Starting /dee2/code/volunteer_pipeline.sh SRR7169776 current disk space = 3049070440448 free memory = 1578790664 SRR7169776 SRAfilesize f33e90371df51f01316f971f247d0cc7 SRR7169776.sra SRR7169776.sra file validated SRR7169776 is paired end SRR7169776 is conventional basespace SRR7169776 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169776_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.01775 18.0 18.0 25.0 18.0 32.0 2 29.39175 30.0 27.0 31.0 27.0 33.0 3 31.47375 33.0 31.0 33.0 29.0 33.0 4 32.411 33.0 33.0 33.0 31.0 33.0 5 33.074 33.0 33.0 34.0 33.0 34.0 6 37.18125 38.0 37.0 38.0 36.0 38.0 7 37.5275 38.0 38.0 38.0 37.0 38.0 8 37.6755 38.0 38.0 38.0 38.0 38.0 9 37.68175 38.0 38.0 38.0 38.0 38.0 10-14 37.641949999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.662749999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.61705 38.0 38.0 38.0 38.0 38.0 25-29 37.47475000000001 38.0 38.0 38.0 37.4 38.0 30-34 37.504149999999996 38.0 38.0 38.0 37.6 38.0 35-39 37.3835 38.0 38.0 38.0 37.2 38.0 40-44 37.33669999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.35785 38.0 38.0 38.0 37.0 38.0 50-54 37.3318 38.0 38.0 38.0 37.0 38.0 55-59 37.35215000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.2145 38.0 38.0 38.0 36.4 38.0 65-69 36.99895 38.0 38.0 38.0 35.6 38.0 70-74 37.09845 38.0 38.0 38.0 36.0 38.0 75-79 36.310399999999994 38.0 37.2 38.0 32.8 38.0 80-84 36.868900000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.681400000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.6401 38.0 38.0 38.0 34.4 38.0 95-99 36.622699999999995 38.0 38.0 38.0 34.8 38.0 100-104 36.50435 38.0 38.0 38.0 34.0 38.0 105-109 36.32145 38.0 37.6 38.0 34.0 38.0 110-114 35.7571 38.0 36.6 38.0 31.0 38.0 115-119 34.600049999999996 38.0 34.6 38.0 24.0 38.0 120-124 35.7491 38.0 36.6 38.0 32.0 38.0 125-129 35.538050000000005 38.0 36.0 38.0 31.0 38.0 130-134 35.008449999999996 38.0 35.6 38.0 27.8 38.0 135-139 34.8734 38.0 35.0 38.0 27.8 38.0 140-144 33.8082 38.0 34.2 38.0 22.2 38.0 145-149 33.73565000000001 38.0 34.6 38.0 22.2 38.0 150-151 29.232625 36.0 18.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 2.0 17 1.0 18 4.0 19 9.0 20 2.0 21 7.0 22 3.0 23 3.0 24 4.0 25 8.0 26 10.0 27 13.0 28 24.0 29 26.0 30 44.0 31 55.0 32 68.0 33 113.0 34 181.0 35 403.0 36 1036.0 37 1980.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.16165698408689 12.806264208133367 14.195503915130084 32.836574892649665 2 22.3 15.375 31.45 30.875000000000004 3 20.225 21.325 26.05 32.4 4 24.099999999999998 28.299999999999997 22.900000000000002 24.7 5 23.849999999999998 31.15 23.0 22.0 6 19.35 34.35 24.625 21.675 7 14.475 25.6 41.075 18.85 8 17.825 25.874999999999996 30.875000000000004 25.424999999999997 9 17.275 25.474999999999998 32.300000000000004 24.95 10-14 20.06 29.325000000000003 26.650000000000002 23.965 15-19 19.7 28.689999999999998 27.395000000000003 24.215 20-24 19.98 28.785 27.27 23.965 25-29 20.294999999999998 28.52 27.42 23.765 30-34 19.74 28.52 27.839999999999996 23.9 35-39 19.5 28.555000000000003 27.43 24.515 