Starting /dee2/code/volunteer_pipeline.sh SRR7169773 current disk space = 3049886351360 free memory = 1487765828 SRR7169773 SRAfilesize a0c627b61b66dccb0c5e6937f0921bbc SRR7169773.sra SRR7169773.sra file validated SRR7169773 is paired end SRR7169773 is conventional basespace SRR7169773 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169773_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.62075 32.0 30.0 33.0 18.0 33.0 2 32.18475 33.0 33.0 33.0 30.0 33.0 3 32.50275 33.0 33.0 33.0 31.0 34.0 4 32.62825 33.0 33.0 34.0 31.0 34.0 5 33.1035 34.0 33.0 34.0 32.0 34.0 6 36.9915 38.0 37.0 38.0 36.0 38.0 7 37.23175 38.0 38.0 38.0 36.0 38.0 8 37.4455 38.0 38.0 38.0 37.0 38.0 9 37.60075 38.0 38.0 38.0 38.0 38.0 10-14 37.572900000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.579750000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.56935 38.0 38.0 38.0 38.0 38.0 25-29 37.5801 38.0 38.0 38.0 38.0 38.0 30-34 37.5527 38.0 38.0 38.0 38.0 38.0 35-39 37.4756 38.0 38.0 38.0 37.8 38.0 40-44 37.513400000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.40685 38.0 38.0 38.0 37.4 38.0 50-54 37.413700000000006 38.0 38.0 38.0 37.2 38.0 55-59 37.362199999999994 38.0 38.0 38.0 37.0 38.0 60-64 36.82525 38.0 37.8 38.0 35.0 38.0 65-69 37.149950000000004 38.0 38.0 38.0 36.4 38.0 70-74 37.240700000000004 38.0 38.0 38.0 36.8 38.0 75-79 37.2131 38.0 38.0 38.0 36.8 38.0 80-84 37.1201 38.0 38.0 38.0 36.0 38.0 85-89 37.1279 38.0 38.0 38.0 36.0 38.0 90-94 36.9013 38.0 38.0 38.0 35.6 38.0 95-99 36.93865 38.0 38.0 38.0 35.4 38.0 100-104 37.0071 38.0 38.0 38.0 36.0 38.0 105-109 36.7102 38.0 38.0 38.0 35.2 38.0 110-114 36.5232 38.0 38.0 38.0 34.4 38.0 115-119 36.5905 38.0 38.0 38.0 34.4 38.0 120-124 36.55159999999999 38.0 38.0 38.0 34.0 38.0 125-129 36.3448 38.0 38.0 38.0 34.0 38.0 130-134 36.10235 38.0 37.4 38.0 33.4 38.0 135-139 35.8907 38.0 36.4 38.0 32.6 38.0 140-144 35.67829999999999 38.0 36.0 38.0 32.0 38.0 145-149 35.129949999999994 38.0 36.0 38.0 30.4 38.0 150-151 31.22825 35.5 31.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 2.0 23 2.0 24 3.0 25 8.0 26 9.0 27 13.0 28 14.0 29 21.0 30 26.0 31 46.0 32 53.0 33 90.0 34 138.0 35 237.0 36 568.0 37 2759.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.867001254705144 11.217063989962359 9.937264742785445 40.978670012547056 2 20.8 16.6 33.625 28.975 3 19.72993248312078 21.030257564391096 25.056264066016503 34.18354588647162 4 22.775000000000002 30.4 22.725 24.099999999999998 5 21.725 35.8 22.45 20.025000000000002 6 18.875 37.75 24.224999999999998 19.15 7 13.775 26.125 42.9 17.2 8 19.375 24.224999999999998 29.175 27.224999999999998 9 17.2 24.7 33.6 24.5 10-14 19.43 30.195 26.595000000000002 23.78 15-19 19.77 28.73 27.875 23.625 20-24 19.735 28.77 27.500000000000004 23.995 25-29 19.91 29.255 27.245 23.59 30-34 19.706970697069707 29.547954795479548 27.26772677267727 23.477347734773478 35-39 20.037003700370036 29.232923292329232 27.462746274627463 23.26732673267327 40-44 20.005 28.555000000000003 28.165000000000003 23.275000000000002 45-49 19.655 28.804999999999996 27.87 23.669999999999998 50-54 19.845 29.154999999999998 27.500000000000004 23.5 55-59 20.505000000000003 28.544999999999998 27.150000000000002 23.799999999999997 60-64 19.6 28.9 28.194999999999997 23.305 65-69 19.825 28.825 27.61 23.74 70-74 20.41 28.215 27.900000000000002 23.474999999999998 75-79 20.544999999999998 28.810000000000002 27.765 22.88 80-84 20.29 28.925 26.825 23.96 85-89 20.28 28.749999999999996 26.99 23.98 90-94 19.935 28.96 27.66 23.445 95-99 20.201010050502525 28.72643632181609 