Starting /dee2/code/volunteer_pipeline.sh SRR7169780 current disk space = 3049208774656 free memory = 1473963840 SRR7169780 SRAfilesize 5b2b4685144127296d59b87b01906b2c SRR7169780.sra SRR7169780.sra file validated SRR7169780 is paired end SRR7169780 is conventional basespace SRR7169780 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169780_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.365 30.0 18.0 33.0 18.0 34.0 2 28.43575 29.0 25.0 33.0 18.0 33.0 3 31.15325 33.0 30.0 33.0 28.0 33.0 4 32.51025 33.0 33.0 33.0 31.0 34.0 5 33.005 33.0 33.0 34.0 33.0 34.0 6 36.99125 38.0 37.0 38.0 35.0 38.0 7 37.28975 38.0 38.0 38.0 36.0 38.0 8 37.45825 38.0 38.0 38.0 37.0 38.0 9 37.66875 38.0 38.0 38.0 38.0 38.0 10-14 37.64045 38.0 38.0 38.0 38.0 38.0 15-19 37.66969999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.646049999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.6348 38.0 38.0 38.0 38.0 38.0 30-34 37.58095 38.0 38.0 38.0 38.0 38.0 35-39 37.4381 38.0 38.0 38.0 37.4 38.0 40-44 37.4833 38.0 38.0 38.0 37.6 38.0 45-49 37.40894999999999 38.0 38.0 38.0 37.2 38.0 50-54 37.22495 38.0 38.0 38.0 36.4 38.0 55-59 37.39444999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.3842 38.0 38.0 38.0 37.0 38.0 65-69 37.03565 38.0 38.0 38.0 36.0 38.0 70-74 37.25385 38.0 38.0 38.0 36.6 38.0 75-79 37.1481 38.0 38.0 38.0 36.0 38.0 80-84 36.917899999999996 38.0 38.0 38.0 35.4 38.0 85-89 36.8459 38.0 38.0 38.0 35.4 38.0 90-94 36.8422 38.0 38.0 38.0 35.4 38.0 95-99 36.805600000000005 38.0 38.0 38.0 35.2 38.0 100-104 36.68755 38.0 38.0 38.0 35.0 38.0 105-109 36.5159 38.0 38.0 38.0 34.4 38.0 110-114 36.1431 38.0 37.4 38.0 33.4 38.0 115-119 35.60435 38.0 36.4 38.0 30.4 38.0 120-124 36.1549 38.0 37.0 38.0 33.8 38.0 125-129 35.0985 38.0 35.4 38.0 27.0 38.0 130-134 35.13975000000001 38.0 35.4 38.0 27.6 38.0 135-139 35.49315 38.0 36.0 38.0 31.2 38.0 140-144 34.83015 38.0 35.0 38.0 28.4 38.0 145-149 34.41605 38.0 35.0 38.0 27.6 38.0 150-151 30.802374999999998 36.5 29.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 1.0 18 2.0 19 7.0 20 3.0 21 4.0 22 1.0 23 5.0 24 3.0 25 2.0 26 11.0 27 13.0 28 14.0 29 20.0 30 28.0 31 37.0 32 61.0 33 95.0 34 177.0 35 296.0 36 868.0 37 2345.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.613751263902934 10.51567239635996 11.097067745197169 40.77350859453993 2 23.05 14.924999999999999 31.35 30.675 3 20.125 19.225 25.575 35.075 4 22.925 26.85 22.525000000000002 27.700000000000003 5 23.45 32.05 23.9 20.599999999999998 6 18.425 35.0 25.4 21.175 7 15.049999999999999 25.7 41.65 17.599999999999998 8 18.35 27.450000000000003 29.549999999999997 24.65 9 17.575 26.025 32.300000000000004 24.099999999999998 10-14 19.85 29.505 27.37 23.275000000000002 15-19 20.185 28.16 28.12 23.535 20-24 20.255000000000003 29.12 27.025 23.599999999999998 25-29 19.634999999999998 29.330000000000002 27.095000000000002 23.94 30-34 20.16 28.925 27.339999999999996 23.575 35-39 20.335 28.9 26.99 23.775 40-44 20.03 29.035 27.445000000000004 