Starting /dee2/code/volunteer_pipeline.sh SRR7169777 current disk space = 3050178256896 free memory = 1404403776 SRR7169777 SRAfilesize bb93699683e881ee698dc0d14ae5f4f3 SRR7169777.sra SRR7169777.sra file validated SRR7169777 is paired end SRR7169777 is conventional basespace SRR7169777 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169777_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.02 27.0 18.0 33.0 18.0 33.0 2 26.11875 27.0 18.0 31.0 18.0 33.0 3 29.57825 30.0 29.0 33.0 25.0 33.0 4 31.65 33.0 31.0 33.0 29.0 33.0 5 32.585 33.0 33.0 33.0 32.0 33.0 6 36.9535 38.0 37.0 38.0 35.0 38.0 7 37.3385 38.0 38.0 38.0 36.0 38.0 8 37.61425 38.0 38.0 38.0 37.0 38.0 9 37.707 38.0 38.0 38.0 38.0 38.0 10-14 37.74229999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.78144999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.7743 38.0 38.0 38.0 38.0 38.0 25-29 37.76995 38.0 38.0 38.0 38.0 38.0 30-34 37.698699999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.57615 38.0 38.0 38.0 38.0 38.0 40-44 37.55159999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.51715 38.0 38.0 38.0 38.0 38.0 50-54 37.3072 38.0 38.0 38.0 37.2 38.0 55-59 37.4483 38.0 38.0 38.0 37.4 38.0 60-64 37.4716 38.0 38.0 38.0 37.4 38.0 65-69 37.11315 38.0 38.0 38.0 36.2 38.0 70-74 37.32725000000001 38.0 38.0 38.0 36.8 38.0 75-79 37.20395 38.0 38.0 38.0 36.8 38.0 80-84 36.9877 38.0 38.0 38.0 36.2 38.0 85-89 36.899950000000004 38.0 38.0 38.0 35.8 38.0 90-94 36.86615 38.0 38.0 38.0 36.0 38.0 95-99 36.88645 38.0 38.0 38.0 35.6 38.0 100-104 36.75385 38.0 38.0 38.0 35.0 38.0 105-109 36.62585 38.0 38.0 38.0 34.8 38.0 110-114 36.331100000000006 38.0 38.0 38.0 34.2 38.0 115-119 35.6811 38.0 36.6 38.0 30.6 38.0 120-124 36.246300000000005 38.0 37.4 38.0 34.0 38.0 125-129 35.129949999999994 38.0 35.4 38.0 27.0 38.0 130-134 35.0536 38.0 35.4 38.0 27.0 38.0 135-139 35.4068 38.0 36.0 38.0 31.0 38.0 140-144 34.836650000000006 38.0 35.2 38.0 29.2 38.0 145-149 34.42295 38.0 35.0 38.0 27.4 38.0 150-151 30.560499999999998 36.0 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 3.0 13 0.0 14 1.0 15 2.0 16 2.0 17 2.0 18 3.0 19 12.0 20 1.0 21 1.0 22 4.0 23 4.0 24 9.0 25 6.0 26 7.0 27 13.0 28 14.0 29 5.0 30 22.0 31 31.0 32 37.0 33 81.0 34 126.0 35 314.0 36 1019.0 37 2279.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.34938240483993 11.34358457272498 10.007562389715149 36.29947063271994 2 24.175 14.674999999999999 32.7 28.449999999999996 3 20.175 19.05 25.924999999999997 34.849999999999994 4 24.425 26.0 22.35 27.224999999999998 5 22.8 30.15 24.625 22.425 6 19.775000000000002 34.5 24.8 20.925 7 14.374999999999998 27.224999999999998 40.699999999999996 17.7 8 18.025 26.025 29.675 26.275 9 17.275 25.924999999999997 33.375 23.425 10-14 19.3 30.785 27.095000000000002 22.82 15-19 19.625 29.37 27.445000000000004 23.56 20-24 19.885 29.330000000000002 27.825 22.96 25-29 20.330000000000002 29.294999999999998 26.790000000000003 23.585 30-34 19.195 29.74 27.205000000000002 23.86 35-39 19.985 