Starting /dee2/code/volunteer_pipeline.sh SRR7169779 current disk space = 3049585561600 free memory = 1481698932 SRR7169779 SRAfilesize 72d57c390d8550978dd0d7605577a1f1 SRR7169779.sra SRR7169779.sra file validated SRR7169779 is paired end SRR7169779 is conventional basespace SRR7169779 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169779_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.699 25.0 18.0 33.0 18.0 33.0 2 25.69725 27.0 18.0 31.0 18.0 33.0 3 29.23675 30.0 27.0 31.0 25.0 33.0 4 31.40375 33.0 31.0 33.0 29.0 33.0 5 32.422 33.0 33.0 33.0 32.0 33.0 6 36.75 38.0 37.0 38.0 34.0 38.0 7 37.15275 38.0 37.0 38.0 36.0 38.0 8 37.49575 38.0 38.0 38.0 37.0 38.0 9 37.582 38.0 38.0 38.0 37.0 38.0 10-14 37.6778 38.0 38.0 38.0 38.0 38.0 15-19 37.717600000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.706849999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.66975 38.0 38.0 38.0 38.0 38.0 30-34 37.5558 38.0 38.0 38.0 38.0 38.0 35-39 37.46325 38.0 38.0 38.0 37.6 38.0 40-44 37.45864999999999 38.0 38.0 38.0 37.6 38.0 45-49 37.38685 38.0 38.0 38.0 37.2 38.0 50-54 37.2374 38.0 38.0 38.0 36.6 38.0 55-59 37.407650000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.340050000000005 38.0 38.0 38.0 36.8 38.0 65-69 37.04905 38.0 38.0 38.0 36.0 38.0 70-74 37.147450000000006 38.0 38.0 38.0 36.2 38.0 75-79 37.04595 38.0 38.0 38.0 36.0 38.0 80-84 36.717 38.0 38.0 38.0 35.2 38.0 85-89 36.70205000000001 38.0 38.0 38.0 34.8 38.0 90-94 36.6917 38.0 38.0 38.0 35.0 38.0 95-99 36.6161 38.0 38.0 38.0 34.6 38.0 100-104 36.599000000000004 38.0 38.0 38.0 34.6 38.0 105-109 36.493700000000004 38.0 37.6 38.0 34.4 38.0 110-114 36.1831 38.0 37.6 38.0 34.0 38.0 115-119 35.46725 38.0 36.4 38.0 29.8 38.0 120-124 36.107600000000005 38.0 37.0 38.0 33.2 38.0 125-129 35.1657 38.0 35.4 38.0 27.2 38.0 130-134 35.0465 38.0 35.4 38.0 28.0 38.0 135-139 35.32895 38.0 35.8 38.0 30.2 38.0 140-144 34.61905 38.0 35.2 38.0 27.4 38.0 145-149 34.19455 38.0 35.0 38.0 26.2 38.0 150-151 30.478625 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 3.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 4.0 16 2.0 17 1.0 18 6.0 19 11.0 20 1.0 21 2.0 22 5.0 23 4.0 24 3.0 25 3.0 26 10.0 27 12.0 28 16.0 29 20.0 30 28.0 31 45.0 32 61.0 33 89.0 34 158.0 35 321.0 36 1045.0 37 2148.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.41509433962264 11.044025157232705 10.943396226415095 35.59748427672956 2 25.1 14.475 33.025 27.400000000000002 3 21.9 20.25 24.7 33.15 4 24.05 28.299999999999997 22.2 25.45 5 23.200000000000003 32.324999999999996 23.75 20.724999999999998 6 19.125 34.575 25.4 20.9 7 13.925 26.825 41.825 17.424999999999997 8 18.25 25.275 31.825 24.65 9 18.175 25.8 33.225 22.8 10-14 19.994999999999997 30.205 26.724999999999998 23.075000000000003 15-19 20.645 28.410000000000004 27.725 23.22 20-24 19.78 29.385 27.49 23.345 25-29 20.22 29.354999999999997 27.33 23.095 30-34 20.49 29.15 26.85 23.51 35-39 20.365 29.04 27.325 23.27 40-44 20.085 28.87 28.01 23.035 45-49 19.975 