23.49 45-49 19.939999999999998 28.299999999999997 27.955000000000002 23.805 50-54 20.765 29.175 26.905 23.155 55-59 19.875 28.62 27.500000000000004 24.005000000000003 60-64 19.835 28.585 27.195000000000004 24.385 65-69 19.865 28.055000000000003 27.944999999999997 24.135 70-74 20.515 28.105000000000004 27.52 23.86 75-79 20.445 28.470000000000002 27.425 23.66 80-84 21.01 28.310000000000002 27.439999999999998 23.24 85-89 20.395 28.74 27.034999999999997 23.830000000000002 90-94 20.495 28.605000000000004 26.979999999999997 23.919999999999998 95-99 20.424999999999997 28.325 27.515 23.735 100-104 20.175 28.965000000000003 26.615 24.245 105-109 20.845 28.365000000000002 26.979999999999997 23.810000000000002 110-114 20.692601527945314 28.724366706875752 27.06574185765983 23.5172899075191 115-119 21.315 28.439999999999998 26.77 23.474999999999998 120-124 21.224999999999998 28.08 26.669999999999998 24.025 125-129 21.29 28.37 26.705000000000002 23.635 130-134 20.945 28.76 26.715 23.580000000000002 135-139 21.605 27.515 26.840000000000003 24.04 140-144 21.15 27.865000000000002 26.75 24.235 145-149 21.135 28.249999999999996 26.46 24.154999999999998 150-151 21.4375 28.1125 26.7125 23.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 2.5 27 4.0 28 6.0 29 10.5 30 13.5 31 20.5 32 29.5 33 32.5 34 45.0 35 68.5 36 88.5 37 98.0 38 123.0 39 161.0 40 181.5 41 200.0 42 234.0 43 266.5 44 272.5 45 276.0 46 281.5 47 282.0 48 254.5 49 207.0 50 170.0 51 149.0 52 130.0 53 99.5 54 72.0 55 52.5 56 43.0 57 37.0 58 25.5 59 14.5 60 7.5 61 4.5 62 8.5 63 6.5 64 4.0 65 2.5 66 1.0 67 1.0 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.52 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.35149384885764495 0.7000000000000001 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.7250000000000001 0.0 0.0 0.0 0.0 88-89 0.875 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.4 0.0 0.0 0.0 0.0 96-97 1.5875 0.0 0.0 0.0 0.0 98-99 1.8625 0.0 0.0 0.0 0.0 100-101 2.175 0.0 0.0 0.0 0.0 102-103 2.4000000000000004 0.0 0.0 0.0 0.0 104-105 2.7125 0.0 0.0 0.0 0.0 106-107 3.1375 0.0 0.0 0.0 0.0 108-109 3.5125 0.0 0.0 0.0 0.0 110-111 3.9375 0.0 0.0 0.0 0.0 112-113 4.4625 0.0 0.0 0.0 0.0 114-115 5.075 0.0 0.0 0.0 0.0 116-117 5.6625 0.0 0.0 0.0 0.0 118-119 6.1875 0.0 0.0 0.0 0.0 120-121 6.65 0.0 0.0 0.0 0.0 122-123 7.225 0.0 0.0 0.0 0.0 124-125 7.9625 0.0 0.0 0.0 0.0 126-127 8.5875 0.0 0.0 0.0 0.0 128-129 9.274999999999999 0.0 0.0 0.0 0.0 130-131 9.925 0.0 0.0 0.0 0.0 132-133 10.9375 0.0 0.0 0.0 0.0 134-135 11.55 0.0 0.0 0.0 0.0 136-137 12.350000000000001 0.0 0.0 0.0 0.0 138-139 12.