Starting /dee2/code/volunteer_pipeline.sh SRR7169781 current disk space = 3049968783360 free memory = 1465828508 SRR7169781 SRAfilesize 0b3f1499da9cefbb4914f0b68e98fca0 SRR7169781.sra SRR7169781.sra file validated SRR7169781 is paired end SRR7169781 is conventional basespace SRR7169781 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169781_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.91225 25.0 18.0 32.0 18.0 33.0 2 26.03025 27.0 18.0 32.0 18.0 33.0 3 28.91875 30.0 27.0 31.0 25.0 33.0 4 31.4115 33.0 31.0 33.0 29.0 33.0 5 32.43825 33.0 33.0 33.0 32.0 33.0 6 36.3305 38.0 36.0 38.0 34.0 38.0 7 36.80425 38.0 37.0 38.0 34.0 38.0 8 37.14775 38.0 38.0 38.0 36.0 38.0 9 37.41125 38.0 38.0 38.0 37.0 38.0 10-14 37.49765 38.0 38.0 38.0 37.2 38.0 15-19 37.518449999999994 38.0 38.0 38.0 37.8 38.0 20-24 37.5121 38.0 38.0 38.0 37.8 38.0 25-29 37.558899999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.475 38.0 38.0 38.0 38.0 38.0 35-39 37.41745 38.0 38.0 38.0 37.0 38.0 40-44 37.38205 38.0 38.0 38.0 37.0 38.0 45-49 37.41775 38.0 38.0 38.0 37.0 38.0 50-54 37.326899999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.191700000000004 38.0 38.0 38.0 36.6 38.0 60-64 37.139950000000006 38.0 38.0 38.0 36.4 38.0 65-69 37.16995 38.0 38.0 38.0 36.4 38.0 70-74 37.205799999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.0988 38.0 38.0 38.0 36.0 38.0 80-84 37.01665 38.0 38.0 38.0 36.0 38.0 85-89 36.88705 38.0 38.0 38.0 35.8 38.0 90-94 36.8523 38.0 38.0 38.0 35.2 38.0 95-99 36.85835 38.0 38.0 38.0 35.6 38.0 100-104 36.70694999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.48425 38.0 38.0 38.0 34.6 38.0 110-114 36.25574999999999 38.0 38.0 38.0 33.8 38.0 115-119 36.223650000000006 38.0 37.6 38.0 33.8 38.0 120-124 36.2489 38.0 37.4 38.0 34.0 38.0 125-129 36.141549999999995 38.0 37.4 38.0 33.6 38.0 130-134 35.88195 38.0 37.0 38.0 32.6 38.0 135-139 35.54395 38.0 36.2 38.0 31.2 38.0 140-144 34.9827 38.0 35.6 38.0 28.2 38.0 145-149 34.75335 38.0 35.2 38.0 28.8 38.0 150-151 31.06725 36.5 29.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 3.0 16 0.0 17 2.0 18 3.0 19 1.0 20 2.0 21 1.0 22 7.0 23 3.0 24 3.0 25 7.0 26 6.0 27 8.0 28 22.0 29 31.0 30 46.0 31 51.0 32 63.0 33 90.0 34 142.0 35 291.0 36 688.0 37 2525.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.397795591182366 10.97194388777555 10.470941883767534 42.15931863727455 2 21.725 14.45 32.225 31.6 3 19.275000000000002 19.875 25.4 35.449999999999996 4 23.125 28.275 21.224999999999998 27.375 5 22.225 32.225 23.974999999999998 21.575 6 19.25 35.475 25.424999999999997 19.85 7 14.099999999999998 26.05 42.35 17.5 8 17.917917917917915 25.375375375375377 31.931931931931935 24.774774774774773 9 17.675 25.974999999999998 33.475 22.875 10-14 19.675 30.175 26.834999999999997 23.315 15-19 20.05 28.92 27.755000000000003 23.275000000000002 20-24 19.015 29.03 27.655 24.3 25-29 19.72 29.509999999999998 26.955000000000002 23.815 30-34 20.07 29.049999999999997 27.200000000000003 23.68 35-39 19.89 29.439999999999998 26.755000000000003 23.915 40-44 20.255000000000003 29.215000000000003 26.8 23.73 45-49 19.955000000000002 29.2 26.900000000000002 23.945 50-54 19.900000000000002 28.99 27.38 23.73 55-59 19.845 29.025000000000002 27.51 23.62 60-64 19.7 28.475 27.560000000000002 24.265 65-69 19.830000000000002 28.985 27.265 23.919999999999998 70-74 20.625 28.294999999999998 27.6 23.48 75-79 19.905 28.744999999999997 27.705000000000002 23.645 80-84 19.91 29.075 27.450000000000003 23.565 85-89 20.474999999999998 28.310000000000002 27.705000000000002 23.51 90-94 20.369999999999997 28.189999999999998 27.525 23.915 95-99 20.45 28.74 27.115000000000002 23.695 