34.161500000000004 38.0 35.6 38.0 24.8 38.0 145-149 34.0856 38.0 35.6 38.0 26.0 38.0 150-151 30.132875 35.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 0.0 5 0.0 6 1.0 7 0.0 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 3.0 15 4.0 16 3.0 17 5.0 18 11.0 19 13.0 20 25.0 21 8.0 22 18.0 23 43.0 24 22.0 25 10.0 26 14.0 27 48.0 28 43.0 29 79.0 30 77.0 31 86.0 32 105.0 33 135.0 34 155.0 35 207.0 36 380.0 37 2495.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.5207603801901 20.535267633816908 11.805902951475739 26.138069034517258 2 27.698472326571498 25.820185324317556 30.60355622339093 15.877786125720009 3 19.929982495623904 27.70692673168292 32.63315828957239 19.72993248312078 4 23.486743371685844 34.06703351675838 23.186593296648326 19.259629814907452 5 24.88122030507627 37.634408602150536 20.05501375343836 17.429357339334832 6 20.4 38.4 24.099999999999998 17.1 7 19.5 21.725 39.675 19.1 8 21.975 26.150000000000002 27.200000000000003 24.675 9 22.5 24.95 29.275000000000002 23.275000000000002 10-14 23.105 28.965000000000003 26.25 21.68 15-19 23.29 27.884999999999998 28.225 20.599999999999998 20-24 23.337333733373335 28.457845784578456 27.642764276427645 20.562056205620564 25-29 23.090772693173292 28.18704676169042 27.85696424106027 20.86521630407602 30-34 22.504500900180034 28.470694138827767 28.265653130626124 20.759151830366072 35-39 22.74523535591016 27.497373818218197 28.63788704917213 21.119503776699514 40-44 23.25697709312794 28.26848054416325 27.838351505451637 20.636190857257176 45-49 22.459491898379678 27.91058211642328 28.280656131226245 21.349269853970796 50-54 22.97114855742787 28.281414070703537 27.9813990699535 20.766038301915096 55-59 23.268143850347624 27.649677387085482 27.799729905466915 21.282448857099983 60-64 23.255 28.060000000000002 28.060000000000002 20.625 65-69 23.12615630781539 27.806390319515977 28.676433821691084 20.39101955097755 70-74 22.685114793979018 29.065936850641123 27.423850793168107 20.82509756221175 75-79 22.997553451760453 28.316136581214764 28.369322412509305 20.316987554515478 80-84 22.871503274610347 28.43072549119155 28.25811037213789 20.43966086206021 85-89 23.452035610683204 27.843353005901772 28.383515054516355 20.32109632889867 90-94 23.3485022753413 28.63929589438416 27.73916087413112 20.273040956143422 95-99 23.705000000000002 28.444999999999997 27.615000000000002 20.235 100-104 24.29168134467314 28.01570127321222 27.643299280358313 20.049318101756327 105-109 24.467454025777922 27.77328371892358 27.460497222671627 20.298765032626868 110-114 24.849884526558892 27.742494226327945 27.44803695150115 19.95958429561201 115-119 24.983551647825827 28.566301812309348 25.922603026496798 20.527543513368023 120-124 24.531259070064433 28.002554130144542 27.497532942474024 19.968653857317005 125-129 25.06279653921295 27.943064471113594 27.356963438459392 19.637175551214067 130-134 25.660262584275355 27.9261925280073 26.92756121052365 19.485983677193694 135-139 25.915 27.975 27.034999999999997 19.075 140-144 26.080216043208644 27.345469093818764 26.710342068413684 19.86397279455891 145-149 26.671333566678335 27.771388569428474 26.541327066353315 19.015950797539876 150-151 27.375940808776626 26.827401454267125 27.12080622528384 18.675851511672406 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 3.0 22 2.5 23 0.0 24 0.5 25 2.0 26 5.5 27 10.5 28 11.0 29 12.0 30 15.0 31 19.5 32 25.5 33 42.5 34 55.5 35 65.5 36 90.0 37 114.5 38 131.5 39 169.0 40 209.0 41 230.0 42 260.5 43 277.5 44 297.0 45 309.0 46 269.5 47 236.5 48 228.5 49 210.0 50 176.0 51 136.5 52 107.0 53 79.5 54 57.0 55 41.5 56 28.5 57 19.0 58 13.5 59 12.0 60 10.0 61 6.0 62 3.5 63 2.0 64 1.0 65 0.5 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.17500000000000002 3 0.025 4 0.05 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.025 30-34 0.02 35-39 0.045 40-44 0.03 45-49 0.02 50-54 0.005 55-59 0.034999999999999996 60-64 0.0 65-69 0.005 70-74 1.345 75-79 5.99 80-84 1.5150000000000001 85-89 0.03 90-94 0.015 95-99 0.0 100-104 0.645 105-109 7.285 110-114 13.4 115-119 16.405 120-124 13.865 125-129 10.424999999999999 130-134 1.365 135-139 0.0 140-144 0.02 145-149 0.005 150-151 2.