Starting /dee2/code/volunteer_pipeline.sh SRR7169783 current disk space = 3049567776768 free memory = 1424166988 SRR7169783 SRAfilesize 3e9fdc60d1c0e8cab51fd306cb88b75c SRR7169783.sra SRR7169783.sra file validated SRR7169783 is paired end SRR7169783 is conventional basespace SRR7169783 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169783_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.85875 18.0 18.0 18.0 18.0 32.0 2 30.135 30.0 29.0 31.0 27.0 33.0 3 31.5345 33.0 31.0 33.0 29.0 33.0 4 32.3305 33.0 33.0 33.0 31.0 33.0 5 33.02025 33.0 33.0 34.0 33.0 34.0 6 37.11375 38.0 37.0 38.0 36.0 38.0 7 37.42 38.0 38.0 38.0 37.0 38.0 8 37.01 38.0 38.0 38.0 36.0 38.0 9 37.47575 38.0 38.0 38.0 37.0 38.0 10-14 37.472950000000004 38.0 38.0 38.0 37.2 38.0 15-19 36.8232 38.0 38.0 38.0 34.6 38.0 20-24 37.5413 38.0 38.0 38.0 37.6 38.0 25-29 37.48615 38.0 38.0 38.0 37.4 38.0 30-34 37.3515 38.0 38.0 38.0 37.0 38.0 35-39 37.3297 38.0 38.0 38.0 36.8 38.0 40-44 37.1668 38.0 38.0 38.0 36.4 38.0 45-49 36.6851 38.0 37.8 38.0 34.4 38.0 50-54 37.33885 38.0 38.0 38.0 37.0 38.0 55-59 37.2784 38.0 38.0 38.0 36.6 38.0 60-64 37.2348 38.0 38.0 38.0 36.0 38.0 65-69 37.2251 38.0 38.0 38.0 36.0 38.0 70-74 37.0837 38.0 38.0 38.0 35.8 38.0 75-79 37.01345 38.0 38.0 38.0 36.0 38.0 80-84 36.9842 38.0 38.0 38.0 35.4 38.0 85-89 36.833999999999996 38.0 38.0 38.0 34.8 38.0 90-94 36.71685 38.0 38.0 38.0 34.6 38.0 95-99 36.5539 38.0 37.8 38.0 34.0 38.0 100-104 36.5288 38.0 38.0 38.0 34.0 38.0 105-109 36.302949999999996 38.0 37.2 38.0 33.6 38.0 110-114 35.801249999999996 38.0 36.8 38.0 31.4 38.0 115-119 35.8433 38.0 37.0 38.0 32.0 38.0 120-124 35.867200000000004 38.0 36.4 38.0 32.2 38.0 125-129 35.621500000000005 38.0 36.0 38.0 31.0 38.0 130-134 34.92615 38.0 35.2 38.0 27.2 38.0 135-139 34.71475 38.0 35.0 38.0 27.4 38.0 140-144 34.6027 38.0 35.0 38.0 27.4 38.0 145-149 33.718050000000005 38.0 34.4 38.0 22.2 38.0 150-151 29.974249999999998 36.0 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 0.0 20 2.0 21 2.0 22 4.0 23 8.0 24 5.0 25 5.0 26 11.0 27 18.0 28 16.0 29 29.0 30 34.0 31 51.0 32 62.0 33 137.0 34 201.0 35 397.0 36 1042.0 37 1967.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.073628850488355 11.044327573253193 11.49511645379414 35.386927122464314 2 21.75 16.925 33.825 27.500000000000004 3 19.779116465863453 21.059236947791167 27.259036144578314 31.90261044176707 4 21.525 30.95 22.875 24.65 5 22.725 33.800000000000004 24.2 19.275000000000002 6 19.225 35.525 25.324999999999996 19.925 7 14.35 26.1 40.699999999999996 18.85 8 17.05 25.974999999999998 30.85 26.125 9 17.224999999999998 23.45 34.449999999999996 24.875 10-14 19.715 30.025000000000002 26.740000000000002 23.52 15-19 19.825 29.185 27.125 23.865 20-24 20.18 29.26 27.495000000000005 23.064999999999998 25-29 20.025000000000002 28.945 27.705000000000002 23.325000000000003 30-34 20.24 28.53 27.855 23.375 35-39 20.225 28.87 27.82 23.085 40-44 20.19 