Starting /dee2/code/volunteer_pipeline.sh SRR7169778 current disk space = 3049445244928 free memory = 1506556840 SRR7169778 SRAfilesize c16f8dc14ca54bffec7bfb29e851940b SRR7169778.sra SRR7169778.sra file validated SRR7169778 is paired end SRR7169778 is conventional basespace SRR7169778 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169778_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.5115 31.0 25.0 33.0 18.0 33.0 2 27.064 29.0 25.0 31.0 18.0 33.0 3 30.3755 31.0 29.0 33.0 27.0 33.0 4 32.0615 33.0 31.0 33.0 30.0 33.0 5 32.6155 33.0 33.0 33.0 32.0 34.0 6 36.5405 38.0 37.0 38.0 34.0 38.0 7 37.157 38.0 38.0 38.0 36.0 38.0 8 37.5215 38.0 38.0 38.0 37.0 38.0 9 37.60575 38.0 38.0 38.0 38.0 38.0 10-14 37.60940000000001 38.0 38.0 38.0 37.8 38.0 15-19 37.62135 38.0 38.0 38.0 38.0 38.0 20-24 37.65304999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.6319 38.0 38.0 38.0 38.0 38.0 30-34 37.5837 38.0 38.0 38.0 38.0 38.0 35-39 37.438050000000004 38.0 38.0 38.0 37.6 38.0 40-44 37.2238 38.0 38.0 38.0 36.8 38.0 45-49 37.4002 38.0 38.0 38.0 37.0 38.0 50-54 37.447950000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.4095 38.0 38.0 38.0 37.0 38.0 60-64 37.33795 38.0 38.0 38.0 37.0 38.0 65-69 37.24775 38.0 38.0 38.0 36.8 38.0 70-74 37.1798 38.0 38.0 38.0 36.0 38.0 75-79 37.180600000000005 38.0 38.0 38.0 36.4 38.0 80-84 37.09145 38.0 38.0 38.0 36.0 38.0 85-89 36.9678 38.0 38.0 38.0 36.0 38.0 90-94 36.842 38.0 38.0 38.0 35.4 38.0 95-99 36.8846 38.0 38.0 38.0 35.4 38.0 100-104 36.73735 38.0 38.0 38.0 34.8 38.0 105-109 36.463100000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.4379 38.0 38.0 38.0 34.0 38.0 115-119 36.3112 38.0 37.4 38.0 34.0 38.0 120-124 36.17355 38.0 37.0 38.0 33.4 38.0 125-129 35.9893 38.0 37.0 38.0 33.0 38.0 130-134 35.581900000000005 38.0 36.2 38.0 30.8 38.0 135-139 35.314750000000004 38.0 35.8 38.0 30.4 38.0 140-144 35.0664 38.0 35.4 38.0 29.2 38.0 145-149 34.5215 38.0 35.0 38.0 27.8 38.0 150-151 30.72475 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 4.0 18 3.0 19 2.0 20 2.0 21 3.0 22 1.0 23 4.0 24 5.0 25 8.0 26 8.0 27 9.0 28 19.0 29 22.0 30 33.0 31 35.0 32 70.0 33 80.0 34 126.0 35 248.0 36 830.0 37 2482.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.31642694928085 10.522331566994701 9.613928841786526 37.54731264193792 2 24.2 14.85 33.7 27.250000000000004 3 20.95 19.325 25.624999999999996 34.1 4 22.55 28.199999999999996 23.025000000000002 26.224999999999998 5 22.55 32.925 24.5 20.025000000000002 6 19.325 37.0 24.3 19.375 7 15.174999999999999 25.85 41.375 17.599999999999998 8 18.425 24.6 31.55 25.424999999999997 9 17.0 25.1 34.275 23.625 10-14 20.3 30.165 26.755000000000003 22.78 15-19 19.765 28.975 28.015 23.244999999999997 20-24 19.855 29.385 27.815 22.945 25-29 20.225 29.485 27.12 23.169999999999998 30-34 20.115 29.215000000000003 27.08 23.59 35-39 20.185 29.14 27.224999999999998 23.45 40-44 20.560000000000002 29.2 27.200000000000003 23.04 45-49 20.19 29.095 27.305 23.41 50-54 20.405 28.605000000000004 27.405 23.585 55-59 20.549999999999997 28.705000000000002 27.084999999999997 23.66 60-64 19.955000000000002 29.04 27.389999999999997 23.615 65-69 19.71 28.33 28.24 23.72 70-74 20.674999999999997 29.275000000000002 27.005000000000003 23.044999999999998 75-79 20.674999999999997 28.16 27.125 24.04 80-84 20.165 28.310000000000002 