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAGTA 10 0.006830828 145.0 2 TGAGGGT 10 0.006830828 145.0 4 >>END_MODULE SRR7169780 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169780_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.822 33.0 33.0 34.0 32.0 34.0 2 32.9895 33.0 33.0 34.0 32.0 34.0 3 32.217 33.0 33.0 34.0 30.0 34.0 4 32.445 33.0 33.0 34.0 32.0 34.0 5 32.92425 33.0 33.0 34.0 32.0 34.0 6 37.326 38.0 38.0 38.0 37.0 38.0 7 37.3685 38.0 38.0 38.0 37.0 38.0 8 37.4605 38.0 38.0 38.0 38.0 38.0 9 37.35775 38.0 38.0 38.0 38.0 38.0 10-14 37.333749999999995 38.0 38.0 38.0 37.8 38.0 15-19 37.36130000000001 38.0 38.0 38.0 38.0 38.0 20-24 36.91565 38.0 38.0 38.0 35.6 38.0 25-29 37.3183 38.0 38.0 38.0 37.8 38.0 30-34 37.351600000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.2946 38.0 38.0 38.0 37.4 38.0 40-44 37.2476 38.0 38.0 38.0 37.0 38.0 45-49 37.2825 38.0 38.0 38.0 37.0 38.0 50-54 37.269600000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.1567 38.0 38.0 38.0 37.0 38.0 60-64 37.006899999999995 38.0 38.0 38.0 36.4 38.0 65-69 36.967650000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.9185 38.0 38.0 38.0 36.0 38.0 75-79 36.5535 38.0 38.0 38.0 36.0 38.0 80-84 36.192899999999995 38.0 37.4 38.0 33.6 38.0 85-89 36.69735000000001 38.0 38.0 38.0 35.4 38.0 90-94 36.832550000000005 38.0 38.0 38.0 36.0 38.0 95-99 36.70285 38.0 38.0 38.0 35.6 38.0 100-104 36.48995 38.0 38.0 38.0 34.6 38.0 105-109 35.1479 38.0 36.8 38.0 28.2 38.0 110-114 34.64704999999999 38.0 37.0 38.0 27.2 38.0 115-119 34.0007 38.0 37.0 38.0 21.4 38.0 120-124 33.79209999999999 38.0 36.0 38.0 17.8 38.0 125-129 33.89755 38.0 36.0 38.0 19.8 38.0 130-134 34.6529 38.0 36.0 38.0 25.6 38.0 135-139 34.9962 38.0 36.0 38.0 29.8 38.0 140-144 34.67445 38.0 35.4 38.0 28.4 38.0 145-149 34.01855 38.0 33.8 38.0 25.2 38.0 150-151 29.48325 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 3.0 14 4.0 15 2.0 16 7.0 17 4.0 18 4.0 19 5.0 20 8.0 21 5.0 22 5.0 23 14.0 24 8.0 25 13.0 26 17.0 27 26.0 28 29.0 29 56.0 30 56.0 31 77.0 32 93.0 33 109.0 34 144.0 35 243.0 36 553.0 37 2501.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.925 21.2 16.375 28.499999999999996 2 26.8 25.8 29.4 18.0 3 19.900000000000002 28.9 30.55 20.65 4 22.925 32.1 24.275 20.7 5 24.9 34.875 22.725 17.5 6 21.15 37.125 23.325000000000003 18.4 7 19.375 21.099999999999998 39.525 20.0 8 21.95 24.474999999999998 27.950000000000003 25.624999999999996 9 21.425 25.174999999999997 29.2 24.2 10-14 23.775 28.65 26.369999999999997 21.205 15-19 23.549999999999997 27.474999999999998 28.09 20.885 20-24 23.015 28.665000000000003 27.24 21.08 25-29 23.255 27.875 27.42 21.45 30-34 22.985 28.494999999999997 27.284999999999997 21.235 35-39 23.425 27.839999999999996 27.52 21.215 40-44 23.41 28.26 27.46 20.87 45-49 23.285 27.884999999999998 27.224999999999998 21.605 50-54 23.355 28.4 27.24 21.005 55-59 23.73 27.71 27.51 21.05 60-64 23.565 28.155 27.875 20.405 65-69 23.345 28.205000000000002 27.925 20.525 70-74 23.705000000000002 27.595 27.834999999999997 20.865000000000002 75-79 23.389093849497144 28.235710314853186 27.5483903573053 20.82680547834437 80-84 24.17725970959152 27.523488921268154 27.317489825654423 20.98176154348591 85-89 24.375 27.13 27.82 20.674999999999997 90-94 23.985 27.775 27.91 20.330000000000002 95-99 24.265 27.560000000000002 28.02 20.155 100-104 