28.455000000000002 27.435 24.135 50-54 20.080000000000002 28.595 27.52 23.805 55-59 20.14 28.815 27.47 23.575 60-64 20.294999999999998 28.634999999999998 27.744999999999997 23.325000000000003 65-69 20.22 28.794999999999998 27.595 23.39 70-74 19.875 28.675 27.93 23.52 75-79 19.765 28.505000000000003 28.095 23.635 80-84 20.965 28.34 26.995 23.7 85-89 20.755000000000003 29.205 27.1 22.939999999999998 90-94 20.119999999999997 28.985 27.250000000000004 23.645 95-99 20.59 28.845 26.965 23.599999999999998 100-104 20.75 28.744999999999997 26.805 23.7 105-109 20.895 28.025 27.41 23.669999999999998 110-114 20.76162761527269 28.76423661632633 26.792433896944456 23.681701871456525 115-119 20.75 29.49 26.340000000000003 23.419999999999998 120-124 20.86 28.994999999999997 26.46 23.685000000000002 125-129 20.979999999999997 29.395 26.255 23.369999999999997 130-134 20.665 28.794999999999998 26.985 23.555 135-139 20.565 28.52 27.089999999999996 23.825 140-144 20.97 28.77 26.43 23.830000000000002 145-149 21.23 29.315 25.869999999999997 23.585 150-151 20.724999999999998 29.2 26.775 23.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.0 24 2.0 25 3.0 26 5.5 27 8.0 28 7.5 29 7.5 30 13.5 31 17.0 32 24.5 33 41.5 34 57.0 35 67.5 36 89.5 37 111.5 38 136.5 39 162.5 40 185.0 41 215.0 42 238.0 43 250.5 44 271.5 45 291.0 46 265.0 47 245.0 48 249.0 49 233.5 50 190.5 51 143.5 52 114.5 53 90.0 54 69.0 55 50.0 56 32.5 57 27.5 58 22.5 59 15.0 60 10.5 61 7.0 62 6.5 63 3.5 64 1.5 65 1.5 66 2.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.345 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57264957264957 99.02499999999999 2 0.40221216691804923 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025138260432378077 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.6625000000000001 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.8999999999999999 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.6375 0.0 0.0 0.0 0.0 96-97 1.875 0.0 0.0 0.0 0.0 98-99 2.2 0.0 0.0 0.0 0.0 100-101 2.6 0.0 0.0 0.0 0.0 102-103 2.85 0.0 0.0 0.0 0.0 104-105 3.1375 0.0 0.0 0.0 0.0 106-107 3.525 0.0 0.0 0.0 0.0 108-109 3.875 0.0 0.0 0.0 0.0 110-111 4.2125 0.0 0.0 0.0 0.0 112-113 4.4875 0.0 0.0 0.0 0.0 114-115 4.95 0.0 0.0 0.0 0.0 116-117 5.525 0.0 0.0 0.0 0.0 118-119 6.112500000000001 0.0 0.0 0.0 0.0 120-121 6.6375 0.0 0.0 0.0 0.0 122-123 7.0875 0.0 0.0 0.0 0.0 124-125 7.6875 0.0 0.0 0.0 0.0 126-127 8.2625 0.0 0.0 0.0 0.0 128-129 8.725 0.0 0.0 0.0 0.0 130-131 9.2375 0.0 0.0 0.0 0.0 132-133 9.712499999999999 0.0 0.0 0.0 0.0 134-135 10.4125 0.0 0.0 0.0 0.0 136-137 10.9875 0.0 0.0 0.0 0.0 138-139 11.