27.77 23.755000000000003 85-89 21.205 28.52 27.38 22.895 90-94 20.52 28.645 26.900000000000002 23.935000000000002 95-99 20.205000000000002 28.389999999999997 27.415 23.990000000000002 100-104 20.905 28.410000000000004 26.91 23.775 105-109 21.01 29.195 26.445 23.35 110-114 20.595 29.630000000000003 26.245 23.53 115-119 21.12 29.054999999999996 26.33 23.494999999999997 120-124 21.25 28.575 26.545 23.630000000000003 125-129 21.185000000000002 28.79 26.76 23.265 130-134 20.715 28.76 26.66 23.865 135-139 21.7 28.52 26.419999999999998 23.36 140-144 20.61 28.665000000000003 26.655 24.07 145-149 20.665 28.38 26.6 24.355 150-151 20.525 28.4375 26.2625 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 2.0 26 4.5 27 9.5 28 11.5 29 9.5 30 16.0 31 30.0 32 42.0 33 47.5 34 53.0 35 66.0 36 88.0 37 104.0 38 125.0 39 154.5 40 171.5 41 215.5 42 255.5 43 261.5 44 256.5 45 258.0 46 263.5 47 265.0 48 250.5 49 212.5 50 177.0 51 153.0 52 119.5 53 95.0 54 79.0 55 54.0 56 42.5 57 29.0 58 16.5 59 12.0 60 12.0 61 10.5 62 6.0 63 4.0 64 4.0 65 2.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.4273504273504274 0.8500000000000001 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.9625 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.925 0.0 0.0 0.0 0.0 102-103 2.3375 0.0 0.0 0.0 0.0 104-105 2.7249999999999996 0.0 0.0 0.0 0.0 106-107 3.125 0.0 0.0 0.0 0.0 108-109 3.5 0.0 0.0 0.0 0.0 110-111 3.9749999999999996 0.0 0.0 0.0 0.0 112-113 4.4125 0.0 0.0 0.0 0.0 114-115 4.8125 0.0 0.0 0.0 0.0 116-117 5.3375 0.0 0.0 0.0 0.0 118-119 6.0375 0.0 0.0 0.0 0.0 120-121 6.574999999999999 0.0 0.0 0.0 0.0 122-123 7.0 0.0 0.0 0.0 0.0 124-125 7.5 0.0 0.0 0.0 0.0 126-127 8.1 0.0 0.0 0.0 0.0 128-129 8.712499999999999 0.0 0.0 0.0 0.0 130-131 9.3125 0.0 0.0 0.0 0.0 132-133 10.024999999999999 0.0 0.0 0.0 0.0 134-135 10.45 0.0 0.0 0.0 0.0 136-137 11.15 0.0 0.0 0.0 0.0 138-139 11.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169778 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169778_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88025 33.0 33.0 34.0 32.0 34.0 2 32.1715 33.0 33.0 34.0 30.0 34.0 3 32.8475 33.0 33.0 34.0 32.0 34.0 4 32.9765 34.0 33.0 34.0 32.0 34.0 5 33.12 34.0 33.0 34.0 33.0 34.0 6 37.28175 38.0 38.0 38.0 37.0 38.0 7 37.36525 38.0 38.0 38.0 38.0 38.0 8 37.389 38.0 38.0 38.0 38.0 38.0 9 37.397 38.0 38.0 38.0 38.0 38.0 10-14 37.38105 38.0 38.0 38.0 37.8 38.0 15-19 37.368100000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.31315 38.0 38.0 38.0 37.8 38.0 25-29 37.311 38.0 38.0 38.0 37.2 38.0 30-34 37.319599999999994 38.0 38.0 38.0 37.0 38.0 35-39 36.949850000000005 38.0 38.0 38.0 35.6 38.0 40-44 37.1871 38.0 38.0 38.0 37.0 38.0 45-49 36.77355 38.0 38.0 38.0 35.4 38.0 50-54 36.88675 38.0 38.0 38.0 36.0 38.0 55-59 36.501149999999996 38.0 37.8 38.0 34.2 38.0 60-64 37.0159 38.0 38.0 38.0 36.4 38.0 65-69 36.9525 38.0 38.0 38.0 36.4 38.0 70-74 36.933800000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.81805 38.0 38.0 38.0 35.8 38.0 80-84 36.81345 38.0 38.0 38.0 35.8 38.0 85-89 35.873400000000004 38.0 37.0 38.0 31.2 38.0 90-94 36.641200000000005 38.0 38.0 38.0 34.8 38.0 95-99 36.6931 38.0 38.0 38.0 35.2 38.0 100-104 36.55895 38.0 38.0 38.0 34.6 38.0 105-109 36.012950000000004 38.0 37.6 38.0 32.8 38.0 110-114 35.345099999999995 38.0 37.0 38.0 30.2 38.0 115-119 34.78509999999999 38.0 36.6 38.0 27.0 38.0 120-124 35.068949999999994 38.0 36.4 38.0 28.2 38.0 125-129 34.9439 38.0 36.0 38.0 27.8 38.0 130-134 34.341449999999995 38.0 35.0 38.0 23.8 38.0 135-139 34.2817 38.0 35.0 38.0 24.8 38.0 140-144 32.9656 37.6 32.6 38.0 19.0 38.0 145-149 32.68195 38.0 32.6 38.0 16.6 38.0 150-151 28.854 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 1.0 5 2.0 6 1.0 7 2.