29.509999999999998 27.250000000000004 23.255 40-44 19.994999999999997 29.575000000000003 27.015 23.415 45-49 19.905 28.775000000000002 27.405 23.915 50-54 20.395 28.799999999999997 27.025 23.78 55-59 19.994999999999997 28.575 27.694999999999997 23.735 60-64 20.055 28.865000000000002 27.375 23.705000000000002 65-69 19.78 28.634999999999998 27.500000000000004 24.085 70-74 20.205000000000002 29.185 27.235 23.375 75-79 20.3 29.439999999999998 26.5 23.76 80-84 20.52 29.07 26.619999999999997 23.79 85-89 20.575 28.425 27.084999999999997 23.915 90-94 20.48 28.720000000000002 27.089999999999996 23.71 95-99 20.419999999999998 27.834999999999997 27.93 23.815 100-104 20.54 28.33 26.66 24.47 105-109 20.025000000000002 28.549999999999997 27.389999999999997 24.035 110-114 21.091475047695553 28.73782508283964 26.70950898684607 23.461190882618737 115-119 20.96 29.04 26.240000000000002 23.76 120-124 21.615000000000002 28.799999999999997 26.02 23.565 125-129 21.05 28.689999999999998 26.135 24.125 130-134 20.52 28.7 26.755000000000003 24.025 135-139 20.990000000000002 28.294999999999998 26.91 23.805 140-144 20.84 28.660000000000004 26.015 24.485 145-149 20.255000000000003 27.955000000000002 26.875 24.915000000000003 150-151 20.3875 27.500000000000004 26.674999999999997 25.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.5 20 1.5 21 0.0 22 0.5 23 2.0 24 2.5 25 3.0 26 3.0 27 2.0 28 6.5 29 12.5 30 19.0 31 28.5 32 39.0 33 44.0 34 56.0 35 74.0 36 90.5 37 115.0 38 132.0 39 149.0 40 179.5 41 210.0 42 229.0 43 254.0 44 275.5 45 276.0 46 277.5 47 256.0 48 226.0 49 209.5 50 164.5 51 132.5 52 118.5 53 94.5 54 79.0 55 62.0 56 45.5 57 34.0 58 29.5 59 20.5 60 10.5 61 9.5 62 7.5 63 4.0 64 2.5 65 2.5 66 1.5 67 0.5 68 0.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.41000000000000003 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21697398332913 98.2 2 0.7072493053801465 1.4000000000000001 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025258903763576663 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 10 0.25 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.1625 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.48750000000000004 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 1.075 0.0 0.0 0.0 0.0 92-93 1.425 0.0 0.0 0.0 0.0 94-95 1.75 0.0 0.0 0.0 0.0 96-97 2.025 0.0 0.0 0.0 0.0 98-99 2.3375000000000004 0.0 0.0 0.0 0.0 100-101 2.6625 0.0 0.0 0.0 0.0 102-103 2.8875 0.0 0.0 0.0 0.0 104-105 3.325 0.0 0.0 0.0 0.0 106-107 3.9875 0.0 0.0 0.0 0.0 108-109 4.6375 0.0 0.0 0.0 0.0 110-111 5.3125 0.0 0.0 0.0 0.0 112-113 5.925000000000001 0.0 0.0 0.0 0.0 114-115 6.512499999999999 0.0 0.0 0.0 0.0 116-117 7.2 0.0 0.0 0.0 0.0 118-119 8.0875 0.0 0.0 0.0 0.0 120-121 8.6 0.0 0.0 0.0 0.0 122-123 9.287500000000001 0.0 0.0 0.0 0.0 124-125 9.925 0.0 0.0 0.0 0.0 126-127 10.7 0.0 0.0 0.0 0.0 128-129 11.399999999999999 0.0 0.0 0.0 0.0 130-131 12.225000000000001 0.0 0.0 0.0 0.0 132-133 13.0625 0.0 0.0 0.0 0.0 134-135 14.05 0.0 0.0 0.0 0.0 136-137 15.0875 0.0 0.0 0.0 0.0 138-139 16.