100-104 20.895 28.645 27.015 23.445 105-109 20.26206134846127 28.530548722325417 26.974245695065015 24.233144234148302 110-114 20.057320997586483 28.987329042638777 26.870474658085275 24.08487530168946 115-119 20.741037051852594 28.61143057152858 26.976348817440872 23.67118355917796 120-124 21.125 27.975 27.08 23.82 125-129 21.044999999999998 28.815 26.605 23.535 130-134 21.205 28.494999999999997 26.284999999999997 24.015 135-139 20.977097709770977 28.78787878787879 25.967596759675963 24.267426742674267 140-144 20.96919383876775 28.155631126225245 26.380276055211045 24.49489897979596 145-149 21.2 28.71 26.224999999999998 23.865 150-151 20.913070669168228 28.267667292057535 26.19136960600375 24.62789243277048 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 3.0 26 3.5 27 5.5 28 8.5 29 12.5 30 19.0 31 23.0 32 24.5 33 35.0 34 53.0 35 70.0 36 84.0 37 110.0 38 142.0 39 168.0 40 184.0 41 204.5 42 230.0 43 243.5 44 264.5 45 281.0 46 278.0 47 278.0 48 255.0 49 211.5 50 187.0 51 151.5 52 110.5 53 86.5 54 76.5 55 60.0 56 37.0 57 25.5 58 19.0 59 10.0 60 7.5 61 8.5 62 4.0 63 2.0 64 1.5 65 4.0 66 4.5 67 1.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.1 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.40499999999999997 110-114 0.5599999999999999 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.02 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19354838709677 98.4 2 0.8064516129032258 1.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.75 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.5375 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.275 0.0 0.0 0.0 0.0 112-113 3.5875 0.0 0.0 0.0 0.0 114-115 4.05 0.0 0.0 0.0 0.0 116-117 4.375 0.0 0.0 0.0 0.0 118-119 4.9125 0.0 0.0 0.0 0.0 120-121 5.3125 0.0 0.0 0.0 0.0 122-123 5.9125 0.0 0.0 0.0 0.0 124-125 6.4 0.0 0.0 0.0 0.0 126-127 6.987500000000001 0.0 0.0 0.0 0.0 128-129 7.775 0.0 0.0 0.0 0.0 130-131 8.5 0.0 0.0 0.0 0.0 132-133 9.2125 0.0 0.0 0.0 0.0 134-135 9.85 0.0 0.0 0.0 0.0 136-137 10.6625 0.0 0.0 0.0 0.0 138-139 11.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGATGCA 10 0.0068449317 144.90001 1 >>END_MODULE SRR7169781 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169781_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80275 33.0 33.0 34.0 32.0 34.0 2 33.0025 34.0 33.0 34.0 32.0 34.0 3 33.068 34.0 33.0 34.0 33.0 34.0 4 33.01925 34.0 33.0 34.0 33.0 34.0 5 32.9645 34.0 33.0 34.0 32.0 34.0 6 37.10875 38.0 38.0 38.0 37.0 38.0 7 37.136 38.0 38.0 38.0 37.0 38.0 8 37.10225 38.0 38.0 38.0 37.0 38.0 9 37.14275 38.0 38.0 38.0 37.0 38.0 10-14 37.03144999999999 38.0 38.0 38.0 36.8 38.0 15-19 37.07770000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.04755 38.0 38.0 38.0 37.0 38.0 25-29 36.96785 38.0 38.0 38.0 36.6 38.0 30-34 36.875449999999994 38.0 38.0 38.0 36.4 38.0 35-39 36.7581 38.0 38.0 38.0 35.8 38.0 40-44 36.75785 38.0 38.0 38.0 35.8 38.0 45-49 36.7818 38.0 38.0 38.0 36.0 38.0 50-54 36.381800000000005 38.0 38.0 38.0 34.4 38.0 55-59 36.2973 38.0 37.8 38.0 33.0 38.0 60-64 36.59570000000001 38.0 38.0 38.0 35.0 38.0 65-69 36.80985 38.0 38.0 38.0 36.0 38.0 70-74 36.465199999999996 38.0 38.0 38.0 35.2 38.0 75-79 35.53320000000001 38.0 38.0 38.0 33.0 38.0 80-84 36.12645 38.0 38.0 38.0 33.8 38.0 85-89 36.39825 38.0 38.0 38.0 34.2 38.0 90-94 36.4354 38.0 38.0 38.0 34.2 38.0 95-99 36.30515 38.0 38.0 38.0 34.4 38.0 100-104 35.93365000000001 38.0 38.0 38.0 33.2 38.0 105-109 35.04705 38.0 37.4 38.0 29.4 38.0 110-114 33.40025000000001 38.0 35.4 38.0 16.2 38.0 115-119 33.1788 38.0 36.0 38.0 14.0 38.0 120-124 33.40585 38.0 35.6 38.0 16.0 38.0 125-129 33.823550000000004 38.0 36.0 38.0 19.6 38.0 130-134 34.54185 38.0 35.6 38.0 25.2 38.0 135-139 34.262350000000005 38.0 35.4 38.0 23.8 38.0 140-144 33.4751 38.0 34.2 38.0 21.8 38.0 145-149 33.4542 38.0 33.0 38.0 20.6 38.0 150-151 28.719625 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 5.0 5 1.0 6 1.0 7 1.0 8 0.0 9 3.0 10 2.0 11 3.0 12 2.0 13 2.0 14 5.0 15 5.0 16 5.0 17 3.0 18 7.0 19 10.0 20 14.0 21 5.0 22 15.0 23 23.0 24 15.0 25 22.0 26 15.0 27 28.0 28 50.0 29 63.0 30 71.0 31 96.0 32 92.0 33 139.0 34 158.0 35 257.0 36 562.0 37 2309.