Starting /dee2/code/volunteer_pipeline.sh SRR7169784 current disk space = 3049382731776 free memory = 1022333616 SRR7169784 SRAfilesize c1d675fb311ecd2675bc37041b9468f5 SRR7169784.sra SRR7169784.sra file validated SRR7169784 is paired end SRR7169784 is conventional basespace SRR7169784 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169784_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.728 32.0 25.0 33.0 18.0 33.0 2 27.61875 29.0 25.0 31.0 18.0 33.0 3 30.6685 31.0 29.0 33.0 27.0 33.0 4 32.5305 33.0 33.0 33.0 32.0 33.0 5 32.79675 33.0 33.0 33.0 32.0 34.0 6 36.56125 38.0 37.0 38.0 34.0 38.0 7 36.93775 38.0 38.0 38.0 35.0 38.0 8 37.37475 38.0 38.0 38.0 37.0 38.0 9 37.52475 38.0 38.0 38.0 37.0 38.0 10-14 37.565749999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.61794999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.620450000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.6123 38.0 38.0 38.0 38.0 38.0 30-34 37.6127 38.0 38.0 38.0 38.0 38.0 35-39 37.58665 38.0 38.0 38.0 38.0 38.0 40-44 37.530350000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.49485 38.0 38.0 38.0 37.6 38.0 50-54 37.43325 38.0 38.0 38.0 37.6 38.0 55-59 37.24055 38.0 38.0 38.0 36.8 38.0 60-64 37.079950000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.289649999999995 38.0 38.0 38.0 36.8 38.0 70-74 37.27715 38.0 38.0 38.0 37.0 38.0 75-79 37.13145 38.0 38.0 38.0 36.2 38.0 80-84 37.186699999999995 38.0 38.0 38.0 36.4 38.0 85-89 37.112350000000006 38.0 38.0 38.0 36.0 38.0 90-94 36.9423 38.0 38.0 38.0 35.8 38.0 95-99 37.0781 38.0 38.0 38.0 36.0 38.0 100-104 37.02305 38.0 38.0 38.0 36.0 38.0 105-109 36.89185 38.0 38.0 38.0 35.4 38.0 110-114 36.74605 38.0 38.0 38.0 34.8 38.0 115-119 36.558350000000004 38.0 38.0 38.0 34.4 38.0 120-124 36.512649999999994 38.0 38.0 38.0 34.4 38.0 125-129 36.326299999999996 38.0 38.0 38.0 34.0 38.0 130-134 36.081050000000005 38.0 37.2 38.0 33.2 38.0 135-139 35.8917 38.0 36.8 38.0 32.6 38.0 140-144 35.71249999999999 38.0 36.0 38.0 33.0 38.0 145-149 35.33025 38.0 36.0 38.0 31.6 38.0 150-151 31.20975 36.5 29.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 3.0 15 1.0 16 0.0 17 1.0 18 0.0 19 2.0 20 1.0 21 2.0 22 2.0 23 5.0 24 5.0 25 10.0 26 6.0 27 9.0 28 11.0 29 21.0 30 29.0 31 34.0 32 61.0 33 72.0 34 114.0 35 233.0 36 636.0 37 2740.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.6 10.85 10.125 41.425 2 21.296296296296298 16.216216216216218 33.95895895895896 28.52852852852853 3 20.625 20.625 25.474999999999998 33.275 4 22.025 30.025000000000002 22.325 25.624999999999996 5 21.725 33.1 24.025 21.15 6 19.375 36.3 24.775 19.55 7 14.224999999999998 25.525 41.55 18.7 8 18.675 25.6 30.425 25.3 9 17.45 23.525 34.625 24.4 10-14 19.89 30.12 26.745 23.244999999999997 15-19 19.775000000000002 28.64 28.050000000000004 23.535 20-24 19.885 28.54 27.725 23.849999999999998 25-29 19.384999999999998 28.705000000000002 27.860000000000003 24.05 30-34 19.56 29.555 27.395000000000003 23.49 35-39 20.405 28.515 27.685 23.395 40-44 20.565 28.895 27.075 23.465 45-49 20.044999999999998 28.410000000000004 27.73 23.815 50-54 19.585 29.14 27.425 23.849999999999998 55-59 20.325 28.38 27.589999999999996 23.705000000000002 60-64 20.27 29.354999999999997 26.56 23.815 65-69 20.59 28.910000000000004 27.515 22.985 70-74 20.560000000000002 28.389999999999997 27.77 23.28 75-79 20.705000000000002 28.455000000000002 27.63 23.21 80-84 20.255000000000003 28.53 27.68 23.535 85-89 20.495 29.14 27.01 23.355 90-94 20.345 29.09 27.195000000000004 23.369999999999997 95-99 20.830000000000002 28.275 27.33 23.565 100-104 20.985 28.58 27.215 23.22 105-109 