27.081354067703383 23.991199559978 100-104 20.41010252563141 28.51712928232058 27.551887971993 23.520880220055012 105-109 20.22990813714171 28.974449073841672 27.363084182520957 23.432558606495657 110-114 20.896648887994367 29.1335413102546 26.974942135453357 22.994867666297676 115-119 20.45 28.595 27.61 23.345 120-124 20.62 29.01 26.555 23.815 125-129 20.84 28.465 26.490000000000002 24.205 130-134 20.380000000000003 28.63 26.924999999999997 24.065 135-139 21.165 27.950000000000003 27.0 23.885 140-144 20.76 28.705000000000002 26.125 24.41 145-149 20.54 27.839999999999996 26.650000000000002 24.97 150-151 20.080020005001252 29.094773693423353 26.619154788697173 24.20605151287822 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 4.5 24 4.0 25 3.5 26 4.0 27 5.0 28 8.5 29 12.0 30 20.5 31 23.0 32 25.5 33 39.5 34 53.0 35 68.5 36 92.5 37 113.0 38 138.5 39 172.0 40 195.0 41 209.5 42 241.0 43 251.5 44 265.5 45 296.5 46 285.0 47 241.0 48 220.5 49 230.5 50 188.0 51 144.5 52 121.0 53 89.5 54 68.5 55 44.0 56 29.5 57 22.0 58 16.0 59 12.5 60 11.0 61 9.0 62 5.0 63 3.0 64 2.0 65 2.0 66 1.0 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.025 105-109 0.395 110-114 0.63 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.1375000000000002 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.85 0.0 0.0 0.0 0.0 102-103 2.1375 0.0 0.0 0.0 0.0 104-105 2.325 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 2.925 0.0 0.0 0.0 0.0 110-111 3.25 0.0 0.0 0.0 0.0 112-113 3.6625 0.0 0.0 0.0 0.0 114-115 4.0875 0.0 0.0 0.0 0.0 116-117 4.6 0.0 0.0 0.0 0.0 118-119 5.0375 0.0 0.0 0.0 0.0 120-121 5.5125 0.0 0.0 0.0 0.0 122-123 6.2375 0.0 0.0 0.0 0.0 124-125 6.8125 0.0 0.0 0.0 0.0 126-127 7.325 0.0 0.0 0.0 0.0 128-129 7.9375 0.0 0.0 0.0 0.0 130-131 8.524999999999999 0.0 0.0 0.0 0.0 132-133 9.05 0.0 0.0 0.0 0.0 134-135 9.6375 0.0 0.0 0.0 0.0 136-137 10.225 0.0 0.0 0.0 0.0 138-139 10.975000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.003561457 20.689285 85-89 >>END_MODULE SRR7169773 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169773_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0005 33.0 33.0 34.0 32.0 34.0 2 33.12875 34.0 33.0 34.0 33.0 34.0 3 33.086 34.0 33.0 34.0 33.0 34.0 4 33.0985 34.0 33.0 34.0 33.0 34.0 5 33.13375 34.0 33.0 34.0 33.0 34.0 6 37.32775 38.0 38.0 38.0 37.0 38.0 7 37.36675 38.0 38.0 38.0 37.0 38.0 8 37.40425 38.0 38.0 38.0 38.0 38.0 9 37.31125 38.0 38.0 38.0 37.0 38.0 10-14 37.292100000000005 38.0 38.0 38.0 37.2 38.0 15-19 37.30545 38.0 38.0 38.0 37.0 38.0 20-24 37.2709 38.0 38.0 38.0 37.2 38.0 25-29 37.25395 38.0 38.0 38.0 37.0 38.0 30-34 37.19575 38.0 38.0 38.0 37.0 38.0 35-39 36.79765 38.0 38.0 38.0 35.4 38.0 40-44 37.111250000000005 38.0 38.0 38.0 36.8 38.0 45-49 37.1705 38.0 38.0 38.0 37.0 38.0 50-54 37.058550000000004 38.0 38.0 38.0 36.8 38.0 55-59 36.97685 38.0 38.0 38.0 36.4 38.0 60-64 37.029799999999994 38.0 38.0 38.0 36.8 38.0 65-69 37.0445 38.0 38.0 38.0 36.8 38.0 70-74 36.41905 38.0 38.0 38.0 35.4 38.0 75-79 35.1252 38.0 38.0 38.0 31.0 38.0 80-84 36.0336 38.0 38.0 38.0 31.8 38.0 85-89 36.84565 38.0 38.0 38.0 36.0 38.0 90-94 36.8007 38.0 38.0 38.0 36.0 38.0 95-99 36.5959 38.0 38.0 38.0 35.0 38.0 100-104 36.371 38.0 38.0 38.0 34.0 38.0 105-109 34.92425 38.0 37.6 38.0 28.8 38.0 110-114 33.3871 38.0 36.6 38.0 12.0 38.0 115-119 32.21755 38.0 36.0 38.0 2.0 38.0 120-124 32.64465 38.0 35.0 38.0 9.0 38.0 125-129 32.964299999999994 38.0 34.8 38.0 15.8 38.0 130-134 35.0077 38.0 36.0 38.0 27.8 38.0 135-139 35.29109999999999 38.0 36.0 38.0 31.0 38.0 140-144 34.9185 38.0 36.0 38.0 30.2 38.0 145-149 34.2117 38.0 35.2 38.0 27.2 38.0 150-151 30.391750000000002 35.5 28.