Starting /dee2/code/volunteer_pipeline.sh SRR7169774 current disk space = 3049984098304 free memory = 1083843908 SRR7169774 SRAfilesize b845326fdd7c99e305a9796f656accb2 SRR7169774.sra SRR7169774.sra file validated SRR7169774 is paired end SRR7169774 is conventional basespace SRR7169774 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169774_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.89825 18.0 18.0 18.0 18.0 32.0 2 25.6355 27.0 25.0 27.0 18.0 30.0 3 26.30675 27.0 25.0 29.0 18.0 31.0 4 29.7755 31.0 29.0 31.0 27.0 33.0 5 31.31925 32.0 32.0 33.0 28.0 33.0 6 35.8465 37.0 36.0 38.0 33.0 38.0 7 36.94425 38.0 37.0 38.0 35.0 38.0 8 36.366 38.0 37.0 38.0 33.0 38.0 9 37.0595 38.0 38.0 38.0 36.0 38.0 10-14 37.31535 38.0 38.0 38.0 36.4 38.0 15-19 36.636399999999995 38.0 37.6 38.0 33.8 38.0 20-24 37.5106 38.0 38.0 38.0 37.4 38.0 25-29 37.533100000000005 38.0 38.0 38.0 37.6 38.0 30-34 37.36635 38.0 38.0 38.0 37.2 38.0 35-39 37.3515 38.0 38.0 38.0 36.8 38.0 40-44 37.101800000000004 38.0 38.0 38.0 36.2 38.0 45-49 36.613099999999996 38.0 37.8 38.0 34.2 38.0 50-54 37.3481 38.0 38.0 38.0 37.0 38.0 55-59 37.30479999999999 38.0 38.0 38.0 36.8 38.0 60-64 37.24495 38.0 38.0 38.0 36.0 38.0 65-69 37.21455 38.0 38.0 38.0 36.0 38.0 70-74 37.11095 38.0 38.0 38.0 36.0 38.0 75-79 37.031150000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.944100000000006 38.0 38.0 38.0 35.8 38.0 85-89 36.831849999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.665299999999995 38.0 38.0 38.0 34.4 38.0 95-99 36.58284999999999 38.0 38.0 38.0 34.2 38.0 100-104 36.52245 38.0 38.0 38.0 34.0 38.0 105-109 36.42935 38.0 37.6 38.0 34.0 38.0 110-114 35.825849999999996 38.0 36.8 38.0 31.4 38.0 115-119 35.92334999999999 38.0 37.0 38.0 32.8 38.0 120-124 35.8941 38.0 36.8 38.0 32.6 38.0 125-129 35.64095 38.0 36.0 38.0 31.8 38.0 130-134 34.90875 38.0 35.4 38.0 27.0 38.0 135-139 34.8067 38.0 35.0 38.0 27.4 38.0 140-144 34.49555 38.0 34.8 38.0 26.4 38.0 145-149 33.945750000000004 38.0 34.6 38.0 23.8 38.0 150-151 30.1475 36.0 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 2.0 17 0.0 18 2.0 19 4.0 20 6.0 21 2.0 22 7.0 23 4.0 24 8.0 25 8.0 26 13.0 27 20.0 28 17.0 29 19.0 30 42.0 31 53.0 32 76.0 33 137.0 34 214.0 35 407.0 36 1164.0 37 1794.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.716862941618643 25.85818090704084 8.895013781007266 35.52994237033325 2 23.674999999999997 16.875 33.175 26.275 3 21.60200250312891 20.125156445556946 26.608260325406757 31.66458072590738 4 22.875 29.925 22.375 24.825 5 23.25 33.1 22.825 20.825 6 18.5 35.975 25.825 19.7 7 14.725 26.575 41.6 17.1 8 17.974999999999998 25.775 31.025000000000002 25.224999999999998 9 17.8 24.825 34.050000000000004 23.325000000000003 10-14 19.455 30.599999999999998 26.935 23.01 15-19 20.09 29.275000000000002 27.165 23.47 20-24 19.825 29.715000000000003 27.775 22.685 25-29 20.05 29.509999999999998 27.589999999999996 22.85 30-34 19.805 29.775000000000002 27.295 23.125 35-39 19.675 29.725 27.455000000000002 23.145 40-44 19.68 29.445 27.74 23.135 45-49 19.93 29.265 27.48 23.325000000000003 50-54 20.155 29.299999999999997 27.18 23.365 55-59 20.405 29.26 27.139999999999997 23.195 60-64 20.43 29.68 26.484999999999996 23.405 65-69 20.375 29.075 27.339999999999996 23.21 70-74 20.345 28.955 27.765 22.935 75-79 20.075000000000003 29.29 27.735 22.900000000000002 80-84 20.05 