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGTAT 15 1.1438822E-4 144.9125 3 GTATACT 10 0.006843168 144.91249 6 ATACTTC 10 0.006843168 144.91249 8 AGGTATA 10 0.006843168 144.91249 4 TCTTTAA 10 0.006843168 144.91249 5 TACTTCT 10 0.006843168 144.91249 9 CAGGAGA 10 0.006843168 144.91249 3 GGTATAC 10 0.006843168 144.91249 5 CCAGGTA 10 0.006843168 144.91249 2 >>END_MODULE SRR7169779 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169779_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.842 33.0 33.0 34.0 32.0 34.0 2 32.99725 33.0 33.0 34.0 32.0 34.0 3 32.36925 33.0 33.0 34.0 31.0 34.0 4 32.148 33.0 33.0 34.0 31.0 34.0 5 32.943 33.0 33.0 34.0 32.0 34.0 6 37.3395 38.0 38.0 38.0 37.0 38.0 7 37.4245 38.0 38.0 38.0 37.0 38.0 8 37.435 38.0 38.0 38.0 38.0 38.0 9 37.40725 38.0 38.0 38.0 38.0 38.0 10-14 37.36845 38.0 38.0 38.0 38.0 38.0 15-19 37.36835000000001 38.0 38.0 38.0 38.0 38.0 20-24 36.95605 38.0 38.0 38.0 35.4 38.0 25-29 37.3039 38.0 38.0 38.0 37.2 38.0 30-34 37.362049999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.2872 38.0 38.0 38.0 37.4 38.0 40-44 37.2457 38.0 38.0 38.0 37.0 38.0 45-49 37.247600000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.2557 38.0 38.0 38.0 37.0 38.0 55-59 37.1145 38.0 38.0 38.0 37.0 38.0 60-64 36.86935 38.0 38.0 38.0 36.0 38.0 65-69 36.8728 38.0 38.0 38.0 35.8 38.0 70-74 36.86925 38.0 38.0 38.0 36.0 38.0 75-79 36.626099999999994 38.0 38.0 38.0 35.8 38.0 80-84 36.2496 38.0 37.8 38.0 34.0 38.0 85-89 36.6217 38.0 38.0 38.0 35.2 38.0 90-94 36.72485 38.0 38.0 38.0 35.8 38.0 95-99 36.632349999999995 38.0 38.0 38.0 35.6 38.0 100-104 36.3681 38.0 38.0 38.0 34.4 38.0 105-109 35.278600000000004 38.0 37.0 38.0 28.6 38.0 110-114 35.023900000000005 38.0 37.0 38.0 29.0 38.0 115-119 34.450450000000004 38.0 36.8 38.0 25.6 38.0 120-124 34.317 38.0 36.0 38.0 24.4 38.0 125-129 34.3775 38.0 36.0 38.0 24.4 38.0 130-134 34.876850000000005 38.0 36.0 38.0 27.6 38.0 135-139 34.927499999999995 38.0 36.0 38.0 29.2 38.0 140-144 34.56745 38.0 35.2 38.0 28.0 38.0 145-149 33.7194 38.0 33.8 38.0 23.4 38.0 150-151 29.671750000000003 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 2.0 5 3.0 6 3.0 7 0.0 8 1.0 9 1.0 10 4.0 11 2.0 12 1.0 13 1.0 14 2.0 15 1.0 16 3.0 17 8.0 18 8.0 19 5.0 20 8.0 21 5.0 22 6.0 23 17.0 24 5.0 25 6.0 26 14.0 27 24.0 28 29.0 29 40.0 30 52.0 31 66.0 32 87.0 33 113.0 34 149.0 35 231.0 36 596.0 37 2502.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.225 19.025 15.675 29.075 2 25.6 25.4 30.5 18.5 3 20.849999999999998 27.900000000000002 29.825000000000003 21.425 4 22.225 34.875 23.9 19.0 5 24.8 34.55 22.775000000000002 17.875 6 20.1 37.85 24.175 17.875 7 20.424999999999997 20.7 38.4 20.474999999999998 8 22.325 24.95 27.325 25.4 9 21.45 23.7 29.725 25.124999999999996 10-14 22.625 29.09 26.36 21.925 15-19 23.755000000000003 27.845 27.76 20.64 20-24 23.580000000000002 27.939999999999998 27.805000000000003 20.674999999999997 25-29 22.759999999999998 28.315 27.855 21.07 30-34 23.1 27.810000000000002 28.384999999999998 20.705000000000002 35-39 23.175 27.644999999999996 27.595 21.584999999999997 40-44 23.115 28.07 28.115000000000002 20.7 45-49 22.78 28.21 28.110000000000003 20.9 50-54 23.815 27.955000000000002 27.6 20.630000000000003 55-59 23.26 27.37 28.565 20.805 60-64 23.880000000000003 26.935 28.65 20.535 65-69 23.04 27.865000000000002 28.465 20.630000000000003 