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 2.0 5 2.0 6 1.0 7 1.0 8 0.0 9 2.0 10 1.0 11 2.0 12 3.0 13 1.0 14 3.0 15 3.0 16 1.0 17 2.0 18 8.0 19 8.0 20 8.0 21 9.0 22 11.0 23 14.0 24 15.0 25 10.0 26 14.0 27 23.0 28 70.0 29 79.0 30 80.0 31 89.0 32 82.0 33 110.0 34 145.0 35 240.0 36 521.0 37 2432.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.0 19.225 13.8 28.975 2 26.700000000000003 25.074999999999996 31.4 16.825000000000003 3 19.264448336252187 28.596447335501622 30.848136102076555 21.290968226169625 4 25.162581290645324 33.84192096048024 22.611305652826413 18.384192096048025 5 22.911455727863935 35.842921460730366 23.036518259129565 18.209104552276138 6 18.9 37.4 25.45 18.25 7 19.950000000000003 18.9 41.225 19.925 8 20.75 24.65 28.4 26.200000000000003 9 21.15 24.125 31.55 23.175 10-14 23.076153807690382 27.946397319865994 27.51637581879094 21.461073053652683 15-19 22.977297729772978 27.767776777677767 28.182818281828183 21.07210721072107 20-24 23.003051067873756 27.484619616865903 27.949782423848347 21.562546891411994 25-29 22.95614780739037 28.006400320016 28.136406820341016 20.901045052252613 30-34 22.679535907181435 27.765553110622125 28.500700140028005 21.054210842168434 35-39 22.65812650120096 28.527822257806246 28.252602081665334 20.56144915932746 40-44 23.040368165674554 27.932569656345358 28.26271822320044 20.76434395477965 45-49 23.12962592518504 27.335467093418686 29.070814162832566 20.46409281856371 50-54 23.455554999749886 28.107648441798812 28.297733980291127 20.13906257816017 55-59 23.423513527029055 27.65414812221833 28.55428314247137 20.36805520828124 60-64 23.73 27.839999999999996 27.644999999999996 20.785 65-69 23.09 27.76 28.815 20.335 70-74 23.210753233578494 27.69972102460056 28.31346690337306 20.776058838447884 75-79 23.42725221680046 27.299438585445195 28.878744949892436 20.3945642478619 80-84 23.2981637415035 27.81272192350614 28.350410875519934 20.53870345947043 85-89 23.477347734773478 28.06280628062806 28.227822782278228 20.23202320232023 90-94 23.445 27.92 28.24 20.395 95-99 24.224999999999998 27.544999999999998 28.165000000000003 20.064999999999998 100-104 24.08222466740022 27.613283985195558 27.80334100230069 20.50115034510353 105-109 23.625286398666944 28.45761299729223 27.712976463236828 20.204124140804 110-114 24.265867611005177 28.095886679378918 27.578316535004088 20.059929174611824 115-119 24.059512360694686 28.50596820727499 27.380211574362168 20.054307857668157 120-124 24.275302756315416 28.259082689462435 27.585073154693408 19.88054139952874 125-129 25.101517418251763 28.23252831801667 27.163923915366535 19.502030348365036 130-134 25.511329456587127 27.421295367956688 28.133146180068174 18.934228995388008 135-139 25.09 28.12 27.435 19.355 140-144 25.52 27.61 27.395000000000003 19.475 145-149 25.040000000000003 28.560000000000002 27.474999999999998 18.925 150-151 26.602403605408114 28.24236354531798 26.43965948923385 18.71557336004006 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 2.0 24 1.5 25 1.0 26 3.0 27 6.5 28 7.0 29 7.5 30 12.0 31 13.5 32 25.0 33 46.0 34 62.0 35 70.0 36 76.5 37 106.5 38 147.0 39 179.5 40 208.5 41 236.5 42 269.0 43 275.0 44 283.5 45 291.5 46 272.0 47 259.0 48 238.0 49 200.0 50 162.0 51 127.5 52 97.0 53 80.5 54 65.0 55 48.0 56 31.5 57 22.0 58 18.0 59 11.0 60 7.0 61 5.5 62 4.5 63 2.5 64 4.0 65 4.5 66 2.5 67 1.0 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.075 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.01 