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.0 19.05 16.575 27.375 2 27.800000000000004 25.324999999999996 30.275000000000002 16.6 3 19.6 28.9 30.65 20.849999999999998 4 22.95 33.800000000000004 23.875 19.375 5 26.408010012515643 34.51814768460576 22.453066332916144 16.62077596996245 6 20.01000500250125 37.51875937968984 23.611805902951478 18.859429714857427 7 19.475 20.75 40.025 19.75 8 22.225 25.3 27.125 25.35 9 21.375 25.15 30.5 22.975 10-14 23.886194309715485 28.891444572228615 25.82629131456573 21.396069803490175 15-19 23.419051430858513 28.026816089653796 27.641584950970582 20.912547528517113 20-24 23.297132275661877 27.941544467243883 27.541164105900606 21.220159151193634 25-29 23.339003402041225 28.26195717430458 27.396437862717633 21.00260156093656 30-34 23.532355737951054 28.231820229217757 27.651268705270006 20.584555327561183 35-39 23.165482030233257 28.461307438181997 27.665431975172687 20.707778556412055 40-44 23.911955977988995 27.818909454727365 27.978989494747374 20.290145072536266 45-49 23.143929912390487 28.28535669586984 27.83979974968711 20.730913642052563 50-54 23.697655780404727 27.604688439190543 28.200761370466843 20.496894409937887 55-59 23.766591535186578 27.43801652892562 27.9839719509141 20.811419984973703 60-64 23.663931144915935 27.722177742193754 27.942353883106485 20.671537229783826 65-69 24.139483690214128 27.38142885731439 28.07184310586352 20.407244346607964 70-74 23.923228048964788 27.84746360384867 27.565361946501437 20.663946400685106 75-79 23.695730545398362 27.39352114126796 28.505948395735697 20.404799917597984 80-84 23.236242693005444 27.82201169119129 28.19995968554727 20.741785930255997 85-89 23.56416804366331 27.780281408041663 28.556406789845273 20.099143758449753 90-94 23.73610972069276 27.395134648112922 28.646511162278504 20.222244468915807 95-99 24.236660326358994 27.31504655120633 28.125938532385625 20.322354590049056 100-104 23.95551547941088 27.48722572888488 28.469091273419494 20.08816751828474 105-109 23.921850161530177 28.039587713450594 28.013948002666528 20.0246141223527 110-114 24.37019358260408 27.594802439671174 27.84937682312384 20.1856271546009 115-119 24.97966708236187 27.023803068915036 27.89676299951201 20.099766849211083 120-124 24.95216836734694 27.614795918367346 27.561649659863946 19.87138605442177 125-129 25.29445636810972 28.23116787939067 26.94341202952416 19.53096372297545 130-134 25.815217391304344 27.95390499194847 27.385265700483092 18.84561191626409 135-139 25.840672538030425 27.90732586068855 27.081665332265814 19.170336269015213 140-144 26.32659191029235 27.50800961153384 27.312775330396477 18.852623147777333 145-149 26.50783322488613 28.14955703488663 26.67300665698984 18.669603083237398 150-151 26.900438321853475 26.938008766437072 27.33876017532874 18.822792736380713 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.0 24 4.5 25 3.5 26 0.0 27 1.0 28 4.5 29 8.5 30 11.0 31 16.5 32 20.0 33 28.5 34 39.5 35 54.0 36 74.5 37 98.5 38 134.0 39 167.0 40 201.0 41 238.0 42 270.0 43 285.5 44 289.0 45 274.0 46 269.5 47 279.0 48 265.5 49 222.0 50 164.5 51 137.0 52 112.0 53 84.0 54 64.5 55 42.5 56 32.0 57 27.5 58 20.5 59 16.0 60 11.5 61 6.5 62 4.5 63 3.0 64 2.5 65 3.0 66 2.