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATGT 10 0.0068484643 144.875 3 >>END_MODULE SRR7169777 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169777_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.918 33.0 33.0 34.0 32.0 34.0 2 33.1215 33.0 33.0 34.0 33.0 34.0 3 32.2985 33.0 33.0 34.0 31.0 34.0 4 32.48625 33.0 33.0 34.0 32.0 34.0 5 33.03425 33.0 33.0 34.0 32.0 34.0 6 37.462 38.0 38.0 38.0 37.0 38.0 7 37.4945 38.0 38.0 38.0 38.0 38.0 8 37.53725 38.0 38.0 38.0 38.0 38.0 9 37.47025 38.0 38.0 38.0 38.0 38.0 10-14 37.52075 38.0 38.0 38.0 38.0 38.0 15-19 37.548950000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.01425 38.0 38.0 38.0 35.4 38.0 25-29 37.4813 38.0 38.0 38.0 38.0 38.0 30-34 37.50515 38.0 38.0 38.0 38.0 38.0 35-39 37.491099999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.4074 38.0 38.0 38.0 38.0 38.0 45-49 37.43425 38.0 38.0 38.0 38.0 38.0 50-54 37.4298 38.0 38.0 38.0 38.0 38.0 55-59 37.355000000000004 38.0 38.0 38.0 37.8 38.0 60-64 37.1745 38.0 38.0 38.0 36.8 38.0 65-69 37.1791 38.0 38.0 38.0 37.0 38.0 70-74 37.1149 38.0 38.0 38.0 36.6 38.0 75-79 36.838800000000006 38.0 38.0 38.0 36.4 38.0 80-84 36.42719999999999 38.0 37.6 38.0 34.0 38.0 85-89 36.89615 38.0 38.0 38.0 36.0 38.0 90-94 37.0347 38.0 38.0 38.0 36.6 38.0 95-99 36.952549999999995 38.0 38.0 38.0 36.2 38.0 100-104 36.69615 38.0 38.0 38.0 35.4 38.0 105-109 35.4708 38.0 37.0 38.0 29.2 38.0 110-114 35.1348 38.0 37.6 38.0 30.8 38.0 115-119 34.3333 38.0 37.0 38.0 23.4 38.0 120-124 34.295 38.0 36.2 38.0 25.0 38.0 125-129 34.32235 38.0 36.2 38.0 24.0 38.0 130-134 35.070550000000004 38.0 36.0 38.0 28.6 38.0 135-139 35.1809 38.0 36.0 38.0 30.6 38.0 140-144 34.8418 38.0 36.0 38.0 30.0 38.0 145-149 34.05345 38.0 33.8 38.0 25.8 38.0 150-151 29.748375 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 1.0 5 2.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 3.0 13 2.0 14 2.0 15 1.0 16 0.0 17 3.0 18 6.0 19 5.0 20 7.0 21 2.0 22 2.0 23 2.0 24 9.0 25 6.0 26 13.0 27 13.0 28 25.0 29 37.0 30 48.0 31 59.0 32 97.0 33 106.0 34 140.0 35 249.0 36 609.0 37 2539.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.475 21.0 15.425 28.1 2 27.700000000000003 25.324999999999996 30.175 16.8 3 21.525 27.575 30.825000000000003 20.075000000000003 4 24.625 31.95 24.25 19.175 5 24.525 35.925000000000004 22.125 17.424999999999997 6 21.65 37.025000000000006 23.799999999999997 17.525 7 21.099999999999998 21.75 38.425 18.725 8 22.95 26.05 25.775 25.224999999999998 9 23.474999999999998 25.624999999999996 28.95 21.95 10-14 23.990000000000002 28.744999999999997 26.0 21.265 15-19 23.75 27.965 27.43 20.855 20-24 23.485 28.205000000000002 27.01 21.3 25-29 24.125 28.185 26.779999999999998 20.91 30-34 23.225 28.525 26.99 21.26 35-39 23.990000000000002 28.255000000000003 27.155 20.599999999999998 40-44 24.09 28.035 26.919999999999998 20.955 45-49 23.630000000000003 28.410000000000004 27.12 20.84 50-54 23.21 27.915 27.73 21.145 55-59 24.47 27.794999999999998 27.400000000000002 