20.974999999999998 28.58 27.105 23.34 110-114 19.868908235765034 28.89522665866106 27.103972780946663 24.131892324627238 115-119 21.115000000000002 28.035 27.16 23.69 120-124 20.75 28.845 26.505000000000003 23.9 125-129 21.005 28.265 26.505000000000003 24.224999999999998 130-134 21.165 28.384999999999998 26.545 23.905 135-139 21.625 28.615000000000002 26.174999999999997 23.585 140-144 20.73 28.689999999999998 26.13 24.45 145-149 20.815 28.360000000000003 26.38 24.445 150-151 20.724999999999998 28.812500000000004 26.1125 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.5 24 3.0 25 3.5 26 3.0 27 6.5 28 11.5 29 16.0 30 20.5 31 18.5 32 30.5 33 50.0 34 58.5 35 78.5 36 87.5 37 99.0 38 123.0 39 143.0 40 178.0 41 214.5 42 254.0 43 274.0 44 273.0 45 262.5 46 273.5 47 281.5 48 238.0 49 196.5 50 167.0 51 133.0 52 112.5 53 98.5 54 68.0 55 50.0 56 40.5 57 33.0 58 28.0 59 18.5 60 14.5 61 8.5 62 4.0 63 6.0 64 4.5 65 2.5 66 3.5 67 1.5 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.06999999999999999 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.5125000000000002 0.0 0.0 0.0 0.0 102-103 1.8624999999999998 0.0 0.0 0.0 0.0 104-105 2.0999999999999996 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.6500000000000004 0.0 0.0 0.0 0.0 110-111 3.05 0.0 0.0 0.0 0.0 112-113 3.375 0.0 0.0 0.0 0.0 114-115 3.7625 0.0 0.0 0.0 0.0 116-117 4.2125 0.0 0.0 0.0 0.0 118-119 4.637499999999999 0.0 0.0 0.0 0.0 120-121 5.0375 0.0 0.0 0.0 0.0 122-123 5.512499999999999 0.0 0.0 0.0 0.0 124-125 5.9875 0.0 0.0 0.0 0.0 126-127 6.6875 0.0 0.0 0.0 0.0 128-129 7.35 0.0 0.0 0.0 0.0 130-131 8.1125 0.0 0.0 0.0 0.0 132-133 8.6125 0.0 0.0 0.0 0.0 134-135 9.075 0.0 0.0 0.0 0.0 136-137 9.8125 0.0 0.0 0.0 0.0 138-139 10.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 35 0.0035366106 20.714287 20-24 >>END_MODULE SRR7169784 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169784_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1205 34.0 33.0 34.0 33.0 34.0 2 33.1915 34.0 33.0 34.0 33.0 34.0 3 33.21175 34.0 33.0 34.0 33.0 34.0 4 33.19075 34.0 33.0 34.0 33.0 34.0 5 33.2165 34.0 33.0 34.0 33.0 34.0 6 37.373 38.0 38.0 38.0 38.0 38.0 7 37.446 38.0 38.0 38.0 38.0 38.0 8 37.452 38.0 38.0 38.0 38.0 38.0 9 37.519 38.0 38.0 38.0 38.0 38.0 10-14 37.426249999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.29385 38.0 38.0 38.0 37.4 38.0 20-24 37.37435000000001 38.0 38.0 38.0 37.6 38.0 25-29 37.30460000000001 38.0 38.0 38.0 37.6 38.0 30-34 37.23420000000001 38.0 38.0 38.0 37.4 38.0 35-39 37.29025 38.0 38.0 38.0 37.2 38.0 40-44 37.312599999999996 38.0 38.0 38.0 37.4 38.0 45-49 37.27165 38.0 38.0 38.0 37.0 38.0 50-54 37.192249999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.00235000000001 38.0 38.0 38.0 36.6 38.0 60-64 36.83655 38.0 38.0 38.0 36.0 38.0 65-69 37.177600000000005 38.0 38.0 38.0 36.8 38.0 70-74 37.1118 38.0 38.0 38.0 36.8 38.0 75-79 35.87335 38.0 38.0 38.0 34.2 38.0 80-84 36.683949999999996 38.0 38.0 38.0 35.2 38.0 85-89 36.71315 38.0 37.8 38.0 35.0 38.0 90-94 36.80215 38.0 38.0 38.0 35.6 38.0 95-99 36.902049999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.68729999999999 38.0 38.0 38.0 35.4 38.0 105-109 35.07155 38.0 37.0 38.0 28.0 38.0 110-114 34.38415 38.0 37.4 38.0 25.8 38.0 115-119 33.4397 38.0 36.8 38.0 11.8 38.0 120-124 33.72815 38.0 37.0 38.0 18.0 38.0 125-129 34.30915 38.0 36.2 38.0 23.8 38.0 130-134 35.106550000000006 38.0 35.8 38.0 28.4 38.0 135-139 34.78715 38.0 35.8 38.0 27.2 38.0 140-144 35.0441 38.0 35.8 38.0 29.4 38.0 145-149 33.7801 38.0 34.2 38.0 24.2 38.0 150-151 30.6545 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 1.0 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 2.0 11 2.0 12 0.0 13 1.0 14 1.0 15 2.0 16 0.0 17 3.0 18 3.0 19 7.0 20 8.0 21 2.0 22 11.0 23 13.0 24 18.0 25 17.0 26 16.0 27 17.0 28 36.0 29 48.0 30 69.0 31 92.0 32 84.0 33 107.0 34 124.0 35 236.0 36 527.0 37 2543.