29.080000000000002 27.189999999999998 23.68 85-89 20.369999999999997 28.87 27.48 23.28 90-94 19.74 29.205 27.345000000000002 23.71 95-99 20.674999999999997 28.68 27.455000000000002 23.189999999999998 100-104 20.945 29.770000000000003 26.57 22.715 105-109 20.300075018754686 29.462365591397848 27.0717679419855 23.165791447861967 110-114 20.905 28.970000000000002 26.924999999999997 23.200000000000003 115-119 21.4 28.970000000000002 26.72 22.91 120-124 20.865000000000002 28.610000000000003 27.255000000000003 23.27 125-129 20.82 29.07 26.215 23.895 130-134 21.095 28.439999999999998 27.11 23.355 135-139 21.065 28.249999999999996 26.765 23.919999999999998 140-144 20.825 28.21 26.534999999999997 24.43 145-149 20.87 28.665000000000003 26.395000000000003 24.07 150-151 20.7 28.787499999999998 26.5375 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 2.5 25 5.0 26 7.0 27 10.0 28 11.0 29 13.5 30 20.5 31 29.0 32 45.5 33 62.5 34 67.5 35 81.0 36 101.5 37 115.0 38 146.0 39 167.0 40 194.0 41 239.0 42 254.5 43 259.0 44 264.0 45 262.5 46 259.0 47 251.0 48 230.0 49 190.0 50 155.0 51 129.0 52 105.0 53 86.0 54 62.0 55 46.5 56 36.0 57 27.0 58 19.0 59 11.0 60 8.0 61 6.0 62 3.0 63 2.0 64 3.5 65 4.0 66 2.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.125 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.025 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.8250000000000002 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.8375 0.0 0.0 0.0 0.0 112-113 3.2375 0.0 0.0 0.0 0.0 114-115 3.575 0.0 0.0 0.0 0.0 116-117 4.1375 0.0 0.0 0.0 0.0 118-119 4.550000000000001 0.0 0.0 0.0 0.0 120-121 4.987500000000001 0.0 0.0 0.0 0.0 122-123 5.35 0.0 0.0 0.0 0.0 124-125 5.85 0.0 0.0 0.0 0.0 126-127 6.35 0.0 0.0 0.0 0.0 128-129 6.8 0.0 0.0 0.0 0.0 130-131 7.175000000000001 0.0 0.0 0.0 0.0 132-133 7.625 0.0 0.0 0.0 0.0 134-135 8.3625 0.0 0.0 0.0 0.0 136-137 8.9 0.0 0.0 0.0 0.0 138-139 9.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGATTC 10 0.006830828 145.0 7 >>END_MODULE SRR7169774 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169774_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8645 33.0 33.0 34.0 32.0 34.0 2 33.00775 34.0 33.0 34.0 32.0 34.0 3 33.02925 34.0 33.0 34.0 32.0 34.0 4 33.00425 34.0 33.0 34.0 32.0 34.0 5 33.00375 34.0 33.0 34.0 32.0 34.0 6 37.253 38.0 38.0 38.0 37.0 38.0 7 37.196 38.0 38.0 38.0 37.0 38.0 8 37.22875 38.0 38.0 38.0 37.0 38.0 9 37.132 38.0 38.0 38.0 37.0 38.0 10-14 36.7351 38.0 37.8 38.0 35.0 38.0 15-19 37.081900000000005 38.0 38.0 38.0 36.8 38.0 20-24 37.02715 38.0 38.0 38.0 36.6 38.0 25-29 37.04535 38.0 38.0 38.0 36.6 38.0 30-34 36.5873 38.0 37.8 38.0 34.6 38.0 35-39 36.9232 38.0 38.0 38.0 36.2 38.0 40-44 36.33285000000001 38.0 37.4 38.0 33.2 38.0 45-49 36.959050000000005 38.0 38.0 38.0 36.4 38.0 50-54 36.54260000000001 38.0 37.8 38.0 34.0 38.0 55-59 36.53765 38.0 38.0 38.0 34.6 38.0 60-64 36.767250000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.4481 38.0 38.0 38.0 34.2 38.0 70-74 36.404849999999996 38.0 38.0 38.0 34.4 38.0 75-79 36.4285 38.0 38.0 38.0 34.0 38.0 80-84 36.25365 38.0 37.8 38.0 33.6 38.0 85-89 36.4757 38.0 38.0 38.0 34.4 38.0 90-94 36.1091 38.0 37.6 38.0 32.8 38.0 95-99 36.317099999999996 38.0 38.0 38.0 34.0 38.0 100-104 35.91905 38.0 37.4 38.0 32.8 38.0 105-109 34.82145 38.0 36.4 38.0 27.0 38.0 110-114 34.31505 38.0 36.0 38.0 24.4 38.0 115-119 