20-24 0.034999999999999996 25-29 0.005 30-34 0.02 35-39 0.08 40-44 0.045 45-49 0.02 50-54 0.045 55-59 0.015 60-64 0.0 65-69 0.0 70-74 1.425 75-79 4.705 80-84 1.43 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.03 105-109 3.9800000000000004 110-114 8.225 115-119 11.615 120-124 8.755 125-129 6.419999999999999 130-134 0.26 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.5125000000000002 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.4625 0.0 0.0 0.0 0.0 108-109 2.7625 0.0 0.0 0.0 0.0 110-111 3.05 0.0 0.0 0.0 0.0 112-113 3.3875 0.0 0.0 0.0 0.0 114-115 3.7625 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.5 0.0 0.0 0.0 0.0 120-121 4.8875 0.0 0.0 0.0 0.0 122-123 5.575 0.0 0.0 0.0 0.0 124-125 6.1 0.0 0.0 0.0 0.0 126-127 6.6 0.0 0.0 0.0 0.0 128-129 7.2125 0.0 0.0 0.0 0.0 130-131 7.8125 0.0 0.0 0.0 0.0 132-133 8.375 0.0 0.0 0.0 0.0 134-135 9.024999999999999 0.0 0.0 0.0 0.0 136-137 9.5875 0.0 0.0 0.0 0.0 138-139 10.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACCAC 10 0.00734854 141.50002 5 ATGACCA 10 0.00734854 141.50002 4 CTCTCCC 10 0.00734854 141.50002 3 TCTCTCC 10 0.00734854 141.50002 2 >>END_MODULE Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra Read 912632 spots for SRR7169773.sra Written 912632 spots for SRR7169773.sra SRR ids: ['SRR7169773.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2m53qnx0 SRR7169773.sra spots: 18252640 blocks: [[1, 912632], [912633, 1825264], [1825265, 2737896], [2737897, 3650528], [3650529, 4563160], [4563161, 5475792], [5475793, 6388424], [6388425, 7301056], [7301057, 8213688], [8213689, 9126320], [9126321, 10038952], [10038953, 10951584], [10951585, 11864216], [11864217, 12776848], [12776849, 13689480], [13689481, 14602112], [14602113, 15514744], [15514745, 16427376], [16427377, 17340008], [17340009, 18252640]] SRR7169773 file size 6163520 SRR7169773 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169773 SRR7169773_1.fastq SRR7169773_2.fastq Input file: SRR7169773_1.fastq Paired file: SRR7169773_2.fastq trimmed: SRR7169773-trimmed-pair1.fastq, SRR7169773-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:02:37 2025 >> started Tue Feb 11 15:02:57 2025 >> done (20.016s) 18252640 read pairs processed; of these: 14279 ( 0.08%) short read pairs filtered out after trimming by size control 12091 ( 0.07%) empty read pairs filtered out after trimming by size control 18226270 (99.86%) read pairs available; of these: 8241566 (45.22%) trimmed read pairs available after processing 9984704 (54.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 3 0.00% 22 5 0.00% 23 4 0.00% 24 8 0.00% 25 6 0.00% 26 10 0.00% 27 8 0.00% 28 7 0.00% 29 9 0.00% 30 9 0.00% 31 9 0.00% 32 18 0.00% 33 10 0.00% 34 14 0.00% 35 16 0.00% 36 23 0.00% 37 27 0.00% 38 25 0.00% 39 45 0.00% 40 37 0.00% 41 52 0.00% 42 55 0.00% 43 61 0.00% 44 58 0.00% 45 72 0.00% 46 102 0.00% 47 96 0.00% 48 123 0.00% 49 128 0.00% 50 187 0.00% 51 210 0.00% 52 229 0.00% 53 231 0.00% 54 262 0.00% 55 303 0.00% 56 294 0.00% 57 352 0.00% 58 427 0.00% 59 491 0.00% 60 594 0.00% 61 684 0.00% 62 757 0.00% 63 834 0.00% 64 980 0.01% 65 1053 0.01% 66 1096 0.01% 67 1274 0.01% 68 1527 0.01% 69 1606 0.01% 70 1940 0.01% 71 2054 0.01% 72 2488 0.01% 73 2801 0.02% 74 3068 0.02% 75 3477 0.02% 76 3718 0.02% 77 4198 0.02% 78 4462 0.02% 79 4991 0.03% 80 5405 0.03% 81 6283 0.03% 82 6928 0.04% 83 7829 0.04% 84 9170 0.05% 85 10371 0.06% 86 10836 0.06% 87 11595 0.06% 88 12275 0.07% 89 13042 0.07% 90 14158 0.08% 91 15395 0.08% 92 16612 0.09% 93 17915 0.10% 94 19266 0.11% 95 20501 0.11% 96 