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.125 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.06 20-24 0.095 25-29 0.06 30-34 0.095 35-39 0.11 40-44 0.05 45-49 0.125 50-54 0.18 55-59 0.17500000000000002 60-64 0.08 65-69 0.06 70-74 0.745 75-79 2.915 80-84 0.7799999999999999 85-89 0.145 90-94 0.11 95-99 0.11 100-104 0.19 105-109 2.495 110-114 5.7250000000000005 115-119 7.785 120-124 5.92 125-129 4.485 130-134 0.64 135-139 0.08 140-144 0.12 145-149 0.105 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14249684741489 98.275 2 0.832282471626734 1.6500000000000001 3 0.025220680958385876 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.075 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 2.95 0.0 0.0 0.0 0.0 112-113 3.2625 0.0 0.0 0.0 0.0 114-115 3.6875 0.0 0.0 0.0 0.0 116-117 4.0375 0.0 0.0 0.0 0.0 118-119 4.5 0.0 0.0 0.0 0.0 120-121 4.85 0.0 0.0 0.0 0.0 122-123 5.4375 0.0 0.0 0.0 0.0 124-125 5.887499999999999 0.0 0.0 0.0 0.0 126-127 6.425 0.0 0.0 0.0 0.0 128-129 7.199999999999999 0.0 0.0 0.0 0.0 130-131 7.925 0.0 0.0 0.0 0.0 132-133 8.675 0.0 0.0 0.0 0.0 134-135 9.325 0.0 0.0 0.0 0.0 136-137 10.1375 0.0 0.0 0.0 0.0 138-139 11.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAGAG 10 0.0071973195 142.4875 5 >>END_MODULE Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566775 spots for SRR7169781.sra Written 566775 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra Read 566762 spots for SRR7169781.sra Written 566762 spots for SRR7169781.sra SRR ids: ['SRR7169781.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1g42hros SRR7169781.sra spots: 11335253 blocks: [[1, 566762], [566763, 1133524], [1133525, 1700286], [1700287, 2267048], [2267049, 2833810], [2833811, 3400572], [3400573, 3967334], [3967335, 4534096], [4534097, 5100858], [5100859, 5667620], [5667621, 6234382], [6234383, 6801144], [6801145, 7367906], [7367907, 7934668], [7934669, 8501430], [8501431, 9068192], [9068193, 9634954], [9634955, 10201716], [10201717, 10768478], [10768479, 11335253]] SRR7169781 file size 3819444 SRR7169781 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169781 SRR7169781_1.fastq SRR7169781_2.fastq Input file: SRR7169781_1.fastq Paired file: SRR7169781_2.fastq trimmed: SRR7169781-trimmed-pair1.fastq, SRR7169781-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:51:43 2025 >> started Tue Feb 11 14:51:57 2025 >> done (13.822s) 11335253 read pairs processed; of these: 13179 ( 0.12%) short read pairs filtered out after trimming by size control 12797 ( 0.11%) empty read pairs filtered out after trimming by size control 11309277 (99.77%) read pairs available; of these: 5350861 (47.31%) trimmed read pairs available after processing 5958416 (52.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 3 0.00% 22 6 0.00% 23 4 0.00% 24 3 0.00% 25 5 0.00% 26 6 0.00% 27 7 0.00% 28 4 0.00% 29 1 0.00% 30 3 0.00% 31 5 0.00% 32 8 0.00% 33 4 0.00% 34 9 0.00% 35 13 0.00% 36 16 0.00% 37 12 0.00% 38 14 0.00% 39 17 0.00% 40 18 0.00% 41 22 0.00% 42 28 0.00% 43 18 0.00% 44 28 0.00% 45 33 0.00% 46 33 0.00% 47 42 0.00% 48 42 0.00% 49 53 0.00% 50 61 0.00% 51 62 0.00% 52 93 0.00% 53 96 0.00% 54 103 0.00% 55 114 0.00% 56 166 0.00% 57 162 0.00% 58 194 0.00% 59 214 0.00% 60 235 0.00% 61 278 0.00% 62 287 0.00% 63 350 0.00% 64 403 0.00% 65 457 0.00% 66 549 0.00% 67 598 0.01% 68 632 0.01% 69 736 0.01% 70 888 0.01% 71 1045 0.01% 72 1194 0.01% 73 1432 0.01% 74 1592 0.01% 75 1654 0.01% 76 1846 0.02% 77 2246 0.02% 78 2351 0.02% 79 2598 0.02% 80 2974 0.03% 81 3266 0.03% 82 3904 0.03% 83 4387 0.04% 84 5374 0.05% 85 6093 0.05% 86 6579 0.06% 87 7123 0.06% 88 7871 