33.923950000000005 38.0 36.0 38.0 20.6 38.0 120-124 33.307 38.0 34.4 38.0 16.6 38.0 125-129 34.17835 38.0 35.0 38.0 23.4 38.0 130-134 34.064049999999995 38.0 34.4 38.0 23.2 38.0 135-139 34.22705 38.0 35.0 38.0 24.2 38.0 140-144 34.0272 38.0 34.2 38.0 23.6 38.0 145-149 33.5305 38.0 33.4 38.0 21.0 38.0 150-151 29.034625 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 3.0 5 1.0 6 2.0 7 3.0 8 0.0 9 2.0 10 2.0 11 3.0 12 1.0 13 1.0 14 6.0 15 2.0 16 4.0 17 2.0 18 8.0 19 6.0 20 7.0 21 9.0 22 4.0 23 13.0 24 15.0 25 20.0 26 17.0 27 22.0 28 34.0 29 44.0 30 61.0 31 99.0 32 115.0 33 122.0 34 228.0 35 310.0 36 732.0 37 2090.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.325 19.650000000000002 14.6 28.425 2 25.55 24.925 32.25 17.275 3 19.925 27.650000000000002 32.175 20.25 4 24.25 32.324999999999996 23.65 19.775000000000002 5 24.6 35.775 22.05 17.575 6 20.4 37.05 23.625 18.925 7 19.275000000000002 21.375 38.550000000000004 20.8 8 21.775 23.875 28.025 26.325 9 22.275 24.725 30.049999999999997 22.95 10-14 23.025000000000002 28.465 27.065 21.445 15-19 23.005 26.845000000000002 29.095 21.055 20-24 23.075000000000003 28.084999999999997 27.944999999999997 20.895 25-29 22.975 27.450000000000003 28.365000000000002 21.21 30-34 22.88 28.110000000000003 28.18 20.830000000000002 35-39 23.085 28.205000000000002 27.52 21.19 40-44 22.775000000000002 28.335 27.794999999999998 21.095 45-49 23.064999999999998 27.755000000000003 28.42 20.76 50-54 23.44 27.810000000000002 27.950000000000003 20.8 55-59 23.755000000000003 27.55 28.044999999999998 20.65 60-64 22.56 27.66 28.860000000000003 20.919999999999998 65-69 22.98 27.700000000000003 28.349999999999998 20.97 70-74 23.461056849486603 27.63335837716003 28.569997495617333 20.33558727773604 75-79 22.914894681543004 27.447841096712867 28.493520788512534 21.143743433231602 80-84 23.073461019152873 27.03905585837876 29.164374656198426 20.72310846626994 85-89 24.035 27.415 28.015 20.535 90-94 23.165 28.015 28.49 20.330000000000002 95-99 23.505000000000003 27.245 28.87 20.380000000000003 100-104 23.827148144443335 27.768330499149744 28.333500050015004 20.071021306391916 105-109 23.62276819777201 27.63111043288061 28.312732081998064 20.433389287349303 110-114 23.459593353287232 27.789245536175045 28.547837754154195 20.203323356383528 115-119 24.260261733326328 28.002312503284806 27.923477164030064 19.813948599358806 120-124 23.860743050142894 28.241101584827227 27.80462457781242 20.09353078721746 125-129 24.39965476976189 27.69457277758034 27.420419353200998 20.48535309945677 130-134 24.042021010505252 28.009004502251127 27.913956978489246 20.035017508754375 135-139 24.665 27.185 28.205000000000002 19.945 140-144 24.55 27.534999999999997 27.975 19.939999999999998 145-149 24.94 27.495000000000005 27.450000000000003 20.115 150-151 25.2625 26.8375 27.825 20.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 1.0 26 3.0 27 3.5 28 4.0 29 7.0 30 12.0 31 15.0 32 21.0 33 36.0 34 46.0 35 59.5 36 81.0 37 98.5 38 137.0 39 181.0 40 207.0 41 226.0 42 246.0 43 264.0 44 286.0 45 303.5 46 291.0 47 266.5 48 238.0 49 208.5 50 178.0 51 140.0 52 116.0 53 96.0 54 68.0 55 45.5 56 31.0 57 22.0 58 15.0 59 10.5 60 7.0 61 5.5 62 3.0 63 1.5 64 2.5 65 2.0 66 1.0 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.17500000000000002 75-79 0.065 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 