20.335 60-64 24.08 27.565 27.37 20.985 65-69 24.099999999999998 27.634999999999998 27.845 20.419999999999998 70-74 24.44 28.050000000000004 27.250000000000004 20.26 75-79 24.172886826709703 28.23280209804317 27.879765987492434 19.71454508775469 80-84 24.427480916030532 27.249899558055446 27.661711530735232 20.660907995178786 85-89 23.96 27.644999999999996 27.785 20.61 90-94 24.16 28.475 27.634999999999998 19.73 95-99 23.765 27.805000000000003 28.09 20.34 100-104 24.468457651708437 27.480114062734508 28.155485517034368 19.895942768522687 105-109 24.166582737435792 27.580823849330244 27.71175344949139 20.54083996374257 110-114 24.649454131525843 28.22476328452424 27.552129145754645 19.573653438195272 115-119 24.91120182367598 28.367703970736365 26.952234533213172 19.76885967237449 120-124 25.48640167364017 27.510460251046027 27.233263598326356 19.769874476987447 125-129 25.63914884717938 28.122549275892716 26.893919590108222 19.344382286819677 130-134 26.06501110438118 28.184938421158893 26.60004037956794 19.150010094891982 135-139 25.72 27.534999999999997 27.16 19.585 140-144 26.705000000000002 27.605 26.69 19.0 145-149 27.18 26.924999999999997 26.119999999999997 19.775000000000002 150-151 26.687499999999996 27.962500000000002 26.2875 19.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.5 27 2.5 28 3.5 29 3.5 30 6.0 31 12.0 32 21.0 33 25.0 34 31.0 35 49.0 36 76.0 37 108.0 38 132.0 39 165.5 40 192.5 41 202.5 42 239.5 43 258.5 44 272.5 45 288.0 46 292.0 47 298.0 48 247.0 49 207.5 50 195.5 51 165.5 52 123.0 53 91.5 54 83.5 55 59.5 56 32.5 57 25.0 58 25.5 59 21.5 60 12.5 61 7.0 62 5.5 63 3.0 64 2.0 65 2.0 66 2.0 67 1.5 68 0.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.86 80-84 0.44 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.7100000000000001 110-114 3.3649999999999998 115-119 5.685 120-124 4.3999999999999995 125-129 4.365 130-134 0.9400000000000001 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62302085951245 99.1 2 0.3518471977883891 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025131942699170642 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.1625 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.8500000000000001 0.0 0.0 0.0 0.0 90-91 1.1 0.0 0.0 0.0 0.0 92-93 1.4375 0.0 0.0 0.0 0.0 94-95 1.775 0.0 0.0 0.0 0.0 96-97 2.0625 0.0 0.0 0.0 0.0 98-99 2.3875 0.0 0.0 0.0 0.0 100-101 2.7125 0.0 0.0 0.0 0.0 102-103 2.925 0.0 0.0 0.0 0.0 104-105 3.2625 0.0 0.0 0.0 0.0 106-107 3.85 0.0 0.0 0.0 0.0 108-109 4.449999999999999 0.0 0.0 0.0 0.0 110-111 5.112500000000001 0.0 0.0 0.0 0.0 112-113 5.737500000000001 0.0 0.0 0.0 0.0 114-115 6.225 0.0 0.0 0.0 0.0 116-117 6.8875 0.0 0.0 0.0 0.0 118-119 7.7 0.0 0.0 0.0 0.0 120-121 8.225 0.0 0.0 0.0 0.0 122-123 8.85 0.0 0.0 0.0 0.0 124-125 9.4875 0.0 0.0 0.0 0.0 126-127 10.2625 0.0 0.0 0.0 0.0 128-129 11.0 0.0 0.0 0.0 0.0 130-131 11.8 0.0 0.0 0.0 0.0 132-133 12.662500000000001 0.0 0.0 0.0 0.0 134-135 13.587499999999999 0.0 0.0 0.0 0.0 136-137 14.5875 0.0 0.0 0.0 0.0 138-139 15.