0.07% 89 8079 0.07% 90 8477 0.07% 91 9281 0.08% 92 9977 0.09% 93 10886 0.10% 94 11773 0.10% 95 12791 0.11% 96 13349 0.12% 97 14212 0.13% 98 14362 0.13% 99 15167 0.13% 100 16196 0.14% 101 16852 0.15% 102 18188 0.16% 103 19292 0.17% 104 20020 0.18% 105 21341 0.19% 106 22385 0.20% 107 22955 0.20% 108 23477 0.21% 109 24332 0.22% 110 25293 0.22% 111 25838 0.23% 112 27175 0.24% 113 28188 0.25% 114 29390 0.26% 115 31050 0.27% 116 31690 0.28% 117 32367 0.29% 118 32809 0.29% 119 33973 0.30% 120 33914 0.30% 121 34798 0.31% 122 36349 0.32% 123 37159 0.33% 124 38794 0.34% 125 40379 0.36% 126 41714 0.37% 127 43001 0.38% 128 44006 0.39% 129 44561 0.39% 130 45331 0.40% 131 45816 0.41% 132 47351 0.42% 133 49125 0.43% 134 50257 0.44% 135 52585 0.46% 136 54548 0.48% 137 56651 0.50% 138 58816 0.52% 139 61489 0.54% 140 64812 0.57% 141 67851 0.60% 142 72264 0.64% 143 78742 0.70% 144 88044 0.78% 145 101081 0.89% 146 120096 1.06% 147 154971 1.37% 148 223978 1.98% 149 423442 3.74% 150 2337101 20.67% 151 5958416 52.69% 11309277 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=11.07 fanout-score-rank=13 prefix-density=0.27 prefix-fanout=6.8 sequence=CAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=41 fanout-score=115.93 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=16.0 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACGCTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=34 prefix-density=0.25 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=206.58 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.0 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATG SRR7169781 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:52:46 Started mapping on | Feb 11 14:52:46 Finished on | Feb 11 14:53:46 Mapping speed, Million of reads per hour | 678.56 Number of input reads | 11309277 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 10881725 Uniquely mapped reads % | 96.22% Average mapped length | 290.83 Number of splices: Total | 9845504 Number of splices: Annotated (sjdb) | 9680869 Number of splices: GT/AG | 9698972 Number of splices: GC/AG | 116188 Number of splices: AT/AC | 8204 Number of splices: Non-canonical | 22140 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 194708 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 14666 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.89% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 243136 243136 243136 N_multimapping 194708 194708 194708 N_noFeature 246436 10760890 297835 N_ambiguous 114934 836 44886 UnstrandedReadsAssigned:10520355 PositiveStrandReadsAssigned:119999 NegativeStrandReadsAssigned:10539004 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169781 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169781-trimmed-pair1.fastq SRR7169781-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,309,277 reads, 10,461,743 reads pseudoaligned [quant] estimated average fragment length: 213.336 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR7169781.ke.tsv 34699 SRR7169781.se.tsv 87100 total ==> SRR7169781.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.66 225 12.2685 Potri.005G024800.1.v4.1 1035 822.664 40 4.78723 Potri.004G059700.1.v4.1 961 748.664 5 0.657551 Potri.007G009000.2.v4.1 1416 1203.66 0 0 Potri.003G141000.2.v4.1 2943 2730.66 180 6.49009 Potri.016G087400.1.v4.1 270 91.4103 1106 1191.26 Potri.015G069301.1.v4.1 564 353.715 0 0 Potri.010G195200.1.v4.1 1773 1560.66 30 1.8926 Potri.012G127500.1.v4.1 977 764.664 3785 487.351 ==> SRR7169781.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 991 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169781 completed mapping pipeline successfully