40-44 20.205000000000002 28.83 27.12 23.845 45-49 20.169999999999998 28.115000000000002 27.91 23.805 50-54 19.950000000000003 28.775000000000002 27.029999999999998 24.245 55-59 20.395 28.68 26.875 24.05 60-64 20.605 28.249999999999996 27.139999999999997 24.005000000000003 65-69 20.94 28.125 27.650000000000002 23.285 70-74 19.835 28.625 27.339999999999996 24.2 75-79 20.275000000000002 28.084999999999997 27.24 24.4 80-84 20.09 28.804999999999996 27.034999999999997 24.07 85-89 19.925 28.055000000000003 27.295 24.725 90-94 20.265 28.33 27.125 24.279999999999998 95-99 20.54 27.744999999999997 27.275 24.44 100-104 20.419999999999998 28.655 27.150000000000002 23.775 105-109 20.655 28.449999999999996 26.584999999999997 24.310000000000002 110-114 20.835 28.485 26.889999999999997 23.79 115-119 21.09 27.950000000000003 27.325 23.635 120-124 21.178176726508976 27.99419912986948 26.70900635095264 24.1186177926689 125-129 21.325 27.99 26.77 23.915 130-134 21.63 27.775 26.555 24.04 135-139 20.97 28.08 26.19 24.759999999999998 140-144 21.240000000000002 28.265 25.814999999999998 24.68 145-149 21.560000000000002 27.93 25.624999999999996 24.884999999999998 150-151 21.5625 28.175 26.450000000000003 23.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 2.0 22 2.5 23 2.5 24 2.0 25 1.5 26 3.0 27 6.0 28 11.0 29 11.5 30 16.5 31 23.0 32 28.0 33 35.5 34 47.5 35 69.5 36 85.0 37 93.0 38 114.0 39 156.0 40 172.0 41 187.0 42 225.0 43 240.0 44 258.0 45 283.5 46 277.5 47 263.5 48 252.0 49 226.0 50 177.5 51 148.5 52 135.5 53 106.0 54 88.5 55 66.5 56 43.0 57 35.0 58 31.5 59 25.0 60 16.5 61 8.0 62 6.5 63 4.0 64 2.0 65 3.0 66 2.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72368751569958 99.25 2 0.25119316754584275 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025119316754584273 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 10 0.25 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.6875 0.0125 0.0 0.0 0.0 86-87 0.8625 0.025 0.0 0.0 0.0 88-89 0.9125 0.025 0.0 0.0 0.0 90-91 1.1625 0.025 0.0 0.0 0.0 92-93 1.35 0.025 0.0 0.0 0.0 94-95 1.4500000000000002 0.025 0.0 0.0 0.0 96-97 1.6375000000000002 0.025 0.0 0.0 0.0 98-99 1.9125 0.025 0.0 0.0 0.0 100-101 2.1625 0.025 0.0 0.0 0.0 102-103 2.5374999999999996 0.025 0.0 0.0 0.0 104-105 2.875 0.025 0.0 0.0 0.0 106-107 3.2750000000000004 0.025 0.0 0.0 0.0 108-109 3.7875 0.025 0.0 0.0 0.0 110-111 4.15 0.025 0.0 0.0 0.0 112-113 4.525 0.025 0.0 0.0 0.0 114-115 5.0875 0.025 0.0 0.0 0.0 116-117 5.7375 0.025 0.0 0.0 0.0 118-119 6.2875 0.025 0.0 0.0 0.0 120-121 6.9625 0.025 0.0 0.0 0.0 122-123 7.475 0.025 0.0 0.0 0.0 124-125 8.1625 0.025 0.0 0.0 0.0 126-127 8.8375 0.025 0.0 0.0 0.0 128-129 9.6375 0.025 0.0 0.0 0.0 130-131 10.4625 0.025 0.0 0.0 0.0 132-133 11.175 0.025 0.0 0.0 0.0 134-135 11.825 0.025 0.0 0.0 0.0 136-137 12.5125 0.025 0.0 0.0 0.0 138-139 13.3 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169776 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169776_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0275 33.0 33.0 34.0 32.0 34.0 2 33.151 34.0 