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATGTC 10 0.007107461 143.0875 4 ATGCAGT 10 0.007107461 143.0875 8 >>END_MODULE Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706442 spots for SRR7169777.sra Written 706442 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra Read 706432 spots for SRR7169777.sra Written 706432 spots for SRR7169777.sra SRR ids: ['SRR7169777.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vlgqkoga SRR7169777.sra spots: 14128650 blocks: [[1, 706432], [706433, 1412864], [1412865, 2119296], [2119297, 2825728], [2825729, 3532160], [3532161, 4238592], [4238593, 4945024], [4945025, 5651456], [5651457, 6357888], [6357889, 7064320], [7064321, 7770752], [7770753, 8477184], [8477185, 9183616], [9183617, 9890048], [9890049, 10596480], [10596481, 11302912], [11302913, 12009344], [12009345, 12715776], [12715777, 13422208], [13422209, 14128650]] SRR7169777 file size 4766035 SRR7169777 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169777 SRR7169777_1.fastq SRR7169777_2.fastq Input file: SRR7169777_1.fastq Paired file: SRR7169777_2.fastq trimmed: SRR7169777-trimmed-pair1.fastq, SRR7169777-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:30:56 2025 >> started Tue Feb 11 14:31:12 2025 >> done (15.632s) 14128650 read pairs processed; of these: 11568 ( 0.08%) short read pairs filtered out after trimming by size control 46413 ( 0.33%) empty read pairs filtered out after trimming by size control 14070669 (99.59%) read pairs available; of these: 7700772 (54.73%) trimmed read pairs available after processing 6369897 (45.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 5 0.00% 21 2 0.00% 22 12 0.00% 23 2 0.00% 24 6 0.00% 25 7 0.00% 26 8 0.00% 27 7 0.00% 28 6 0.00% 29 7 0.00% 30 10 0.00% 31 18 0.00% 32 16 0.00% 33 16 0.00% 34 24 0.00% 35 17 0.00% 36 24 0.00% 37 36 0.00% 38 38 0.00% 39 48 0.00% 40 63 0.00% 41 56 0.00% 42 72 0.00% 43 72 0.00% 44 90 0.00% 45 83 0.00% 46 108 0.00% 47 123 0.00% 48 137 0.00% 49 166 0.00% 50 223 0.00% 51 243 0.00% 52 238 0.00% 53 290 0.00% 54 324 0.00% 55 387 0.00% 56 402 0.00% 57 452 0.00% 58 556 0.00% 59 634 0.00% 60 714 0.01% 61 815 0.01% 62 941 0.01% 63 1022 0.01% 64 1224 0.01% 65 1365 0.01% 66 1420 0.01% 67 1687 0.01% 68 1815 0.01% 69 2057 0.01% 70 2495 0.02% 71 2780 0.02% 72 3292 0.02% 73 3730 0.03% 74 4133 0.03% 75 4736 0.03% 76 5606 0.04% 77 6596 0.05% 78 6647 0.05% 79 7076 0.05% 80 7753 0.06% 81 8545 0.06% 82 9607 0.07% 83 10616 0.08% 84 12179 0.09% 85 13581 0.10% 86 14839 0.11% 87 15814 0.11% 88 16719 0.12% 89 17393 0.12% 90 18605 0.13% 91 19814 0.14% 92 21388 0.15% 93 23414 0.17% 94 24895 0.18% 95 26646 0.19% 96 27825 0.20% 97 28536 0.20% 98 29792 0.21% 99 30342 0.22% 100 31659 0.22% 101 33043 0.23% 102 34748 0.25% 103 36412 0.26% 104 38211 0.27% 105 40235 0.29% 106 41665 0.30% 107 42776 0.30% 108 42964 0.31% 109 44349 0.32% 110 44765 0.32% 111 45848 0.33% 112 47063 0.33% 113 49327 0.35% 114 50857 0.36% 115 52762 0.37% 116 54633 0.39% 117 54906 0.39% 118 55839 0.40% 119 