Starting /dee2/code/volunteer_pipeline.sh SRR7169782 current disk space = 3049495969792 free memory = 1476990464 SRR7169782 SRAfilesize a0acb8b16df20b407af18d8e085556a2 SRR7169782.sra SRR7169782.sra file validated SRR7169782 is paired end SRR7169782 is conventional basespace SRR7169782 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169782_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.706 27.0 18.0 33.0 18.0 33.0 2 26.895 29.0 25.0 31.0 18.0 33.0 3 29.07475 31.0 27.0 33.0 18.0 33.0 4 31.648 33.0 31.0 33.0 29.0 33.0 5 32.496 33.0 33.0 33.0 32.0 33.0 6 36.31125 38.0 36.0 38.0 34.0 38.0 7 36.81225 38.0 37.0 38.0 35.0 38.0 8 37.11725 38.0 38.0 38.0 36.0 38.0 9 37.46725 38.0 38.0 38.0 37.0 38.0 10-14 37.4906 38.0 38.0 38.0 37.4 38.0 15-19 37.5776 38.0 38.0 38.0 37.8 38.0 20-24 37.63695 38.0 38.0 38.0 38.0 38.0 25-29 37.6016 38.0 38.0 38.0 38.0 38.0 30-34 37.547700000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.4258 38.0 38.0 38.0 37.4 38.0 40-44 37.174350000000004 38.0 38.0 38.0 36.6 38.0 45-49 37.3498 38.0 38.0 38.0 37.0 38.0 50-54 37.40525 38.0 38.0 38.0 37.0 38.0 55-59 37.3714 38.0 38.0 38.0 37.0 38.0 60-64 37.29045 38.0 38.0 38.0 37.0 38.0 65-69 37.19545000000001 38.0 38.0 38.0 36.4 38.0 70-74 37.14875 38.0 38.0 38.0 36.0 38.0 75-79 37.13125 38.0 38.0 38.0 36.0 38.0 80-84 37.0504 38.0 38.0 38.0 36.0 38.0 85-89 36.89675 38.0 38.0 38.0 35.6 38.0 90-94 36.7986 38.0 38.0 38.0 35.0 38.0 95-99 36.793 38.0 38.0 38.0 35.0 38.0 100-104 36.60465000000001 38.0 38.0 38.0 34.4 38.0 105-109 36.394149999999996 38.0 37.8 38.0 34.0 38.0 110-114 36.32755 38.0 38.0 38.0 34.0 38.0 115-119 36.1456 38.0 37.2 38.0 33.4 38.0 120-124 35.9316 38.0 36.8 38.0 32.6 38.0 125-129 35.78445 38.0 36.4 38.0 32.2 38.0 130-134 35.41180000000001 38.0 35.8 38.0 30.2 38.0 135-139 35.14575000000001 38.0 35.6 38.0 29.8 38.0 140-144 34.7329 38.0 35.0 38.0 28.0 38.0 145-149 34.223200000000006 38.0 35.0 38.0 26.4 38.0 150-151 30.279125 36.0 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 1.0 18 3.0 19 1.0 20 0.0 21 5.0 22 5.0 23 8.0 24 6.0 25 11.0 26 13.0 27 11.0 28 17.0 29 30.0 30 31.0 31 41.0 32 60.0 33 102.0 34 157.0 35 293.0 36 864.0 37 2335.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.76824034334764 9.946983085079525 10.022721534965918 42.26205503660692 2 20.4 14.649999999999999 34.625 30.325000000000003 3 18.85 20.375 25.55 35.225 4 22.75 28.9 23.225 25.124999999999996 5 21.4 33.800000000000004 24.349999999999998 20.45 6 19.375 35.35 24.975 20.3 7 14.099999999999998 24.95 42.55 18.4 8 16.45 24.775 31.924999999999997 26.85 9 18.075 24.45 34.375 23.1 10-14 19.98 29.95 26.490000000000002 23.580000000000002 15-19 19.905 29.255 27.265 23.575 20-24 20.225 28.9 27.744999999999997 23.13 25-29 20.09 29.07 27.200000000000003 23.64 30-34 19.62 29.24 27.500000000000004 23.64 35-39 19.71 29.270000000000003 26.815 24.205 40-44 19.41 29.15 27.85 23.59 45-49 19.85 28.715000000000003 27.275 24.16 50-54 20.119999999999997 28.655 27.855 23.369999999999997 55-59 19.869999999999997 28.499999999999996 27.765 23.865 60-64 20.39 28.499999999999996 27.43 23.68 65-69 20.075000000000003 28.89 27.24 23.794999999999998 70-74 19.725 28.720000000000002 27.845 23.71 75-79 20.655 28.625 27.265 