33.0 34.0 33.0 34.0 3 33.1535 34.0 33.0 34.0 33.0 34.0 4 33.11675 34.0 33.0 34.0 33.0 34.0 5 33.11525 34.0 33.0 34.0 33.0 34.0 6 37.348 38.0 38.0 38.0 38.0 38.0 7 37.40275 38.0 38.0 38.0 38.0 38.0 8 37.39725 38.0 38.0 38.0 38.0 38.0 9 37.24425 38.0 38.0 38.0 37.0 38.0 10-14 37.2812 38.0 38.0 38.0 37.4 38.0 15-19 36.70504999999999 38.0 37.8 38.0 35.0 38.0 20-24 37.19565 38.0 38.0 38.0 37.0 38.0 25-29 36.182849999999995 38.0 37.6 38.0 31.8 38.0 30-34 37.178250000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.24635 38.0 38.0 38.0 37.4 38.0 40-44 37.206199999999995 38.0 38.0 38.0 37.2 38.0 45-49 37.08815 38.0 38.0 38.0 36.8 38.0 50-54 37.1148 38.0 38.0 38.0 36.8 38.0 55-59 37.07055 38.0 38.0 38.0 36.6 38.0 60-64 36.98095 38.0 38.0 38.0 36.6 38.0 65-69 35.6126 38.0 36.8 38.0 28.6 38.0 70-74 36.03085 38.0 37.2 38.0 32.0 38.0 75-79 36.766549999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.223 38.0 37.4 38.0 33.0 38.0 85-89 36.74014999999999 38.0 38.0 38.0 35.8 38.0 90-94 36.72755 38.0 38.0 38.0 36.0 38.0 95-99 36.7019 38.0 38.0 38.0 36.0 38.0 100-104 36.3966 38.0 38.0 38.0 34.8 38.0 105-109 35.503750000000004 38.0 37.2 38.0 30.4 38.0 110-114 35.454449999999994 38.0 37.8 38.0 31.6 38.0 115-119 34.30454999999999 38.0 36.4 38.0 24.6 38.0 120-124 34.27945 38.0 36.0 38.0 24.0 38.0 125-129 34.3448 38.0 35.4 38.0 24.2 38.0 130-134 35.10825 38.0 36.0 38.0 29.2 38.0 135-139 35.0756 38.0 36.0 38.0 30.0 38.0 140-144 34.778549999999996 38.0 35.6 38.0 28.4 38.0 145-149 34.120549999999994 38.0 34.4 38.0 26.4 38.0 150-151 29.79175 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 7.0 4 2.0 5 1.0 6 3.0 7 2.0 8 0.0 9 1.0 10 3.0 11 0.0 12 3.0 13 2.0 14 2.0 15 3.0 16 1.0 17 5.0 18 7.0 19 5.0 20 10.0 21 7.0 22 10.0 23 5.0 24 4.0 25 3.0 26 10.0 27 25.0 28 28.0 29 31.0 30 51.0 31 57.0 32 90.0 33 113.0 34 177.0 35 272.0 36 689.0 37 2364.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.31965982991496 20.38519259629815 14.25712856428214 26.038019009504755 2 26.775 25.95 28.675 18.6 3 21.675 29.225 29.099999999999998 20.0 4 25.4 33.775 21.099999999999998 19.725 5 25.324999999999996 34.775 20.875 19.025 6 22.900000000000002 35.4 22.900000000000002 18.8 7 20.25 22.225 36.425000000000004 21.099999999999998 8 22.125 26.375 26.700000000000003 24.8 9 23.075000000000003 25.174999999999997 29.049999999999997 22.7 10-14 24.46 27.950000000000003 25.865 21.725 15-19 24.169999999999998 28.139999999999997 26.945000000000004 20.745 20-24 24.07 28.144999999999996 26.83 20.955 25-29 24.215 27.735 27.150000000000002 20.9 30-34 24.125 27.794999999999998 26.700000000000003 21.38 35-39 23.86 27.91 27.229999999999997 21.0 40-44 23.98 27.744999999999997 27.034999999999997 21.240000000000002 45-49 24.26 27.67 27.22 20.849999999999998 50-54 23.785 27.944999999999997 27.725 20.544999999999998 55-59 24.43 27.07 27.48 21.02 60-64 23.765 27.6 27.279999999999998 21.355 65-69 24.04 27.83 27.495000000000005 20.635 70-74 23.905 27.950000000000003 27.650000000000002 20.495 75-79 24.361611398183918 27.291426278031405 27.757989264034517 