70-74 23.44 28.205000000000002 27.83 20.525 75-79 23.160173160173162 27.7307963354475 28.48082150407732 20.62820900030202 80-84 23.88718823706529 27.525467958046875 27.926933306568973 20.660410498318864 85-89 23.68 27.96 28.1 20.26 90-94 24.044999999999998 27.694999999999997 28.285 19.975 95-99 23.799999999999997 28.215 27.965 20.02 100-104 23.66183091545773 27.91895947973987 27.63881940970485 20.78039019509755 105-109 23.677202150645694 28.330234661574792 27.787548364403797 20.205014823375713 110-114 24.074739489759253 27.85277963143576 27.71931625686566 20.353164621939328 115-119 25.1618291918981 27.145541866778032 27.573606180831074 20.119022760492797 120-124 24.551238942631006 28.327556774093427 27.0239511665201 20.09725311675547 125-129 24.724564216624426 28.153933688511874 27.140123105570783 19.98137898929292 130-134 25.41792547834844 27.67875125881168 26.732124874118835 20.17119838872105 135-139 25.480000000000004 27.065 27.255000000000003 20.200000000000003 140-144 25.7 27.705000000000002 27.060000000000002 19.535 145-149 26.14 28.255000000000003 26.51 19.095000000000002 150-151 26.3625 27.275 27.1125 19.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 1.5 26 2.0 27 5.5 28 7.5 29 7.0 30 9.5 31 17.0 32 21.5 33 31.0 34 51.0 35 64.5 36 74.0 37 98.5 38 124.5 39 164.5 40 204.0 41 232.5 42 249.5 43 271.0 44 304.0 45 298.0 46 282.5 47 267.0 48 228.0 49 193.0 50 172.5 51 153.5 52 126.0 53 90.5 54 66.0 55 50.5 56 39.0 57 24.5 58 14.5 59 13.5 60 10.5 61 5.5 62 2.5 63 3.0 64 2.5 65 1.0 66 1.0 67 0.5 68 1.5 69 2.5 70 1.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.67 80-84 0.365 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.49500000000000005 110-114 2.595 115-119 4.22 120-124 3.345 125-129 3.335 130-134 0.7000000000000001 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59768669851647 99.02499999999999 2 0.35202413879808897 0.7000000000000001 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025144581342720643 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 90-91 1.15 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.6625 0.0 0.0 0.0 0.0 96-97 1.875 0.0 0.0 0.0 0.0 98-99 2.2 0.0 0.0 0.0 0.0 100-101 2.575 0.0 0.0 0.0 0.0 102-103 2.825 0.0 0.0 0.0 0.0 104-105 3.0875000000000004 0.0 0.0 0.0 0.0 106-107 3.475 0.0 0.0 0.0 0.0 108-109 3.8 0.0 0.0 0.0 0.0 110-111 4.1625 0.0 0.0 0.0 0.0 112-113 4.45 0.0 0.0 0.0 0.0 114-115 4.95 0.0 0.0 0.0 0.0 116-117 5.475 0.0 0.0 0.0 0.0 118-119 6.05 0.0 0.0 0.0 0.0 120-121 6.5375 0.0 0.0 0.0 0.0 122-123 6.975 0.0 0.0 0.0 0.0 124-125 7.575 0.0 0.0 0.0 0.0 126-127 8.175 0.0 0.0 0.0 0.0 128-129 8.6 0.0 0.0 0.0 0.0 130-131 9.075 0.0 0.0 0.0 0.0 132-133 9.5625 0.0 0.0 0.0 0.0 134-135 10.2625 0.0 0.0 0.0 0.0 136-137 10.825 0.0 0.0 0.0 0.0 138-139 11.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559715 spots for SRR7169779.sra Written 559715 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra Read 559713 spots for SRR7169779.sra Written 559713 spots for SRR7169779.sra SRR ids: ['SRR7169779.