24.621079485768597 28.157670951928367 27.40733329998499 19.813916262318042 105-109 24.375725167734448 28.295414417595723 26.867779851687434 20.461080562982396 110-114 25.243223557567244 27.69366838353884 27.44914416523594 19.613963893657978 115-119 25.28967789943659 27.750611246943762 27.017114914425427 19.942595939194216 120-124 24.753934417600927 27.717248276225064 27.04352860676878 20.48528869940523 125-129 25.521627161402215 27.60813580701109 27.245493246439274 19.624743785147423 130-134 25.822451665148293 27.74066201032493 26.723352566049197 19.713533758477578 135-139 26.185000000000002 27.515 26.69 19.61 140-144 26.584999999999997 28.249999999999996 26.224999999999998 18.94 145-149 27.279999999999998 27.77 26.3 18.65 150-151 26.85 28.000000000000004 27.025 18.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 1.5 25 0.0 26 0.5 27 1.0 28 3.5 29 7.0 30 9.0 31 12.0 32 19.0 33 30.5 34 41.0 35 58.0 36 66.5 37 86.0 38 119.5 39 150.0 40 195.0 41 239.0 42 265.0 43 286.0 44 299.0 45 291.0 46 269.0 47 252.0 48 243.5 49 219.0 50 184.5 51 156.0 52 135.5 53 104.5 54 68.0 55 50.0 56 41.5 57 27.5 58 16.5 59 13.0 60 11.0 61 7.5 62 4.0 63 3.0 64 4.5 65 3.5 66 0.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 1.065 80-84 0.485 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.045 105-109 0.885 110-114 3.895 115-119 5.93 120-124 5.005 125-129 4.865 130-134 1.21 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.30120481927710846 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0251004016064257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.025 0.0 2 0.0 0.0 0.0 0.025 0.0 3 0.0 0.0 0.0 0.025 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.07500000000000001 0.0 0.0 0.025 0.0 70-71 0.15 0.0 0.0 0.025 0.0 72-73 0.1875 0.0 0.0 0.025 0.0 74-75 0.2375 0.0 0.0 0.025 0.0 76-77 0.3 0.0 0.0 0.025 0.0 78-79 0.3625 0.0 0.0 0.025 0.0 80-81 0.4125 0.0 0.0 0.025 0.0 82-83 0.4625 0.0 0.0 0.025 0.0 84-85 0.575 0.0 0.0 0.025 0.0 86-87 0.7250000000000001 0.0 0.0 0.025 0.0 88-89 0.875 0.0 0.0 0.025 0.0 90-91 0.9375 0.0 0.0 0.025 0.0 92-93 1.1 0.0 0.0 0.025 0.0 94-95 1.35 0.0 0.0 0.025 0.0 96-97 1.5625 0.0 0.0 0.025 0.0 98-99 1.8375 0.0 0.0 0.025 0.0 100-101 2.1500000000000004 0.0 0.0 0.025 0.0 102-103 2.3499999999999996 0.0 0.0 0.025 0.0 104-105 2.6625 0.0 0.0 0.025 0.0 106-107 3.1 0.0 0.0 0.025 0.0 108-109 3.475 0.0 0.0 0.025 0.0 110-111 3.9124999999999996 0.0 0.0 0.025 0.0 112-113 4.475 0.0 0.0 0.025 0.0 114-115 5.025 0.0 0.0 0.025 0.0 116-117 5.6 0.0 0.0 0.025 0.0 118-119 6.125 0.0 0.0 0.025 0.0 120-121 6.55 0.0 0.0 0.025 0.0 122-123 7.125 0.0 0.0 0.025 0.0 124-125 7.8875 0.0 0.0 0.025 0.0 126-127 8.525 0.0 0.0 0.025 0.0 128-129 9.1875 0.0 0.0 0.025 0.0 130-131 9.825 0.0 0.0 0.025 0.0 132-133 10.8 0.0 0.0 0.025 0.0 134-135 11.4125 0.0 0.0 0.025 0.0 136-137 12.25 0.0 0.0 0.025 0.0 138-139 12.8875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGACA 10 0.0069954093 143.85 5 AGTAGTC 10 0.0069954093 143.85 3 TTGGGAA 10 0.0069954093 143.85 7 AGACTGT 10 0.0069954093 143.85 3 TGGGAAG 10 0.0069954093 143.85 8 GTAGTCA 10 0.0069954093 143.85 4 >>END_MODULE Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663989 spots for SRR7169780.sra Written 663989 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra Read 663972 spots for SRR7169780.sra Written 663972 spots for SRR7169780.sra SRR ids: ['SRR7169780.