20.588973059750163 80-84 24.18 28.405 26.490000000000002 20.925 85-89 24.465 27.465 27.655 20.415 90-94 24.404999999999998 27.68 27.265 20.65 95-99 24.265 27.435 27.785 20.515 100-104 24.624549459351222 27.52803364036844 27.007408890668806 20.840008009611534 105-109 25.258663987945756 27.488699146157707 27.493721747865397 19.75891511803114 110-114 24.874359104523073 27.701913802731106 27.250114218995886 20.173612873749935 115-119 24.762300618278175 27.562737049929858 27.5055852860186 20.169377045773366 120-124 25.72669907934209 27.293886417709736 27.112858177304233 19.866556325643945 125-129 25.72986192489937 27.86467621134152 26.636775869975033 19.768685993784075 130-134 25.866039247096516 27.953544253103722 26.707048458149778 19.47336804164998 135-139 26.69 27.625 26.82 18.865000000000002 140-144 26.35 27.97 26.525 19.155 145-149 26.825 28.165000000000003 26.22 18.790000000000003 150-151 26.55 27.725 26.387500000000003 19.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 2.0 25 1.5 26 2.0 27 2.5 28 2.0 29 2.0 30 2.5 31 6.5 32 10.0 33 21.0 34 29.5 35 38.5 36 50.5 37 64.5 38 98.5 39 148.0 40 191.5 41 217.0 42 252.5 43 285.5 44 291.0 45 285.0 46 295.5 47 299.5 48 263.5 49 219.5 50 193.5 51 161.5 52 125.0 53 98.0 54 84.5 55 69.5 56 49.0 57 35.5 58 23.0 59 19.0 60 13.0 61 7.5 62 8.5 63 8.0 64 5.5 65 3.5 66 3.5 67 2.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.335 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.12 105-109 0.44999999999999996 110-114 1.505 115-119 3.765 120-124 3.3300000000000005 125-129 1.865 130-134 0.12 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54682779456193 98.85000000000001 2 0.3776435045317221 0.75 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025176233635448138 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 10 0.25 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.5375 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.375 0.0 0.0 0.0 0.0 94-95 1.4625 0.0 0.0 0.0 0.0 96-97 1.6375000000000002 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.1875 0.0 0.0 0.0 0.0 102-103 2.575 0.0 0.0 0.0 0.0 104-105 2.9000000000000004 0.0 0.0 0.0 0.0 106-107 3.3499999999999996 0.0 0.0 0.0 0.0 108-109 3.8375 0.0 0.0 0.0 0.0 110-111 4.1875 0.0 0.0 0.0 0.0 112-113 4.550000000000001 0.0 0.0 0.0 0.0 114-115 5.1 0.0 0.0 0.0 0.0 116-117 5.75 0.0 0.0 0.0 0.0 118-119 6.2625 0.0 0.0 0.0 0.0 120-121 6.9625 0.0 0.0 0.0 0.0 122-123 7.4625 0.0 0.0 0.0 0.0 124-125 8.162500000000001 0.0 0.0 0.0 0.0 126-127 8.825 0.0 0.0 0.0 0.0 128-129 9.55 0.0 0.0 0.0 0.0 130-131 10.4125 0.0 0.0 0.0 0.0 132-133 11.125 0.0 0.0 0.0 0.0 134-135 11.875 0.0 0.0 0.0 0.0 136-137 12.6625 0.0 0.0 0.0 0.0 138-139 13.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTCTC 10 0.007026399 143.6375 5 ATTCTCT 10 0.007026399 143.6375 6 TTTTGTT 10 0.007026399 143.6375 5 TTTTTTT 35 0.0033203184 20.938412 100-104 >>END_MODULE Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649109 spots for SRR7169776.sra Written 649109 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra Read 649103 spots for SRR7169776.sra Written 649103 spots for SRR7169776.sra SRR ids: ['SRR7169776.