1.7049999999999998 110-114 3.11 115-119 4.865 120-124 3.775 125-129 1.5150000000000001 130-134 0.05 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 1.8250000000000002 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.4625 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.1375 0.0 0.0 0.0 0.0 114-115 3.4375 0.0 0.0 0.0 0.0 116-117 3.925 0.0 0.0 0.0 0.0 118-119 4.2375 0.0 0.0 0.0 0.0 120-121 4.675000000000001 0.0 0.0 0.0 0.0 122-123 5.0 0.0 0.0 0.0 0.0 124-125 5.5625 0.0 0.0 0.0 0.0 126-127 6.1 0.0 0.0 0.0 0.0 128-129 6.525 0.0 0.0 0.0 0.0 130-131 6.9 0.0 0.0 0.0 0.0 132-133 7.35 0.0 0.0 0.0 0.0 134-135 8.0875 0.0 0.0 0.0 0.0 136-137 8.625 0.0 0.0 0.0 0.0 138-139 9.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCCTG 10 0.007063091 143.3875 145 AAGCCTC 10 0.007063091 143.3875 9 >>END_MODULE Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867923 spots for SRR7169774.sra Written 867923 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra Read 867912 spots for SRR7169774.sra Written 867912 spots for SRR7169774.sra SRR ids: ['SRR7169774.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0dlye5jo SRR7169774.sra spots: 17358251 blocks: [[1, 867912], [867913, 1735824], [1735825, 2603736], [2603737, 3471648], [3471649, 4339560], [4339561, 5207472], [5207473, 6075384], [6075385, 6943296], [6943297, 7811208], [7811209, 8679120], [8679121, 9547032], [9547033, 10414944], [10414945, 11282856], [11282857, 12150768], [12150769, 13018680], [13018681, 13886592], [13886593, 14754504], [14754505, 15622416], [15622417, 16490328], [16490329, 17358251]] SRR7169774 file size 5860441 SRR7169774 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169774 SRR7169774_1.fastq SRR7169774_2.fastq Input file: SRR7169774_1.fastq Paired file: SRR7169774_2.fastq trimmed: SRR7169774-trimmed-pair1.fastq, SRR7169774-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:52:10 2025 >> started Tue Feb 11 14:52:28 2025 >> done (17.768s) 17358251 read pairs processed; of these: 13446 ( 0.08%) short read pairs filtered out after trimming by size control 16518 ( 0.10%) empty read pairs filtered out after trimming by size control 17328287 (99.83%) read pairs available; of these: 8719607 (50.32%) trimmed read pairs available after processing 8608680 (49.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 3 0.00% 24 1 0.00% 25 5 0.00% 26 1 0.00% 27 4 0.00% 28 5 0.00% 29 2 0.00% 30 8 0.00% 31 11 0.00% 32 8 0.00% 33 8 0.00% 34 15 0.00% 35 12 0.00% 36 25 0.00% 37 20 0.00% 38 25 0.00% 39 28 0.00% 40 25 0.00% 41 27 0.00% 42 43 0.00% 43 46 0.00% 44 52 0.00% 45 50 0.00% 46 74 0.00% 47 63 0.00% 48 83 0.00% 49 108 0.00% 50 133 0.00% 51 126 0.00% 52 191 0.00% 53 180 0.00% 54 200 0.00% 55 226 0.00% 56 251 0.00% 57 264 0.00% 58 327 0.00% 59 408 0.00% 60 470 0.00% 61 543 0.00% 62 639 0.00% 63 691 0.00% 64 820 0.00% 65 921 0.01% 66 988 0.01% 67 1067 0.01% 68 1250 0.01% 69 1385 0.01% 70 1593 0.01% 71 1825 0.01% 72 2269 0.01% 73 2608 0.02% 74 2886 0.02% 75 3080 0.02% 76 3615 0.02% 77 3825 0.02% 78 4105 0.02% 79 4496 0.03% 80 5134 0.03% 81 5809 0.03% 82 6636 0.04% 83 7434 0.04% 84 8781 0.05% 85 10117 0.06% 86 10434 0.06% 87 11218 0.06% 88 12154 0.07% 89 12798 0.07% 90 13893 0.08% 91 15038 0.09% 92 16308 0.09% 93 17670 0.10% 94 19012 0.11% 95 20520 0.12% 96 21403 0.12% 97 22316 0.13% 98 22780 0.13% 99 23759 0.14% 100 25444 0.15% 101 26742 