29.24 27.85 22.720000000000002 45-49 19.98 28.65 27.644999999999996 23.724999999999998 50-54 20.45 28.505000000000003 27.584999999999997 23.46 55-59 20.43 28.64 27.334999999999997 23.595 60-64 20.075000000000003 28.599999999999998 27.939999999999998 23.385 65-69 19.81 28.32 28.050000000000004 23.82 70-74 19.93 29.42 27.275 23.375 75-79 20.424999999999997 28.98 27.26 23.335 80-84 20.345 28.410000000000004 27.61 23.635 85-89 20.5 29.104999999999997 27.575 22.82 90-94 19.97 29.005 27.27 23.755000000000003 95-99 21.09 28.74 26.765 23.405 100-104 20.805 29.304999999999996 26.950000000000003 22.939999999999998 105-109 20.844379970986946 29.003051373117906 26.396878595367916 23.755690060527236 110-114 20.275000000000002 29.205 26.93 23.59 115-119 21.19 28.54 26.884999999999998 23.385 120-124 21.265 28.389999999999997 26.69 23.655 125-129 20.76 28.63 26.369999999999997 24.240000000000002 130-134 20.66 28.439999999999998 26.740000000000002 24.16 135-139 21.355 28.055000000000003 26.540000000000003 24.05 140-144 21.185000000000002 28.28 26.005 24.529999999999998 145-149 21.48 27.71 26.13 24.68 150-151 20.925 28.4375 26.2625 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 4.0 27 5.5 28 13.0 29 15.0 30 20.5 31 34.5 32 38.0 33 41.5 34 51.0 35 72.0 36 87.5 37 119.5 38 144.0 39 158.5 40 191.0 41 206.5 42 233.0 43 250.0 44 269.5 45 288.5 46 274.5 47 258.5 48 243.5 49 205.0 50 161.0 51 145.0 52 118.0 53 98.5 54 77.5 55 44.5 56 31.5 57 30.5 58 25.5 59 15.0 60 8.0 61 3.5 62 3.5 63 4.0 64 2.5 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.4 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.045 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.5625 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7749999999999999 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 1.2125 0.0 0.0 0.0 0.0 90-91 1.4375 0.0 0.0 0.0 0.0 92-93 1.6125 0.0 0.0 0.0 0.0 94-95 1.825 0.0 0.0 0.0 0.0 96-97 2.125 0.0 0.0 0.0 0.0 98-99 2.375 0.0 0.0 0.0 0.0 100-101 2.7375 0.0 0.0 0.0 0.0 102-103 3.0999999999999996 0.0 0.0 0.0 0.0 104-105 3.4375 0.0 0.0 0.0 0.0 106-107 3.7375 0.0 0.0 0.0 0.0 108-109 4.35 0.0 0.0 0.0 0.0 110-111 4.9375 0.0 0.0 0.0 0.0 112-113 5.55 0.0 0.0 0.0 0.0 114-115 6.1125 0.0 0.0 0.0 0.0 116-117 6.825 0.0 0.0 0.0 0.0 118-119 7.5625 0.0 0.0 0.0 0.0 120-121 8.375 0.0 0.0 0.0 0.0 122-123 9.075 0.0 0.0 0.0 0.0 124-125 9.6125 0.0 0.0 0.0 0.0 126-127 10.25 0.0 0.0 0.0 0.0 128-129 11.1125 0.0 0.0 0.0 0.0 130-131 12.05 0.0 0.0 0.0 0.0 132-133 12.95 0.0 0.0 0.0 0.0 134-135 13.875 0.0 0.0 0.0 0.0 136-137 14.5625 0.0 0.0 0.0 0.0 138-139 15.