23.455000000000002 80-84 20.055 28.110000000000003 27.43 24.404999999999998 85-89 20.615 28.544999999999998 27.615000000000002 23.225 90-94 20.185 28.439999999999998 27.815 23.56 95-99 20.145 28.794999999999998 27.415 23.645 100-104 20.794999999999998 28.76 26.834999999999997 23.61 105-109 20.24 28.799999999999997 27.165 23.794999999999998 110-114 20.505000000000003 28.725 27.650000000000002 23.119999999999997 115-119 20.794999999999998 29.099999999999998 26.555 23.549999999999997 120-124 20.57 28.01 27.925 23.494999999999997 125-129 20.825 28.185 26.69 24.3 130-134 20.86 28.610000000000003 26.474999999999998 24.055 135-139 20.96 28.060000000000002 27.339999999999996 23.64 140-144 21.475 28.205000000000002 26.479999999999997 23.84 145-149 21.7 28.005000000000003 26.345000000000002 23.95 150-151 20.3375 29.2 26.687499999999996 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 0.5 24 1.5 25 2.5 26 4.5 27 8.0 28 10.0 29 11.5 30 18.5 31 27.5 32 34.0 33 42.0 34 54.5 35 72.5 36 83.0 37 98.0 38 125.5 39 156.5 40 192.5 41 214.5 42 241.5 43 263.0 44 264.0 45 269.0 46 284.0 47 285.5 48 239.0 49 195.5 50 173.0 51 141.5 52 111.5 53 91.0 54 74.5 55 55.0 56 40.5 57 28.0 58 20.0 59 14.5 60 10.5 61 9.0 62 7.5 63 6.5 64 2.0 65 1.5 66 2.5 67 2.5 68 1.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.6375000000000002 0.0 0.0 0.0 0.0 106-107 1.9249999999999998 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.5875000000000004 0.0 0.0 0.0 0.0 118-119 4.050000000000001 0.0 0.0 0.0 0.0 120-121 4.4125 0.0 0.0 0.0 0.0 122-123 4.7375 0.0 0.0 0.0 0.0 124-125 5.050000000000001 0.0 0.0 0.0 0.0 126-127 5.550000000000001 0.0 0.0 0.0 0.0 128-129 6.1 0.0 0.0 0.0 0.0 130-131 6.762499999999999 0.0 0.0 0.0 0.0 132-133 7.300000000000001 0.0 0.0 0.0 0.0 134-135 7.800000000000001 0.0 0.0 0.0 0.0 136-137 8.475000000000001 0.0 0.0 0.0 0.0 138-139 9.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTTCA 10 0.006830828 145.0 4 CCCATAT 10 0.006830828 145.0 1 CCATTTC 10 0.006830828 145.0 3 CCCCATT 10 0.006830828 145.0 1 CATATGT 10 0.006830828 145.0 7 >>END_MODULE SRR7169782 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169782_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8935 33.0 33.0 34.0 32.0 34.0 2 32.1725 33.0 33.0 34.0 28.0 34.0 3 32.817 33.0 33.0 34.0 32.0 34.0 4 33.009 34.0 33.0 34.0 32.0 34.0 5 33.1505 34.0 33.0 34.0 33.0 34.0 6 37.40075 38.0 38.0 38.0 37.0 38.0 7 37.4365 38.0 38.0 38.0 38.0 38.0 8 37.3655 38.0 38.0 38.0 38.0 38.0 9 37.4845 38.0 38.0 38.0 38.0 38.0 10-14 37.384100000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.377050000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.3255 38.0 38.0 38.0 37.8 38.0 25-29 37.302600000000005 38.0 38.0 38.0 37.4 38.0 30-34 37.288900000000005 38.0 38.0 38.0 37.0 38.0 35-39 36.970800000000004 38.0 38.0 38.0 36.0 38.0 40-44 37.2198 38.0 38.0 38.0 37.0 38.0 45-49 36.715250000000005 38.0 38.0 38.0 35.2 38.0 50-54 36.9012 38.0 38.0 38.0 36.0 38.0 55-59 36.449799999999996 38.0 37.6 38.0 33.8 38.0 60-64 36.92035 38.0 38.0 38.0 36.0 38.0 65-69 36.9177 38.0 38.0 38.0 36.2 38.0 70-74 36.9045 38.0 38.0 38.0 36.0 38.0 75-79 36.7535 38.0 38.0 38.0 35.6 38.0 80-84 36.7797 38.0 38.0 38.0 35.8 38.0 85-89 35.90560000000001 