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x6v7ullz SRR7169779.sra spots: 11194262 blocks: [[1, 559713], [559714, 1119426], [1119427, 1679139], [1679140, 2238852], [2238853, 2798565], [2798566, 3358278], [3358279, 3917991], [3917992, 4477704], [4477705, 5037417], [5037418, 5597130], [5597131, 6156843], [6156844, 6716556], [6716557, 7276269], [7276270, 7835982], [7835983, 8395695], [8395696, 8955408], [8955409, 9515121], [9515122, 10074834], [10074835, 10634547], [10634548, 11194262]] SRR7169779 file size 3771667 SRR7169779 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169779 SRR7169779_1.fastq SRR7169779_2.fastq Input file: SRR7169779_1.fastq Paired file: SRR7169779_2.fastq trimmed: SRR7169779-trimmed-pair1.fastq, SRR7169779-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:33:11 2025 >> started Tue Feb 11 15:33:24 2025 >> done (12.705s) 11194262 read pairs processed; of these: 8619 ( 0.08%) short read pairs filtered out after trimming by size control 24579 ( 0.22%) empty read pairs filtered out after trimming by size control 11161064 (99.70%) read pairs available; of these: 5611504 (50.28%) trimmed read pairs available after processing 5549560 (49.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 7 0.00% 21 1 0.00% 22 5 0.00% 23 8 0.00% 24 7 0.00% 25 3 0.00% 26 9 0.00% 27 8 0.00% 28 7 0.00% 29 6 0.00% 30 10 0.00% 31 42 0.00% 32 14 0.00% 33 23 0.00% 34 28 0.00% 35 16 0.00% 36 32 0.00% 37 32 0.00% 38 48 0.00% 39 64 0.00% 40 47 0.00% 41 66 0.00% 42 73 0.00% 43 90 0.00% 44 101 0.00% 45 91 0.00% 46 104 0.00% 47 112 0.00% 48 132 0.00% 49 176 0.00% 50 185 0.00% 51 227 0.00% 52 254 0.00% 53 270 0.00% 54 310 0.00% 55 287 0.00% 56 342 0.00% 57 390 0.00% 58 432 0.00% 59 524 0.00% 60 551 0.00% 61 657 0.01% 62 744 0.01% 63 805 0.01% 64 892 0.01% 65 993 0.01% 66 1061 0.01% 67 1205 0.01% 68 1316 0.01% 69 1472 0.01% 70 1662 0.01% 71 1858 0.02% 72 2215 0.02% 73 2457 0.02% 74 2772 0.02% 75 3114 0.03% 76 3625 0.03% 77 4094 0.04% 78 4056 0.04% 79 4367 0.04% 80 4547 0.04% 81 5309 0.05% 82 5855 0.05% 83 6431 0.06% 84 7571 0.07% 85 8388 0.08% 86 8957 0.08% 87 9488 0.09% 88 9921 0.09% 89 10442 0.09% 90 11312 0.10% 91 12080 0.11% 92 13027 0.12% 93 13988 0.13% 94 15383 0.14% 95 16151 0.14% 96 16965 0.15% 97 17478 0.16% 98 18060 0.16% 99 18723 0.17% 100 19512 0.17% 101 20178 0.18% 102 21705 0.19% 103 22513 0.20% 104 23982 0.21% 105 24990 0.22% 106 26156 0.23% 107 26926 0.24% 108 27181 0.24% 109 27952 0.25% 110 28327 0.25% 111 29078 0.26% 112 30279 0.27% 113 31287 0.28% 114 32702 0.29% 115 33801 0.30% 116 35219 0.32% 117 35274 0.32% 118 36445 0.33% 119 36589 0.33% 120 36791 0.33% 121 37513 0.34% 122 38605 0.35% 123 40073 0.36% 124 41213 0.37% 125 42285 0.38% 126 43860 0.39% 127 44754 0.40% 128 45356 0.41% 129 46291 0.41% 130 47319 0.42% 131 48015 0.43% 132 49139 0.44% 133 49842 0.45% 134 51756 0.46% 135 53623 0.48% 136 55390 0.50% 137 57430 0.51% 138 59429 0.53% 139 61318 0.55% 140 64592 0.58% 141 69361 0.62% 142 74085 