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.56994687579054 98.4 2 0.35416139640779154 0.7000000000000001 3 0.0 0.0 4 0.05059448520111307 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025297242600556536 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 28 0.7000000000000001 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.2375 0.0 0.0 0.0 0.0 92-93 1.5125 0.0 0.0 0.0 0.0 94-95 1.8625 0.0 0.0 0.0 0.0 96-97 2.05 0.0 0.0 0.0 0.0 98-99 2.3125 0.0 0.0 0.0 0.0 100-101 2.7 0.0 0.0 0.0 0.0 102-103 2.9000000000000004 0.0 0.0 0.0 0.0 104-105 3.2375 0.0 0.0 0.0 0.0 106-107 3.6375 0.0 0.0 0.0 0.0 108-109 3.8499999999999996 0.0 0.0 0.0 0.0 110-111 4.1625 0.0 0.0 0.0 0.0 112-113 4.55 0.0 0.0 0.0 0.0 114-115 5.0125 0.0 0.0 0.0 0.0 116-117 5.6 0.0 0.0 0.0 0.0 118-119 6.075 0.0 0.0 0.0 0.0 120-121 6.525 0.0 0.0 0.0 0.0 122-123 6.949999999999999 0.0 0.0 0.0 0.0 124-125 7.425 0.0 0.0 0.0 0.0 126-127 8.1375 0.0 0.0 0.0 0.0 128-129 8.9 0.0 0.0 0.0 0.0 130-131 9.5875 0.0 0.0 0.0 0.0 132-133 10.25 0.0 0.0 0.0 0.0 134-135 10.774999999999999 0.0 0.0 0.0 0.0 136-137 11.6625 0.0 0.0 0.0 0.0 138-139 12.600000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGCCA 10 0.007711339 139.2375 4 >>END_MODULE Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212439 spots for SRR7169772.sra Written 1212439 spots for SRR7169772.sra Read 1212451 spots for SRR7169772.sra Written 1212451 spots for SRR7169772.sra SRR ids: ['SRR7169772.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t34hiftt SRR7169772.sra spots: 24248792 blocks: [[1, 1212439], [1212440, 2424878], [2424879, 3637317], [3637318, 4849756], [4849757, 6062195], [6062196, 7274634], [7274635, 8487073], [8487074, 9699512], [9699513, 10911951], [10911952, 12124390], [12124391, 13336829], [13336830, 14549268], [14549269, 15761707], [15761708, 16974146], [16974147, 18186585], [18186586, 19399024], [19399025, 20611463], [20611464, 21823902], [21823903, 23036341], [23036342, 24248792]] SRR7169772 file size 8195419 SRR7169772 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169772 SRR7169772_1.fastq SRR7169772_2.fastq Input file: SRR7169772_1.fastq Paired file: SRR7169772_2.fastq trimmed: SRR7169772-trimmed-pair1.fastq, SRR7169772-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:14:41 2025 >> started Tue Feb 11 14:15:08 2025 >> done (27.123s) 24248792 read pairs processed; of these: 15684 ( 0.06%) short read pairs filtered out after trimming by size control 185464 ( 0.76%) empty read pairs filtered out after trimming by size control 24047644 (99.17%) read pairs available; of these: 11621845 (48.33%) trimmed read pairs available after processing 12425799 (51.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 4 0.00% 21 12 0.00% 22 10 0.00% 23 11 0.00% 24 6 0.00% 25 8 0.00% 26 9 0.00% 27 12 0.00% 28 7 0.00% 29 14 0.00% 30 14 0.00% 31 14 0.00% 32 25 0.00% 33 19 0.00% 34 33 0.00% 35 22 0.00% 36 27 0.00% 37 51 0.00% 38 41 0.00% 39 58 0.00% 40 86 0.00% 41 94 0.00% 42 120 0.00% 43 116 0.00% 44 114 0.00% 45 154 0.00% 46 184 0.00% 47 217 0.00% 48 228 0.00% 49 314 0.00% 50 363 0.00% 51 370 0.00% 52 429 0.00% 53 546 0.00% 54 498 0.00% 55 600 0.00% 56 662 0.00% 57 803 0.00% 58 844 0.00% 59 1023 0.00% 60 1271 0.01% 61 1399 0.01% 62 1753 0.01% 63 1923 0.01% 64 2068 0.01% 65 2295 0.01% 66 2500 0.01% 67 2896 0.01% 68 3176 0.01% 69 3690 0.02% 70 4279 0.02% 71 4854 0.02% 72 5853 0.02% 73 6647 0.03% 74 7186 0.03% 75 8034 0.03% 76 8960 0.04% 77 9861 0.04% 78 10504 0.04% 79 11567 0.05% 80 