38.0 37.0 38.0 31.8 38.0 90-94 36.6117 38.0 38.0 38.0 34.8 38.0 95-99 36.638799999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.50765 38.0 38.0 38.0 34.6 38.0 105-109 35.884249999999994 38.0 37.4 38.0 32.6 38.0 110-114 35.251850000000005 38.0 37.0 38.0 30.4 38.0 115-119 34.58175 38.0 36.4 38.0 26.4 38.0 120-124 34.84065 38.0 36.2 38.0 27.6 38.0 125-129 34.740050000000004 38.0 36.0 38.0 27.2 38.0 130-134 34.231550000000006 38.0 35.0 38.0 23.6 38.0 135-139 34.14045 38.0 35.0 38.0 23.4 38.0 140-144 33.0176 37.6 32.6 38.0 19.0 38.0 145-149 32.813050000000004 38.0 32.6 38.0 17.8 38.0 150-151 28.80175 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 5.0 4 3.0 5 1.0 6 0.0 7 1.0 8 2.0 9 0.0 10 1.0 11 3.0 12 2.0 13 1.0 14 1.0 15 2.0 16 4.0 17 4.0 18 5.0 19 9.0 20 2.0 21 5.0 22 8.0 23 8.0 24 12.0 25 13.0 26 17.0 27 21.0 28 40.0 29 38.0 30 49.0 31 57.0 32 90.0 33 129.0 34 178.0 35 306.0 36 783.0 37 2198.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.074999999999996 18.35 14.124999999999998 29.45 2 26.0 27.525 30.599999999999998 15.875 3 22.6 26.525 30.25 20.625 4 23.875 33.6 22.650000000000002 19.875 5 23.45 37.325 22.225 17.0 6 20.625 37.075 23.200000000000003 19.1 7 20.125 20.8 39.800000000000004 19.275000000000002 8 20.849999999999998 25.5 27.450000000000003 26.200000000000003 9 22.175 23.05 30.625000000000004 24.15 10-14 23.835 28.32 26.57 21.275 15-19 22.95 27.165 28.485 21.4 20-24 23.595 27.825 27.825 20.755000000000003 25-29 23.145 27.655 28.38 20.82 30-34 23.03 28.395 28.08 20.495 35-39 22.86 28.199999999999996 27.92 21.02 40-44 23.04 28.115000000000002 27.615000000000002 21.23 45-49 23.055 27.87 27.73 21.345 50-54 23.055 27.62 27.900000000000002 21.425 55-59 23.625 27.35 28.29 20.735 60-64 22.935 27.21 29.154999999999998 20.7 65-69 23.29 27.505000000000003 27.865000000000002 21.34 70-74 23.580000000000002 27.650000000000002 28.58 20.19 75-79 24.2 27.169999999999998 28.470000000000002 20.16 80-84 23.87 27.310000000000002 28.77 20.05 85-89 24.055 27.295 28.110000000000003 20.54 90-94 23.71 27.955000000000002 28.035 20.3 95-99 23.935000000000002 27.589999999999996 27.85 20.625 100-104 23.59 27.92 27.99 20.5 105-109 24.25 27.67 27.555000000000003 20.525 110-114 24.011184544992375 27.600406710726993 27.49872902897814 20.889679715302492 115-119 24.77821332783165 27.96575201155354 27.620177429337733 19.63585723127708 120-124 24.34080170705685 28.481430676218057 27.17573540618808 20.002032210537013 125-129 24.56726389310659 28.575766778013968 27.118129365320375 19.738839963559066 130-134 24.805 28.01 27.35 19.835 135-139 25.224999999999998 27.655 27.565 19.555 140-144 25.66 28.32 27.025 18.995 145-149 25.47 28.105000000000004 27.0 19.425 150-151 25.8 28.537499999999998 26.25 19.412499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 2.5 27 3.5 28 3.5 29 7.5 30 10.0 31 16.5 32 21.5 33 23.5 34 48.5 35 67.5 36 82.0 37 103.0 38 136.5 39 172.5 40 187.0 41 217.5 42 257.5 43 286.5 44 295.0 45 294.0 46 270.5 47 244.0 48 235.0 49 200.0 50 166.5 51 144.0 52 120.5 53 102.0 54 74.0 55 50.5 56 40.5 57 30.0 58 22.5 59 16.0 60 8.5 61 7.5 62 6.0 63 2.5 64 2.0 65 3.0 66 3.0 67 1.0 68 2.0 69 4.0 70 2.