0.66% 143 78445 0.70% 144 88578 0.79% 145 101850 0.91% 146 121018 1.08% 147 160928 1.44% 148 235068 2.11% 149 459835 4.12% 150 2363063 21.17% 151 5549560 49.72% 11161064 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=49.19 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=13.4 sequence=CCACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=fanout-score sequence-density=0.19 sequence-density-rank=1 fanout-score=49.19 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=13.4 sequence=CCACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=5.74 fanout-score-rank=14 prefix-density=0.27 prefix-fanout=4.1 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=35.03 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.5 sequence=CCTCTTCACTTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCAACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169779 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:34:18 Started mapping on | Feb 11 15:34:18 Finished on | Feb 11 15:35:24 Mapping speed, Million of reads per hour | 608.79 Number of input reads | 11161064 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 10758285 Uniquely mapped reads % | 96.39% Average mapped length | 289.16 Number of splices: Total | 9674145 Number of splices: Annotated (sjdb) | 9505965 Number of splices: GT/AG | 9536654 Number of splices: GC/AG | 107459 Number of splices: AT/AC | 8415 Number of splices: Non-canonical | 21617 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 183440 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 33431 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.60% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 227748 227748 227748 N_multimapping 183440 183440 183440 N_noFeature 286123 10636330 335771 N_ambiguous 115061 651 42252 UnstrandedReadsAssigned:10357101 PositiveStrandReadsAssigned:121304 NegativeStrandReadsAssigned:10380262 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169779 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169779-trimmed-pair1.fastq SRR7169779-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,161,064 reads, 10,348,801 reads pseudoaligned [quant] estimated average fragment length: 208.116 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR7169779.ke.tsv 34699 SRR7169779.se.tsv 87100 total ==> SRR7169779.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.88 211 12.8523 Potri.005G024800.1.v4.1 1035 827.884 26 3.46413 Potri.004G059700.1.v4.1 961 753.89 2 0.292625 Potri.007G009000.2.v4.1 1416 1208.88 0 0 Potri.003G141000.2.v4.1 2943 2735.88 252.088 10.1635 Potri.016G087400.1.v4.1 270 94.8979 830 964.743 Potri.015G069301.1.v4.1 564 358.679 0 0 Potri.010G195200.1.v4.1 1773 1565.88 13 0.915744 Potri.012G127500.1.v4.1 977 769.89 2848 408.039 ==> SRR7169779.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1249 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 162 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169779 completed mapping pipeline successfully