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 1.0 15 4.0 16 0.0 17 2.0 18 3.0 19 5.0 20 2.0 21 5.0 22 6.0 23 11.0 24 17.0 25 11.0 26 26.0 27 11.0 28 33.0 29 26.0 30 46.0 31 72.0 32 99.0 33 147.0 34 180.0 35 294.0 36 804.0 37 2177.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.275 20.875 14.825 28.025 2 26.974999999999998 26.0 30.675 16.35 3 21.775 27.175 30.475 20.575 4 24.175 32.725 23.575 19.525000000000002 5 24.375 35.875 21.375 18.375 6 19.5 38.324999999999996 23.875 18.3 7 18.925 21.975 40.1 19.0 8 21.9 25.174999999999997 27.750000000000004 25.174999999999997 9 22.575 24.175 29.799999999999997 23.45 10-14 24.19 28.13 26.200000000000003 21.48 15-19 23.385 27.800000000000004 27.705000000000002 21.11 20-24 23.125 27.644999999999996 28.134999999999998 21.095 25-29 23.56 27.815 27.93 20.695 30-34 22.585 28.22 28.17 21.025 35-39 23.3 27.785 27.755000000000003 21.16 40-44 23.400000000000002 27.865000000000002 28.000000000000004 20.735 45-49 23.119999999999997 28.005000000000003 27.839999999999996 21.035 50-54 23.419999999999998 27.884999999999998 28.055000000000003 20.64 55-59 23.27 27.544999999999998 28.65 20.535 60-64 23.615 27.37 28.32 20.695 65-69 23.535 27.715 28.17 20.580000000000002 70-74 23.185 27.834999999999997 28.439999999999998 20.54 75-79 23.515 27.33 28.235 20.919999999999998 80-84 23.64 27.74 27.96 20.66 85-89 23.375 27.450000000000003 28.73 20.445 90-94 23.875 28.21 27.694999999999997 20.22 95-99 23.45 28.125 27.794999999999998 20.630000000000003 100-104 23.985 27.615000000000002 28.265 20.135 105-109 24.349999999999998 27.939999999999998 27.384999999999998 20.325 110-114 24.653077822396178 28.216337111777563 27.042138972195396 20.088446093630864 115-119 24.26754544050255 28.556716955872506 26.826630966479588 20.349106637145358 120-124 25.01525010166735 27.938186254575033 27.109597397315984 19.936966246441642 125-129 24.76980673884448 28.210057674795102 27.117272083375493 19.902863502984925 130-134 25.165 27.755000000000003 27.139999999999997 19.939999999999998 135-139 25.995 27.52 26.915 19.57 140-144 25.674999999999997 27.83 26.775 19.72 145-149 25.790000000000003 27.644999999999996 27.529999999999998 19.035 150-151 26.650000000000002 27.212500000000002 26.275 19.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 1.0 24 1.5 25 2.0 26 2.5 27 4.5 28 5.5 29 4.5 30 6.0 31 10.0 32 19.5 33 31.0 34 48.5 35 61.5 36 81.0 37 111.5 38 135.0 39 166.5 40 197.0 41 207.0 42 256.0 43 296.5 44 292.5 45 286.5 46 288.5 47 268.5 48 228.5 49 204.5 50 177.0 51 149.5 52 115.0 53 91.0 54 68.0 55 44.0 56 34.0 57 25.5 58 19.0 59 18.5 60 12.0 61 6.5 62 4.0 63 2.5 64 2.5 65 2.5 66 2.0 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 1.635 115-119 2.895 120-124 1.6400000000000001 125-129 1.17 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.9625 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.9124999999999999 0.0 0.0 0.0 0.0 102-103 2.2875 0.0 0.0 0.0 