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTCAA 10 0.006832588 144.9875 5 >>END_MODULE SRR7169783 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169783_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10325 33.0 33.0 34.0 33.0 34.0 2 33.2105 34.0 33.0 34.0 33.0 34.0 3 33.22 34.0 33.0 34.0 33.0 34.0 4 33.22225 34.0 33.0 34.0 33.0 34.0 5 33.1755 34.0 33.0 34.0 33.0 34.0 6 37.42675 38.0 38.0 38.0 38.0 38.0 7 37.465 38.0 38.0 38.0 38.0 38.0 8 37.42425 38.0 38.0 38.0 38.0 38.0 9 37.40375 38.0 38.0 38.0 38.0 38.0 10-14 37.0589 38.0 38.0 38.0 36.4 38.0 15-19 37.335750000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.23665 38.0 38.0 38.0 37.2 38.0 25-29 37.2952 38.0 38.0 38.0 37.2 38.0 30-34 36.933550000000004 38.0 38.0 38.0 36.0 38.0 35-39 37.17615 38.0 38.0 38.0 37.0 38.0 40-44 36.70245 38.0 37.8 38.0 34.2 38.0 45-49 37.24565 38.0 38.0 38.0 37.0 38.0 50-54 36.7798 38.0 37.6 38.0 34.6 38.0 55-59 36.85615 38.0 38.0 38.0 35.6 38.0 60-64 37.053050000000006 38.0 38.0 38.0 36.6 38.0 65-69 36.845800000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.827 38.0 38.0 38.0 35.8 38.0 75-79 36.744150000000005 38.0 38.0 38.0 35.6 38.0 80-84 36.6193 38.0 38.0 38.0 35.2 38.0 85-89 36.82775 38.0 38.0 38.0 36.0 38.0 90-94 36.4516 38.0 37.8 38.0 34.2 38.0 95-99 36.733549999999994 38.0 38.0 38.0 35.6 38.0 100-104 36.4116 38.0 38.0 38.0 34.4 38.0 105-109 35.3174 38.0 37.4 38.0 30.4 38.0 110-114 34.737350000000006 38.0 37.0 38.0 27.2 38.0 115-119 34.3548 38.0 36.6 38.0 25.4 38.0 120-124 33.78505 38.0 35.2 38.0 19.8 38.0 125-129 34.58905 38.0 35.8 38.0 26.0 38.0 130-134 34.67255 38.0 35.2 38.0 26.6 38.0 135-139 34.87859999999999 38.0 35.6 38.0 28.2 38.0 140-144 34.80045 38.0 35.4 38.0 29.4 38.0 145-149 34.14885 38.0 33.8 38.0 26.6 38.0 150-151 29.879375 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 3.0 6 0.0 7 0.0 8 4.0 9 1.0 10 1.0 11 3.0 12 4.0 13 3.0 14 1.0 15 2.0 16 4.0 17 1.0 18 3.0 19 4.0 20 4.0 21 3.0 22 5.0 23 7.0 24 10.0 25 9.0 26 17.0 27 11.0 28 27.0 29 28.0 30 47.0 31 91.0 32 100.0 33 131.0 34 171.0 35 288.0 36 653.0 37 2354.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.825 19.7 12.8 27.675 2 26.1 25.650000000000002 32.15 16.1 3 22.025 28.599999999999998 30.25 19.125 4 23.724999999999998 34.8 22.425 19.05 5 24.7 36.025 22.325 16.950000000000003 6 20.95 37.65 22.6 18.8 7 19.6 20.9 40.125 19.375 8 22.925 24.275 27.125 25.674999999999997 9 21.675 24.4 29.775000000000002 24.15 10-14 23.89 28.48 26.11 21.52 15-19 23.185 27.615000000000002 28.244999999999997 20.955 20-24 22.79 28.084999999999997 27.689999999999998 21.435000000000002 25-29 23.325000000000003 28.144999999999996 27.525 21.005 30-34 22.68 27.875 28.065 21.38 35-39 23.07 27.11 28.444999999999997 21.375 40-44 23.125 28.294999999999998 27.92 20.66 45-49 22.79 27.58 28.155 21.475 50-54 23.355 27.694999999999997 27.965 20.985 55-59 23.41 27.334999999999997 28.305000000000003 20.95 60-64 22.835 27.83 28.73 20.605 65-69 23.474999999999998 27.975 28.625 19.925 70-74 23.392839233777956 27.133687694313508 28.407381406077626 21.06609166583091 75-79 23.581835477895158 27.472087317879136 28.57357432533921 20.372502878886497 80-84 23.372011603481045 27.853356006802038 28.32349704911473 20.451135340602182 85-89 23.28 28.02 28.255000000000003 20.445 90-94 23.95 