0.15% 102 28532 0.16% 103 29751 0.17% 104 31359 0.18% 105 33410 0.19% 106 34679 0.20% 107 35486 0.20% 108 36606 0.21% 109 37223 0.21% 110 37498 0.22% 111 39339 0.23% 112 41400 0.24% 113 43266 0.25% 114 45108 0.26% 115 47316 0.27% 116 47904 0.28% 117 48976 0.28% 118 49740 0.29% 119 50218 0.29% 120 51518 0.30% 121 52623 0.30% 122 54523 0.31% 123 56326 0.33% 124 58999 0.34% 125 61956 0.36% 126 63262 0.37% 127 64779 0.37% 128 65873 0.38% 129 67422 0.39% 130 68627 0.40% 131 69759 0.40% 132 71854 0.41% 133 74234 0.43% 134 76288 0.44% 135 79955 0.46% 136 83168 0.48% 137 86034 0.50% 138 89722 0.52% 139 93804 0.54% 140 99248 0.57% 141 105349 0.61% 142 114859 0.66% 143 127018 0.73% 144 144755 0.84% 145 172205 0.99% 146 213916 1.23% 147 283955 1.64% 148 406771 2.35% 149 794477 4.58% 150 3770970 21.76% 151 8608680 49.68% 17328287 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=35 prefix-density=0.19 prefix-fanout=2.3 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=193.39 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=40 prefix-density=0.16 prefix-fanout=2.0 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=185.46 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=21.5 sequence=GAAGAAGAAGAAA SRR7169774 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:53:13 Started mapping on | Feb 11 14:53:13 Finished on | Feb 11 14:54:46 Mapping speed, Million of reads per hour | 670.77 Number of input reads | 17328287 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16555189 Uniquely mapped reads % | 95.54% Average mapped length | 290.46 Number of splices: Total | 14716944 Number of splices: Annotated (sjdb) | 14463915 Number of splices: GT/AG | 14507093 Number of splices: GC/AG | 165252 Number of splices: AT/AC | 12513 Number of splices: Non-canonical | 32086 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297833 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 32793 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.51% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 488187 488187 488187 N_multimapping 297833 297833 297833 N_noFeature 460123 16344068 552442 N_ambiguous 180307 851 60865 UnstrandedReadsAssigned:15914759 PositiveStrandReadsAssigned:210270 NegativeStrandReadsAssigned:15941882 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169774 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169774-trimmed-pair1.fastq SRR7169774-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,328,287 reads, 15,853,709 reads pseudoaligned [quant] estimated average fragment length: 215.497 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52401 SRR7169774.ke.tsv 34699 SRR7169774.se.tsv 87100 total ==> SRR7169774.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.5 280 10.432 Potri.005G024800.1.v4.1 1035 820.503 45 3.68518 Potri.004G059700.1.v4.1 961 746.523 1 0.0900086 Potri.007G009000.2.v4.1 1416 1201.5 0 0 Potri.003G141000.2.v4.1 2943 2728.5 321.08 7.90707 Potri.016G087400.1.v4.1 270 91.1062 1527.27 1126.41 Potri.015G069301.1.v4.1 564 351.641 0 0 Potri.010G195200.1.v4.1 1773 1558.5 17 0.73294 Potri.012G127500.1.v4.1 977 762.513 6116 538.948 ==> SRR7169774.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2308 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 326 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169774 completed mapping pipeline successfully