0.0 104-105 2.6500000000000004 0.0 0.0 0.0 0.0 106-107 3.05 0.0 0.0 0.0 0.0 108-109 3.4375 0.0 0.0 0.0 0.0 110-111 3.8375000000000004 0.0 0.0 0.0 0.0 112-113 4.2 0.0 0.0 0.0 0.0 114-115 4.5875 0.0 0.0 0.0 0.0 116-117 5.1 0.0 0.0 0.0 0.0 118-119 5.7875 0.0 0.0 0.0 0.0 120-121 6.2875 0.0 0.0 0.0 0.0 122-123 6.7 0.0 0.0 0.0 0.0 124-125 7.2 0.0 0.0 0.0 0.0 126-127 7.800000000000001 0.0 0.0 0.0 0.0 128-129 8.412500000000001 0.0 0.0 0.0 0.0 130-131 8.9875 0.0 0.0 0.0 0.0 132-133 9.649999999999999 0.0 0.0 0.0 0.0 134-135 10.037500000000001 0.0 0.0 0.0 0.0 136-137 10.65 0.0 0.0 0.0 0.0 138-139 11.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCTC 10 0.00693757 144.25 4 TGAGGCT 10 0.00693757 144.25 8 ACAACTA 10 0.00693757 144.25 1 GTTCAGA 30 0.0018347214 72.125 145 >>END_MODULE Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627131 spots for SRR7169778.sra Written 627131 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra Read 627116 spots for SRR7169778.sra Written 627116 spots for SRR7169778.sra SRR ids: ['SRR7169778.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__7u_3hom SRR7169778.sra spots: 12542335 blocks: [[1, 627116], [627117, 1254232], [1254233, 1881348], [1881349, 2508464], [2508465, 3135580], [3135581, 3762696], [3762697, 4389812], [4389813, 5016928], [5016929, 5644044], [5644045, 6271160], [6271161, 6898276], [6898277, 7525392], [7525393, 8152508], [8152509, 8779624], [8779625, 9406740], [9406741, 10033856], [10033857, 10660972], [10660973, 11288088], [11288089, 11915204], [11915205, 12542335]] SRR7169778 file size 4228485 SRR7169778 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169778 SRR7169778_1.fastq SRR7169778_2.fastq Input file: SRR7169778_1.fastq Paired file: SRR7169778_2.fastq trimmed: SRR7169778-trimmed-pair1.fastq, SRR7169778-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:55:04 2025 >> started Tue Feb 11 15:55:17 2025 >> done (13.247s) 12542335 read pairs processed; of these: 8436 ( 0.07%) short read pairs filtered out after trimming by size control 15618 ( 0.12%) empty read pairs filtered out after trimming by size control 12518281 (99.81%) read pairs available; of these: 6396610 (51.10%) trimmed read pairs available after processing 6121671 (48.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 3 0.00% 21 2 0.00% 22 3 0.00% 23 6 0.00% 24 3 0.00% 25 3 0.00% 26 4 0.00% 27 1 0.00% 28 4 0.00% 29 6 0.00% 30 6 0.00% 31 4 0.00% 32 7 0.00% 33 13 0.00% 34 5 0.00% 35 18 0.00% 36 13 0.00% 37 15 0.00% 38 21 0.00% 39 35 0.00% 40 36 0.00% 41 38 0.00% 42 29 0.00% 43 57 0.00% 44 50 0.00% 45 47 0.00% 46 49 0.00% 47 72 0.00% 48 95 0.00% 49 104 0.00% 50 129 0.00% 51 121 0.00% 52 151 0.00% 53 176 0.00% 54 217 0.00% 55 192 0.00% 56 247 0.00% 57 277 0.00% 58 319 0.00% 59 346 0.00% 60 397 0.00% 61 481 0.00% 62 550 0.00% 63 585 0.00% 64 734 0.01% 65 747 0.01% 66 848 0.01% 67 993 0.01% 68 1069 0.01% 69 1296 0.01% 70 1488 0.01% 71 1682 0.01% 72 1877 0.01% 73 2304 0.02% 74 2491 0.02% 75 2790 0.02% 76 3219 0.03% 77 3559 0.03% 78 3769 0.03% 79 4144 0.03% 80 4520 0.04% 81 5087 0.04% 82 5811 0.05% 83 6542 0.05% 84 7452 0.06% 85 8606 0.07% 86 9108 0.07% 87 9682 0.08% 88 10552 0.08% 89 11113 0.09% 90 11475 0.09% 91 12379 0.10% 92 13616 0.11% 93 14540 0.12% 94 15892 0.13% 95 16811 0.13% 96 17288 0.14% 97 18310 0.15% 98 18881 0.15% 99 19421 0.16% 