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_04db61xx SRR7169780.sra spots: 13279457 blocks: [[1, 663972], [663973, 1327944], [1327945, 1991916], [1991917, 2655888], [2655889, 3319860], [3319861, 3983832], [3983833, 4647804], [4647805, 5311776], [5311777, 5975748], [5975749, 6639720], [6639721, 7303692], [7303693, 7967664], [7967665, 8631636], [8631637, 9295608], [9295609, 9959580], [9959581, 10623552], [10623553, 11287524], [11287525, 11951496], [11951497, 12615468], [12615469, 13279457]] SRR7169780 file size 4478271 SRR7169780 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169780 SRR7169780_1.fastq SRR7169780_2.fastq Input file: SRR7169780_1.fastq Paired file: SRR7169780_2.fastq trimmed: SRR7169780-trimmed-pair1.fastq, SRR7169780-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:12:27 2025 >> started Tue Feb 11 16:12:42 2025 >> done (15.420s) 13279457 read pairs processed; of these: 11195 ( 0.08%) short read pairs filtered out after trimming by size control 30650 ( 0.23%) empty read pairs filtered out after trimming by size control 13237612 (99.68%) read pairs available; of these: 6602507 (49.88%) trimmed read pairs available after processing 6635105 (50.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 4 0.00% 24 8 0.00% 25 5 0.00% 26 9 0.00% 27 11 0.00% 28 11 0.00% 29 4 0.00% 30 9 0.00% 31 19 0.00% 32 8 0.00% 33 11 0.00% 34 11 0.00% 35 14 0.00% 36 9 0.00% 37 17 0.00% 38 20 0.00% 39 23 0.00% 40 34 0.00% 41 30 0.00% 42 46 0.00% 43 36 0.00% 44 44 0.00% 45 64 0.00% 46 56 0.00% 47 80 0.00% 48 112 0.00% 49 108 0.00% 50 126 0.00% 51 148 0.00% 52 162 0.00% 53 180 0.00% 54 214 0.00% 55 192 0.00% 56 271 0.00% 57 280 0.00% 58 304 0.00% 59 350 0.00% 60 427 0.00% 61 518 0.00% 62 614 0.00% 63 708 0.01% 64 732 0.01% 65 885 0.01% 66 953 0.01% 67 1122 0.01% 68 1256 0.01% 69 1359 0.01% 70 1644 0.01% 71 1933 0.01% 72 2195 0.02% 73 2430 0.02% 74 2762 0.02% 75 3002 0.02% 76 3714 0.03% 77 3903 0.03% 78 4092 0.03% 79 4590 0.03% 80 5009 0.04% 81 5654 0.04% 82 6487 0.05% 83 7361 0.06% 84 8719 0.07% 85 9864 0.07% 86 10314 0.08% 87 11348 0.09% 88 11835 0.09% 89 12552 0.09% 90 13434 0.10% 91 14213 0.11% 92 15290 0.12% 93 16539 0.12% 94 17694 0.13% 95 19393 0.15% 96 19840 0.15% 97 20886 0.16% 98 21399 0.16% 99 22113 0.17% 100 23183 0.18% 101 23722 0.18% 102 25252 0.19% 103 27045 0.20% 104 28161 0.21% 105 30073 0.23% 106 31130 0.24% 107 31695 0.24% 108 32487 0.25% 109 33225 0.25% 110 34218 0.26% 111 34876 0.26% 112 36328 0.27% 113 37666 0.28% 114 39154 0.30% 115 41004 0.31% 116 42032 0.32% 117 42635 0.32% 118 43611 0.33% 119 43615 0.33% 120 44423 