27.839999999999996 28.035 20.175 95-99 23.59 27.865000000000002 28.255000000000003 20.29 100-104 23.661563094165917 28.189732812969076 27.549284499149408 20.599419593715602 105-109 23.711340206185564 28.575074002245586 27.57987138920078 20.13371440236807 110-114 24.293785310734464 27.906494583527703 27.310423469652207 20.489296636085626 115-119 25.25539757767246 28.062137967351237 27.309110057925224 19.37335439705108 120-124 24.72501694208414 28.056091330865872 27.180315904707292 20.0385758223427 125-129 25.457511342203194 28.444716317479735 26.680940001019525 19.41683233929755 130-134 26.017521902377972 27.32916145181477 27.429286608260327 19.22403003754693 135-139 26.229999999999997 27.744999999999997 26.784999999999997 19.24 140-144 26.474999999999998 27.944999999999997 26.555 19.025 145-149 26.705000000000002 28.084999999999997 26.534999999999997 18.675 150-151 27.187499999999996 27.450000000000003 27.35 18.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 1.0 26 3.0 27 3.0 28 6.0 29 9.5 30 10.0 31 21.0 32 25.5 33 26.5 34 45.5 35 70.5 36 79.0 37 89.5 38 125.0 39 165.5 40 186.0 41 218.0 42 258.0 43 290.5 44 286.5 45 270.0 46 289.0 47 278.5 48 250.0 49 209.0 50 165.5 51 154.0 52 127.0 53 92.5 54 67.5 55 43.5 56 36.5 57 30.0 58 20.0 59 13.0 60 7.5 61 4.5 62 6.0 63 5.0 64 2.5 65 2.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.29 75-79 0.135 80-84 0.03 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06999999999999999 105-109 2.03 110-114 3.535 115-119 5.050000000000001 120-124 4.085 125-129 1.915 130-134 0.125 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.44999999999999996 0.0 0.0 0.0 0.0 80-81 0.5375000000000001 0.0 0.0 0.0 0.0 82-83 0.5875 0.0 0.0 0.0 0.0 84-85 0.7250000000000001 0.0 0.0 0.0 0.0 86-87 0.8875 0.0 0.0 0.0 0.0 88-89 1.1625 0.0 0.0 0.0 0.0 90-91 1.3875000000000002 0.0 0.0 0.0 0.0 92-93 1.55 0.0 0.0 0.0 0.0 94-95 1.75 0.0 0.0 0.0 0.0 96-97 2.05 0.0 0.0 0.0 0.0 98-99 2.2874999999999996 0.0 0.0 0.0 0.0 100-101 2.6375 0.0 0.0 0.0 0.0 102-103 3.0 0.0 0.0 0.0 0.0 104-105 3.3375 0.0 0.0 0.0 0.0 106-107 3.575 0.0 0.0 0.0 0.0 108-109 4.1875 0.0 0.0 0.0 0.0 110-111 4.762499999999999 0.0 0.0 0.0 0.0 112-113 5.35 0.0 0.0 0.0 0.0 114-115 5.8875 0.0 0.0 0.0 0.0 116-117 6.5625 0.0 0.0 0.0 0.0 118-119 7.3 0.0 0.0 0.0 0.0 120-121 7.9375 0.0 0.0 0.0 0.0 122-123 8.537500000000001 0.0 0.0 0.0 0.0 124-125 9.05 0.0 0.0 0.0 0.0 126-127 9.662500000000001 0.0 0.0 0.0 0.0 128-129 10.5125 0.0 0.0 0.0 0.0 130-131 11.425 0.0 0.0 0.0 0.0 132-133 12.287500000000001 0.0 0.0 0.0 0.0 134-135 13.149999999999999 0.0 0.0 0.0 0.0 136-137 13.85 0.0 0.0 0.0 0.0 138-139 14.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACTC 10 0.007066775 143.3625 2 >>END_MODULE Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra Read 740571 spots for SRR7169783.sra Written 740571 spots for SRR7169783.sra SRR ids: ['SRR7169783.