100 20374 0.16% 101 21301 0.17% 102 22584 0.18% 103 23412 0.19% 104 24690 0.20% 105 25734 0.21% 106 26925 0.22% 107 27576 0.22% 108 28375 0.23% 109 29303 0.23% 110 29814 0.24% 111 30613 0.24% 112 31985 0.26% 113 33159 0.26% 114 34589 0.28% 115 35815 0.29% 116 36668 0.29% 117 37676 0.30% 118 37920 0.30% 119 38210 0.31% 120 39172 0.31% 121 40146 0.32% 122 40762 0.33% 123 42334 0.34% 124 44050 0.35% 125 45380 0.36% 126 46978 0.38% 127 48312 0.39% 128 48979 0.39% 129 50314 0.40% 130 51549 0.41% 131 52011 0.42% 132 53555 0.43% 133 55082 0.44% 134 56388 0.45% 135 58306 0.47% 136 61321 0.49% 137 63398 0.51% 138 65728 0.53% 139 69067 0.55% 140 73589 0.59% 141 77832 0.62% 142 83846 0.67% 143 91320 0.73% 144 103824 0.83% 145 121761 0.97% 146 146468 1.17% 147 191229 1.53% 148 282930 2.26% 149 541849 4.33% 150 2777371 22.19% 151 6121671 48.90% 12518281 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=39 prefix-density=0.20 prefix-fanout=2.4 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=90.66 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=14.4 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=40 prefix-density=0.20 prefix-fanout=2.4 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=43.55 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=11.9 sequence=TGTTGGTGGTGG SRR7169778 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:56:04 Started mapping on | Feb 11 15:56:05 Finished on | Feb 11 15:57:15 Mapping speed, Million of reads per hour | 643.80 Number of input reads | 12518281 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11930166 Uniquely mapped reads % | 95.30% Average mapped length | 289.87 Number of splices: Total | 10677244 Number of splices: Annotated (sjdb) | 10495166 Number of splices: GT/AG | 10521580 Number of splices: GC/AG | 121631 Number of splices: AT/AC | 8993 Number of splices: Non-canonical | 25040 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 211509 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 40047 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 385390 385390 385390 N_multimapping 211509 211509 211509 N_noFeature 289443 11793809 347342 N_ambiguous 123351 646 44412 UnstrandedReadsAssigned:11517372 PositiveStrandReadsAssigned:135711 NegativeStrandReadsAssigned:11538412 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169778 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169778-trimmed-pair1.fastq SRR7169778-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,518,281 reads, 11,499,804 reads pseudoaligned [quant] estimated average fragment length: 212.438 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,001 rounds 52401 SRR7169778.ke.tsv 34699 SRR7169778.se.tsv 87100 total ==> SRR7169778.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.56 225 11.4047 Potri.005G024800.1.v4.1 1035 823.562 19 2.11258 Potri.004G059700.1.v4.1 961 749.567 0 0 Potri.007G009000.2.v4.1 1416 1204.56 0 0 Potri.003G141000.2.v4.1 2943 2731.56 237 7.94497 Potri.016G087400.1.v4.1 270 93.0924 1240 1219.73 Potri.015G069301.1.v4.1 564 354.542 0 0 Potri.010G195200.1.v4.1 1773 1561.56 28 1.64193 Potri.012G127500.1.v4.1 977 765.562 3353 401.059 ==> SRR7169778.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1558 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169778 completed mapping pipeline successfully