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x2jgaam3 SRR7169776.sra spots: 12982066 blocks: [[1, 649103], [649104, 1298206], [1298207, 1947309], [1947310, 2596412], [2596413, 3245515], [3245516, 3894618], [3894619, 4543721], [4543722, 5192824], [5192825, 5841927], [5841928, 6491030], [6491031, 7140133], [7140134, 7789236], [7789237, 8438339], [8438340, 9087442], [9087443, 9736545], [9736546, 10385648], [10385649, 11034751], [11034752, 11683854], [11683855, 12332957], [12332958, 12982066]] SRR7169776 file size 4377495 SRR7169776 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169776 SRR7169776_1.fastq SRR7169776_2.fastq Input file: SRR7169776_1.fastq Paired file: SRR7169776_2.fastq trimmed: SRR7169776-trimmed-pair1.fastq, SRR7169776-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:16:30 2025 >> started Tue Feb 11 16:16:44 2025 >> done (13.905s) 12982066 read pairs processed; of these: 23095 ( 0.18%) short read pairs filtered out after trimming by size control 50448 ( 0.39%) empty read pairs filtered out after trimming by size control 12908523 (99.43%) read pairs available; of these: 6566362 (50.87%) trimmed read pairs available after processing 6342161 (49.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 6 0.00% 21 5 0.00% 22 8 0.00% 23 7 0.00% 24 10 0.00% 25 9 0.00% 26 17 0.00% 27 10 0.00% 28 8 0.00% 29 17 0.00% 30 23 0.00% 31 17 0.00% 32 17 0.00% 33 16 0.00% 34 16 0.00% 35 19 0.00% 36 17 0.00% 37 23 0.00% 38 31 0.00% 39 39 0.00% 40 36 0.00% 41 37 0.00% 42 51 0.00% 43 46 0.00% 44 52 0.00% 45 62 0.00% 46 77 0.00% 47 87 0.00% 48 93 0.00% 49 102 0.00% 50 111 0.00% 51 155 0.00% 52 189 0.00% 53 189 0.00% 54 197 0.00% 55 234 0.00% 56 258 0.00% 57 305 0.00% 58 371 0.00% 59 398 0.00% 60 491 0.00% 61 589 0.00% 62 672 0.01% 63 777 0.01% 64 877 0.01% 65 866 0.01% 66 1059 0.01% 67 1250 0.01% 68 1350 0.01% 69 1541 0.01% 70 1786 0.01% 71 1947 0.02% 72 2254 0.02% 73 2586 0.02% 74 3006 0.02% 75 3525 0.03% 76 4329 0.03% 77 4932 0.04% 78 4628 0.04% 79 5094 0.04% 80 5662 0.04% 81 6077 0.05% 82 7083 0.05% 83 8070 0.06% 84 9786 0.08% 85 11246 0.09% 86 11960 0.09% 87 12521 0.10% 88 13530 0.10% 89 13851 0.11% 90 15008 0.12% 91 15724 0.12% 92 16800 0.13% 93 18677 0.14% 94 19857 0.15% 95 21325 0.17% 96 22137 0.17% 97 22982 0.18% 98 23332 0.18% 99 24137 0.19% 100 25155 0.19% 101 26138 0.20% 102 28223 0.22% 103 29517 0.23% 104 31292 0.24% 105 32985 0.26% 106 34103 0.26% 107 34219 0.27% 108 35273 0.27% 109 36370 0.28% 110 37004 0.29% 111 37724 0.29% 112 39179 0.30% 113 41529 0.32% 114 43000 0.33% 115 44754 0.35% 116 45505 0.35% 117 46822 0.36% 118 47052 0.36% 119 47520 0.37% 120 48096 0.37% 121 49155 0.38% 122 50018 0.39% 123 52380 0.41% 124 53913 0.42% 125 55640 0.43% 126 57641 0.45% 127 58223 0.45% 128 58867 0.46% 129 59712 0.46% 130 59902 0.46% 131 60755 0.47% 132 62843 0.49% 133 64202 0.50% 134 66414 0.51% 135 68736 0.53% 136 70463 0.55% 137 72430 0.56% 138 74715 0.58% 139 76804 0.59% 140 78894 0.61% 141 