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g79aopd_ SRR7169783.sra spots: 14811420 blocks: [[1, 740571], [740572, 1481142], [1481143, 2221713], [2221714, 2962284], [2962285, 3702855], [3702856, 4443426], [4443427, 5183997], [5183998, 5924568], [5924569, 6665139], [6665140, 7405710], [7405711, 8146281], [8146282, 8886852], [8886853, 9627423], [9627424, 10367994], [10367995, 11108565], [11108566, 11849136], [11849137, 12589707], [12589708, 13330278], [13330279, 14070849], [14070850, 14811420]] SRR7169783 file size 4997403 SRR7169783 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169783 SRR7169783_1.fastq SRR7169783_2.fastq Input file: SRR7169783_1.fastq Paired file: SRR7169783_2.fastq trimmed: SRR7169783-trimmed-pair1.fastq, SRR7169783-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:30:24 2025 >> started Tue Feb 11 15:30:40 2025 >> done (16.535s) 14811420 read pairs processed; of these: 11024 ( 0.07%) short read pairs filtered out after trimming by size control 13702 ( 0.09%) empty read pairs filtered out after trimming by size control 14786694 (99.83%) read pairs available; of these: 7765831 (52.52%) trimmed read pairs available after processing 7020863 (47.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 5 0.00% 21 4 0.00% 22 1 0.00% 23 4 0.00% 24 3 0.00% 25 1 0.00% 26 3 0.00% 27 1 0.00% 28 8 0.00% 29 5 0.00% 30 14 0.00% 31 12 0.00% 32 5 0.00% 33 12 0.00% 34 15 0.00% 35 12 0.00% 36 21 0.00% 37 25 0.00% 38 40 0.00% 39 34 0.00% 40 60 0.00% 41 55 0.00% 42 71 0.00% 43 81 0.00% 44 104 0.00% 45 97 0.00% 46 117 0.00% 47 141 0.00% 48 153 0.00% 49 164 0.00% 50 196 0.00% 51 230 0.00% 52 301 0.00% 53 328 0.00% 54 368 0.00% 55 379 0.00% 56 399 0.00% 57 465 0.00% 58 586 0.00% 59 633 0.00% 60 768 0.01% 61 885 0.01% 62 999 0.01% 63 1234 0.01% 64 1264 0.01% 65 1368 0.01% 66 1473 0.01% 67 1690 0.01% 68 1902 0.01% 69 2239 0.02% 70 2607 0.02% 71 2980 0.02% 72 3415 0.02% 73 3905 0.03% 74 4423 0.03% 75 4798 0.03% 76 5388 0.04% 77 5758 0.04% 78 6270 0.04% 79 6942 0.05% 80 7729 0.05% 81 8731 0.06% 82 9927 0.07% 83 11252 0.08% 84 12687 0.09% 85 13888 0.09% 86 14534 0.10% 87 15418 0.10% 88 16514 0.11% 89 17403 0.12% 90 18740 0.13% 91 20000 0.14% 92 21666 0.15% 93 23107 0.16% 94 24605 0.17% 95 26230 0.18% 96 27197 0.18% 97 27962 0.19% 98 28964 0.20% 99 30085 0.20% 100 31208 0.21% 101 32321 0.22% 102 34362 0.23% 103 36094 0.24% 104 38130 0.26% 105 39462 0.27% 106 40552 0.27% 107 41059 0.28% 108 41415 0.28% 109 42649 0.29% 110 43262 0.29% 111 44700 0.30% 112 46154 0.31% 113 48247 0.33% 114 49787 0.34% 115 50956 0.34% 116 52316 0.35% 117 53136 0.36% 118 53046 0.36% 119 53230 0.36% 120 54577 0.37% 121 55786 0.38% 122 57328 0.39% 123 59079 0.40% 124 60983 0.41% 125 62541 0.42% 126 64313 0.43% 127 64717 0.44% 128 65815 0.45% 129 65867 0.45% 130 67037 0.45% 131 68038 0.46% 132 69905 0.47% 133 71762 0.49% 134 73755 0.50% 135 75918 0.51% 136 77983 0.53% 137 80525 0.54% 138 83369 0.56% 139 86365 0.58% 140 89411 0.60% 141 94421 0.64% 142 101358 