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 1.6500000000000001 115-119 3.06 120-124 1.585 125-129 1.21 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.925 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.45 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 3.1 0.0 0.0 0.0 0.0 116-117 3.4625000000000004 0.0 0.0 0.0 0.0 118-119 3.9250000000000003 0.0 0.0 0.0 0.0 120-121 4.2625 0.0 0.0 0.0 0.0 122-123 4.5875 0.0 0.0 0.0 0.0 124-125 4.9 0.0 0.0 0.0 0.0 126-127 5.4 0.0 0.0 0.0 0.0 128-129 5.925 0.0 0.0 0.0 0.0 130-131 6.5625 0.0 0.0 0.0 0.0 132-133 7.0875 0.0 0.0 0.0 0.0 134-135 7.574999999999999 0.0 0.0 0.0 0.0 136-137 8.2 0.0 0.0 0.0 0.0 138-139 8.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra Read 598082 spots for SRR7169782.sra Written 598082 spots for SRR7169782.sra Read 598081 spots for SRR7169782.sra Written 598081 spots for SRR7169782.sra SRR ids: ['SRR7169782.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8bgyq7np SRR7169782.sra spots: 11961621 blocks: [[1, 598081], [598082, 1196162], [1196163, 1794243], [1794244, 2392324], [2392325, 2990405], [2990406, 3588486], [3588487, 4186567], [4186568, 4784648], [4784649, 5382729], [5382730, 5980810], [5980811, 6578891], [6578892, 7176972], [7176973, 7775053], [7775054, 8373134], [8373135, 8971215], [8971216, 9569296], [9569297, 10167377], [10167378, 10765458], [10765459, 11363539], [11363540, 11961621]] SRR7169782 file size 4031700 SRR7169782 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169782 SRR7169782_1.fastq SRR7169782_2.fastq Input file: SRR7169782_1.fastq Paired file: SRR7169782_2.fastq trimmed: SRR7169782-trimmed-pair1.fastq, SRR7169782-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:51:21 2025 >> started Tue Feb 11 15:51:37 2025 >> done (15.189s) 11961621 read pairs processed; of these: 6819 ( 0.06%) short read pairs filtered out after trimming by size control 7650 ( 0.06%) empty read pairs filtered out after trimming by size control 11947152 (99.88%) read pairs available; of these: 5835543 (48.84%) trimmed read pairs available after processing 6111609 (51.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 4 0.00% 21 4 0.00% 22 2 0.00% 23 4 0.00% 24 3 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 2 0.00% 29 8 0.00% 30 9 0.00% 31 2 0.00% 32 3 0.00% 33 11 0.00% 34 6 0.00% 35 14 0.00% 36 5 0.00% 37 21 0.00% 38 16 0.00% 39 20 0.00% 40 17 0.00% 41 23 0.00% 42 22 0.00% 43 26 0.00% 44 28 0.00% 45 26 0.00% 46 40 0.00% 47 43 0.00% 48 41 0.00% 49 61 0.00% 50 57 0.00% 51 62 0.00% 52 96 0.00% 53 90 0.00% 54 102 0.00% 55 97 0.00% 56 141 0.00% 57 150 0.00% 58 181 0.00% 59 201 0.00% 60 237 0.00% 61 285 0.00% 62 303 0.00% 63 333 0.00% 64 394 0.00% 65 434 0.00% 66 458 0.00% 67 548 0.00% 68 600 0.01% 69 765 0.01% 70 797 0.01% 71 855 0.01% 72 1073 0.01% 73 1165 0.01% 74 1331 0.01% 75 1498 0.01% 76 1694 0.01% 77 1741 0.01% 78 1961 0.02% 79 2189 0.02% 80 2451 0.02% 81 2773 0.02% 82 3176 0.03% 83 3715 0.03% 84 4455 0.04% 85 5021 0.04% 86 5357 0.04% 87 5923 0.05% 88 6273 0.05% 89 6775 0.06% 90 7147 0.06% 91 7890 0.07% 92 8236 0.07% 93 9169 0.08% 94 9984 0.08% 95 10784 0.09% 96 11252 0.09% 97 11917 0.10% 98 12382 0.10% 99 12760 0.11% 100 13663 0.11% 101 14372 0.12% 102 15539 0.13% 103 16451 0.14% 104 17330 0.15% 105 