0.34% 121 45489 0.34% 122 46143 0.35% 123 47597 0.36% 124 49418 0.37% 125 51000 0.39% 126 52104 0.39% 127 53590 0.40% 128 54687 0.41% 129 55251 0.42% 130 56246 0.42% 131 57468 0.43% 132 58483 0.44% 133 59661 0.45% 134 61553 0.46% 135 63371 0.48% 136 66249 0.50% 137 68472 0.52% 138 70478 0.53% 139 73609 0.56% 140 76273 0.58% 141 81593 0.62% 142 86475 0.65% 143 91092 0.69% 144 102048 0.77% 145 118695 0.90% 146 139567 1.05% 147 185007 1.40% 148 266696 2.01% 149 522516 3.95% 150 2804314 21.18% 151 6635105 50.12% 13237612 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.5 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=259.12 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.04 fanout-score-rank=20 prefix-density=0.31 prefix-fanout=3.5 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=12 fanout-score=58.67 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=14.1 sequence=TGTTGGTGGTGG SRR7169780 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:13:28 Started mapping on | Feb 11 16:13:28 Finished on | Feb 11 16:14:50 Mapping speed, Million of reads per hour | 581.16 Number of input reads | 13237612 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12672123 Uniquely mapped reads % | 95.73% Average mapped length | 289.34 Number of splices: Total | 11710142 Number of splices: Annotated (sjdb) | 11506264 Number of splices: GT/AG | 11540060 Number of splices: GC/AG | 134246 Number of splices: AT/AC | 9729 Number of splices: Non-canonical | 26107 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 258409 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 20153 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 317825 317825 317825 N_multimapping 258409 258409 258409 N_noFeature 275629 12524521 338862 N_ambiguous 130769 618 46038 UnstrandedReadsAssigned:12265725 PositiveStrandReadsAssigned:146984 NegativeStrandReadsAssigned:12287223 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169780 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169780-trimmed-pair1.fastq SRR7169780-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,237,612 reads, 12,206,405 reads pseudoaligned [quant] estimated average fragment length: 208.158 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7169780.ke.tsv 34699 SRR7169780.se.tsv 87100 total ==> SRR7169780.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.84 235 10.3095 Potri.005G024800.1.v4.1 1035 827.842 24 2.30311 Potri.004G059700.1.v4.1 961 753.848 2 0.210764 Potri.007G009000.2.v4.1 1416 1208.84 0 0 Potri.003G141000.2.v4.1 2943 2735.84 209 6.06885 Potri.016G087400.1.v4.1 270 94.8338 1227.83 1028.55 Potri.015G069301.1.v4.1 564 358.424 0 0 Potri.010G195200.1.v4.1 1773 1565.84 0 0 Potri.012G127500.1.v4.1 977 769.848 3968 409.466 ==> SRR7169780.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 782 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 201 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169780 completed mapping pipeline successfully