0.69% 143 110277 0.75% 144 123649 0.84% 145 143705 0.97% 146 174722 1.18% 147 228846 1.55% 148 325491 2.20% 149 629979 4.26% 150 3064113 20.72% 151 7020863 47.48% 14786694 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=109.71 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=11.5 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=38 prefix-density=0.21 prefix-fanout=2.2 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=7 fanout-score=40.23 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=11.7 sequence=TGTTGGTGGTGGTACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAACATGTTGGTGGGGACATGTTTGTTAGTGTGCCCAAAGCAGATGCCGTTTTCATGAAGTGGATATGCCATGATTGGAGCGACGCACACTGCTTAAAATTCTTGAAGAATTGCTATGACGCGTTGCCGGAAAACGGCAAGGTGATACTTGTTGAGTGCATTCTTCCCGTGGCTCCTGACACAAGCCTTGCCACCAA SRR7169783 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:31:21 Started mapping on | Feb 11 15:31:21 Finished on | Feb 11 15:32:35 Mapping speed, Million of reads per hour | 719.35 Number of input reads | 14786694 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14165729 Uniquely mapped reads % | 95.80% Average mapped length | 287.31 Number of splices: Total | 12728359 Number of splices: Annotated (sjdb) | 12508468 Number of splices: GT/AG | 12544047 Number of splices: GC/AG | 145177 Number of splices: AT/AC | 10036 Number of splices: Non-canonical | 29099 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 243741 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 29144 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.32% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 387564 387564 387564 N_multimapping 243741 243741 243741 N_noFeature 373948 13983636 460021 N_ambiguous 149619 801 53009 UnstrandedReadsAssigned:13642162 PositiveStrandReadsAssigned:181292 NegativeStrandReadsAssigned:13652699 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7169783 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169783-trimmed-pair1.fastq SRR7169783-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,786,694 reads, 13,560,877 reads pseudoaligned [quant] estimated average fragment length: 203.441 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR7169783.ke.tsv 34699 SRR7169783.se.tsv 87100 total ==> SRR7169783.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1815.56 280 12.3781 Potri.005G024800.1.v4.1 1035 832.559 26 2.50649 Potri.004G059700.1.v4.1 961 758.559 3 0.317424 Potri.007G009000.2.v4.1 1416 1213.56 0 0 Potri.003G141000.2.v4.1 2943 2740.56 254.066 7.44071 Potri.016G087400.1.v4.1 270 97.5293 998.911 822.053 Potri.015G069301.1.v4.1 564 363.091 0 0 Potri.010G195200.1.v4.1 1773 1570.56 26 1.3287 Potri.012G127500.1.v4.1 977 774.559 4254 440.81 ==> SRR7169783.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1353 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 206 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169783 completed mapping pipeline successfully