12568 0.05% 81 14356 0.06% 82 15844 0.07% 83 17618 0.07% 84 20117 0.08% 85 22206 0.09% 86 23048 0.10% 87 24660 0.10% 88 26284 0.11% 89 27019 0.11% 90 29171 0.12% 91 31536 0.13% 92 33774 0.14% 93 36232 0.15% 94 38795 0.16% 95 41137 0.17% 96 42812 0.18% 97 44154 0.18% 98 44934 0.19% 99 46922 0.20% 100 48293 0.20% 101 50597 0.21% 102 53087 0.22% 103 55517 0.23% 104 58210 0.24% 105 60765 0.25% 106 63254 0.26% 107 63784 0.27% 108 65087 0.27% 109 66612 0.28% 110 67501 0.28% 111 69104 0.29% 112 72009 0.30% 113 73732 0.31% 114 76522 0.32% 115 79555 0.33% 116 81356 0.34% 117 82775 0.34% 118 83417 0.35% 119 83489 0.35% 120 84905 0.35% 121 86123 0.36% 122 87968 0.37% 123 90738 0.38% 124 93574 0.39% 125 95831 0.40% 126 99075 0.41% 127 100768 0.42% 128 102000 0.42% 129 102729 0.43% 130 104092 0.43% 131 104315 0.43% 132 106351 0.44% 133 108773 0.45% 134 111237 0.46% 135 114958 0.48% 136 118550 0.49% 137 121650 0.51% 138 125701 0.52% 139 129492 0.54% 140 134199 0.56% 141 140348 0.58% 142 148074 0.62% 143 155941 0.65% 144 173500 0.72% 145 190508 0.79% 146 223318 0.93% 147 284064 1.18% 148 407288 1.69% 149 824653 3.43% 150 4794378 19.94% 151 12425799 51.67% 24047644 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=12.96 fanout-score-rank=11 prefix-density=0.30 prefix-fanout=6.8 sequence=CAACCTCAACAGTGGCCATTGGAACTAGAAGGAAAATAAAGCACAGCTGGGATACAAAAGAAAACTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=279.58 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=29.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=36 prefix-density=0.36 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=317.56 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=29.7 sequence=AAGAAGAAGAAG SRR7169772 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:15:51 Started mapping on | Feb 11 14:15:51 Finished on | Feb 11 14:17:45 Mapping speed, Million of reads per hour | 759.40 Number of input reads | 24047644 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 23169407 Uniquely mapped reads % | 96.35% Average mapped length | 288.13 Number of splices: Total | 21522912 Number of splices: Annotated (sjdb) | 21168501 Number of splices: GT/AG | 21194917 Number of splices: GC/AG | 260060 Number of splices: AT/AC | 18920 Number of splices: Non-canonical | 49015 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 401286 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 39559 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.78% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 491414 491414 491414 N_multimapping 401286 401286 401286 N_noFeature 626026 22844214 836214 N_ambiguous 202955 1532 86711 UnstrandedReadsAssigned:22340426 PositiveStrandReadsAssigned:323661 NegativeStrandReadsAssigned:22246482 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169772 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169772-trimmed-pair1.fastq SRR7169772-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,047,644 reads, 22,102,147 reads pseudoaligned [quant] estimated average fragment length: 208.331 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7169772.ke.tsv 34699 SRR7169772.se.tsv 87100 total ==> SRR7169772.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.67 399 11.1454 Potri.005G024800.1.v4.1 1035 827.669 55 3.361 Potri.004G059700.1.v4.1 961 753.695 4 0.268428 Potri.007G009000.2.v4.1 1416 1208.67 0 0 Potri.003G141000.2.v4.1 2943 2735.67 477.035 8.81962 Potri.016G087400.1.v4.1 270 97.8681 1766.87 913.117 Potri.015G069301.1.v4.1 564 359.646 0 0 Potri.010G195200.1.v4.1 1773 1565.67 63 2.03518 Potri.012G127500.1.v4.1 977 769.676 11628 764.117 ==> SRR7169772.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1530 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 463 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169772 completed mapping pipeline successfully