18600 0.16% 106 19434 0.16% 107 19708 0.16% 108 20381 0.17% 109 21372 0.18% 110 21759 0.18% 111 22559 0.19% 112 23905 0.20% 113 24944 0.21% 114 26324 0.22% 115 27484 0.23% 116 28088 0.24% 117 29033 0.24% 118 29468 0.25% 119 29764 0.25% 120 30767 0.26% 121 31249 0.26% 122 32326 0.27% 123 33563 0.28% 124 34914 0.29% 125 36536 0.31% 126 38233 0.32% 127 38909 0.33% 128 39840 0.33% 129 40869 0.34% 130 41934 0.35% 131 42808 0.36% 132 43874 0.37% 133 45752 0.38% 134 47410 0.40% 135 48999 0.41% 136 51845 0.43% 137 53957 0.45% 138 56465 0.47% 139 59254 0.50% 140 63055 0.53% 141 67318 0.56% 142 73665 0.62% 143 81467 0.68% 144 93019 0.78% 145 110772 0.93% 146 134738 1.13% 147 179781 1.50% 148 269755 2.26% 149 528229 4.42% 150 2776314 23.24% 151 6111609 51.16% 11947152 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=39 prefix-density=0.18 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=351.26 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=34 prefix-density=0.24 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=84.56 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.4 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7169782 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:52:20 Started mapping on | Feb 11 15:52:20 Finished on | Feb 11 15:53:28 Mapping speed, Million of reads per hour | 632.50 Number of input reads | 11947152 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11309589 Uniquely mapped reads % | 94.66% Average mapped length | 292.23 Number of splices: Total | 10594946 Number of splices: Annotated (sjdb) | 10415496 Number of splices: GT/AG | 10440141 Number of splices: GC/AG | 124169 Number of splices: AT/AC | 8688 Number of splices: Non-canonical | 21948 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 227863 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 130582 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.18% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 417588 417588 417588 N_multimapping 227863 227863 227863 N_noFeature 276046 11190712 331870 N_ambiguous 106890 535 43586 UnstrandedReadsAssigned:10926653 PositiveStrandReadsAssigned:118342 NegativeStrandReadsAssigned:10934133 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169782 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169782-trimmed-pair1.fastq SRR7169782-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,947,152 reads, 10,944,599 reads pseudoaligned [quant] estimated average fragment length: 223.512 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR7169782.ke.tsv 34699 SRR7169782.se.tsv 87100 total ==> SRR7169782.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.49 187 9.81167 Potri.005G024800.1.v4.1 1035 812.488 30 3.47847 Potri.004G059700.1.v4.1 961 738.5 4 0.510262 Potri.007G009000.2.v4.1 1416 1193.49 0 0 Potri.003G141000.2.v4.1 2943 2720.49 240.041 8.31234 Potri.016G087400.1.v4.1 270 87.3294 1277 1377.57 Potri.015G069301.1.v4.1 564 343.688 0 0 Potri.010G195200.1.v4.1 1773 1550.49 6 0.364558 Potri.012G127500.1.v4.1 977 754.494 3581 447.128 ==> SRR7169782.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 834 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169782 completed mapping pipeline successfully