55603 0.40% 120 56085 0.40% 121 57084 0.41% 122 58223 0.41% 123 60129 0.43% 124 62394 0.44% 125 63498 0.45% 126 65444 0.47% 127 66839 0.48% 128 68011 0.48% 129 68196 0.48% 130 69437 0.49% 131 69931 0.50% 132 70887 0.50% 133 73147 0.52% 134 74666 0.53% 135 77585 0.55% 136 79901 0.57% 137 82508 0.59% 138 85170 0.61% 139 87938 0.62% 140 91133 0.65% 141 96310 0.68% 142 102280 0.73% 143 107471 0.76% 144 121320 0.86% 145 139791 0.99% 146 164218 1.17% 147 215855 1.53% 148 313940 2.23% 149 607909 4.32% 150 3002316 21.34% 151 6369897 45.27% 14070669 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=36 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=129.36 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=6.6 sequence=AAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=42 prefix-density=0.22 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=133.72 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169777 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:31:54 Started mapping on | Feb 11 14:31:54 Finished on | Feb 11 14:33:10 Mapping speed, Million of reads per hour | 666.51 Number of input reads | 14070669 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 13421746 Uniquely mapped reads % | 95.39% Average mapped length | 286.78 Number of splices: Total | 11418506 Number of splices: Annotated (sjdb) | 11214478 Number of splices: GT/AG | 11247775 Number of splices: GC/AG | 134352 Number of splices: AT/AC | 10081 Number of splices: Non-canonical | 26298 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 247294 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 22256 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 411494 411494 411494 N_multimapping 247294 247294 247294 N_noFeature 282246 13240732 367658 N_ambiguous 141938 864 45731 UnstrandedReadsAssigned:12997562 PositiveStrandReadsAssigned:180150 NegativeStrandReadsAssigned:13008357 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR7169777 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169777-trimmed-pair1.fastq SRR7169777-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,070,669 reads, 12,968,769 reads pseudoaligned [quant] estimated average fragment length: 200.725 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52401 SRR7169777.ke.tsv 34699 SRR7169777.se.tsv 87100 total ==> SRR7169777.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1818.28 241 9.40813 Potri.005G024800.1.v4.1 1035 835.275 54 4.58891 Potri.004G059700.1.v4.1 961 761.294 7 0.652667 Potri.007G009000.2.v4.1 1416 1216.28 0 0 Potri.003G141000.2.v4.1 2943 2743.28 228 5.89945 Potri.016G087400.1.v4.1 270 98.9285 1742 1249.89 Potri.015G069301.1.v4.1 564 365.583 0 0 Potri.010G195200.1.v4.1 1773 1573.28 25 1.12793 Potri.012G127500.1.v4.1 977 777.282 7956 726.545 ==> SRR7169777.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 749 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 334 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169777 completed mapping pipeline successfully