21877 0.12% 97 22822 0.13% 98 23556 0.13% 99 24262 0.13% 100 25782 0.14% 101 26832 0.15% 102 28459 0.16% 103 30172 0.17% 104 31548 0.17% 105 33119 0.18% 106 34428 0.19% 107 35318 0.19% 108 36409 0.20% 109 36997 0.20% 110 38108 0.21% 111 39456 0.22% 112 41260 0.23% 113 42479 0.23% 114 44665 0.25% 115 45835 0.25% 116 47088 0.26% 117 47550 0.26% 118 48329 0.27% 119 48865 0.27% 120 50095 0.27% 121 51435 0.28% 122 52466 0.29% 123 54299 0.30% 124 56219 0.31% 125 58212 0.32% 126 59406 0.33% 127 61596 0.34% 128 62460 0.34% 129 63064 0.35% 130 63936 0.35% 131 64782 0.36% 132 66228 0.36% 133 68791 0.38% 134 70833 0.39% 135 72957 0.40% 136 75152 0.41% 137 78252 0.43% 138 81262 0.45% 139 84361 0.46% 140 88007 0.48% 141 93856 0.51% 142 99555 0.55% 143 108391 0.59% 144 122873 0.67% 145 145944 0.80% 146 166547 0.91% 147 219900 1.21% 148 324430 1.78% 149 626196 3.44% 150 3849628 21.12% 151 9984704 54.78% 18226270 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=13.26 fanout-score-rank=10 prefix-density=0.28 prefix-fanout=6.9 sequence=CAACCTCAACAGTGGCCATTGGAACTAGAAGGAAAATAAAGCACAGCTGGGATACAAAAGAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=296.49 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=30.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=37 prefix-density=0.33 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=30 fanout-score=243.08 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=25.6 sequence=GAAGAAGAAGAAA SRR7169773 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:03:56 Started mapping on | Feb 11 15:03:57 Finished on | Feb 11 15:05:15 Mapping speed, Million of reads per hour | 841.21 Number of input reads | 18226270 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 15382416 Uniquely mapped reads % | 84.40% Average mapped length | 285.67 Number of splices: Total | 15025140 Number of splices: Annotated (sjdb) | 14790437 Number of splices: GT/AG | 14800542 Number of splices: GC/AG | 177957 Number of splices: AT/AC | 12128 Number of splices: Non-canonical | 34513 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276710 % of reads mapped to multiple loci | 1.52% Number of reads mapped to too many loci | 106869 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.40% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2583022 2583022 2583022 N_multimapping 276710 276710 276710 N_noFeature 357534 15233092 430487 N_ambiguous 187338 1554 109840 UnstrandedReadsAssigned:14837544 PositiveStrandReadsAssigned:147770 NegativeStrandReadsAssigned:14842089 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169773 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169773-trimmed-pair1.fastq SRR7169773-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,226,270 reads, 16,770,514 reads pseudoaligned [quant] estimated average fragment length: 213.53 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7169773.ke.tsv 34699 SRR7169773.se.tsv 87100 total ==> SRR7169773.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.47 359 13.446 Potri.005G024800.1.v4.1 1035 822.47 34 2.79543 Potri.004G059700.1.v4.1 961 748.483 0 0 Potri.007G009000.2.v4.1 1416 1203.47 0 0 Potri.003G141000.2.v4.1 2943 2730.47 418.038 10.3531 Potri.016G087400.1.v4.1 270 96.3244 1633.2 1146.55 Potri.015G069301.1.v4.1 564 354.549 0 0 Potri.010G195200.1.v4.1 1773 1560.47 10 0.433346 Potri.012G127500.1.v4.1 977 764.476 6091 538.784 ==> SRR7169773.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1163 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169773 completed mapping pipeline successfully