82948 0.64% 142 88457 0.69% 143 94888 0.74% 144 105055 0.81% 145 119035 0.92% 146 139833 1.08% 147 176849 1.37% 148 254416 1.97% 149 484215 3.75% 150 2630800 20.38% 151 6342161 49.13% 12908523 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=40 prefix-density=0.18 prefix-fanout=2.3 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=45 fanout-score=273.63 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.70 fanout-score-rank=23 prefix-density=0.25 prefix-fanout=4.6 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTGGGGCTGAATCTCCCGATGGAGAGGATGGTGATGAAGGAGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=72.66 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.8 sequence=CACCACCACTGGTAACAAGGACATCATCATGGTTGATCACATGAGGAAGATGAAGAACAATGCCATTGTCTGCAACATCGGTCACTTCGATAATGAAATCGACATGCTTGGACTTGAGACCTTCCCTGGCGTGAAGCGCATCACCATCAAGCCCCAAACTGACAGGTGGGTCTTCCCTGACACCAACTCCGGCATCATTGTCCTGGCTGAGGGACGTCTCATGAACCTGGGATGTGCCACCGGTCACCCCAGCTTTGTGATGTCCTGCTCATTCACCAACCAGGTGAT SRR7169776 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:17:28 Started mapping on | Feb 11 16:17:29 Finished on | Feb 11 16:18:35 Mapping speed, Million of reads per hour | 704.10 Number of input reads | 12908523 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 12145775 Uniquely mapped reads % | 94.09% Average mapped length | 287.92 Number of splices: Total | 10453017 Number of splices: Annotated (sjdb) | 10268532 Number of splices: GT/AG | 10302270 Number of splices: GC/AG | 119738 Number of splices: AT/AC | 9121 Number of splices: Non-canonical | 21888 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 216900 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 19204 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.04% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 564519 564519 564519 N_multimapping 216900 216900 216900 N_noFeature 253485 11984662 327196 N_ambiguous 134343 668 46517 UnstrandedReadsAssigned:11757947 PositiveStrandReadsAssigned:160445 NegativeStrandReadsAssigned:11772062 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7169776 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169776-trimmed-pair1.fastq SRR7169776-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,908,523 reads, 11,736,139 reads pseudoaligned [quant] estimated average fragment length: 202.3 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR7169776.ke.tsv 34699 SRR7169776.se.tsv 87100 total ==> SRR7169776.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1816.7 197 8.86082 Potri.005G024800.1.v4.1 1035 833.7 29 2.84236 Potri.004G059700.1.v4.1 961 759.708 4 0.430234 Potri.007G009000.2.v4.1 1416 1214.7 0 0 Potri.003G141000.2.v4.1 2943 2741.7 187 5.5733 Potri.016G087400.1.v4.1 270 96.301 1372 1164.17 Potri.015G069301.1.v4.1 564 363.793 0 0 Potri.010G195200.1.v4.1 1773 1571.7 17 0.883833 Potri.012G127500.1.v4.1 977 775.7 5958 627.621 ==> SRR7169776.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1171 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169776 completed mapping pipeline successfully