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.15 19.625 16.325 26.900000000000002 2 26.726726726726728 25.875875875875877 29.87987987987988 17.51751751751752 3 20.655983975963945 28.492739108662995 31.797696544817228 19.053580370555835 4 24.480080180405913 33.07441743923828 23.903783512904035 18.541718867451767 5 24.724724724724727 36.23623623623624 22.597597597597595 16.441441441441444 6 19.875 38.125 23.775 18.224999999999998 7 19.35 21.125 38.75 20.775 8 21.975 24.9 27.375 25.75 9 22.425 25.724999999999998 28.449999999999996 23.400000000000002 10-14 23.189999999999998 28.64 26.395000000000003 21.775 15-19 23.179271708683473 27.89115646258503 27.66106442577031 21.268507402961184 20-24 23.095 28.244999999999997 27.665 20.995 25-29 23.425 27.994999999999997 27.639999999999997 20.94 30-34 22.47724772477248 28.682868286828683 27.47274727472747 21.367136713671368 35-39 22.975 27.634999999999998 28.095 21.295 40-44 22.994999999999997 27.76 27.805000000000003 21.44 45-49 23.81952781112445 27.62104841936775 27.941176470588236 20.618247298919567 50-54 23.68342010412495 28.243892671205444 27.513015618742493 20.559671605927115 55-59 23.555600020009003 27.647441348606872 27.927567405332397 20.86939122605172 60-64 23.524704940988197 27.225445089017803 28.190638127625522 21.059211842368477 65-69 23.565 27.42 28.16 20.855 70-74 23.27620765684506 27.480457005411907 28.061735818801363 21.18159951894167 75-79 23.143048334791786 27.744891130900296 28.31111339887785 20.80094713543007 80-84 22.715391575349354 27.907911933246204 28.460842465064847 20.915854026339602 85-89 23.849999999999998 27.27 28.405 20.474999999999998 90-94 24.159831966393277 27.730546109221844 27.855571114222844 20.254050810162035 95-99 23.974384630778466 28.086852111266758 27.761656994196514 20.177106263758255 100-104 24.035623155050782 27.462850853054487 28.023215089808375 20.478310902086356 105-109 24.184894758563765 27.275072224515064 28.31200990507635 20.22802311184482 110-114 24.53191489361702 27.930851063829788 27.372340425531917 20.164893617021278 115-119 25.023245638024395 27.916643876825464 27.243887764590056 19.816222720560084 120-124 24.484536082474225 28.318298969072163 27.70081615120275 19.49634879725086 125-129 24.91489027392238 28.135966060860003 27.256062431257526 19.69308123396009 130-134 25.945593908120834 27.638895846901455 27.087821251440307 19.327688993537397 135-139 25.605 27.755000000000003 26.915 19.725 140-144 25.314999999999998 27.689999999999998 27.165 19.830000000000002 145-149 26.46132306615331 28.086404320216012 26.56632831641582 18.88594429721486 150-151 26.266700277287626 28.28333753466095 26.417948071590626 19.0320141164608 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 1.5 24 1.5 25 2.0 26 1.5 27 3.5 28 6.5 29 10.0 30 15.5 31 19.0 32 21.0 33 26.5 34 42.5 35 66.0 36 86.0 37 107.5 38 133.0 39 154.0 40 181.5 41 217.5 42 259.5 43 283.5 44 291.0 45 298.0 46 267.0 47 248.0 48 253.0 49 212.5 50 166.5 51 143.0 52 118.5 53 98.0 54 76.5 55 52.5 56 39.0 57 28.5 58 17.5 59 11.5 60 9.5 61 7.0 62 4.5 63 4.0 64 2.0 65 2.0 66 2.0 67 0.0 68 2.0 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.1 3 0.15 4 0.22499999999999998 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.04 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.04 50-54 0.12 55-59 0.045 60-64 0.02 65-69 0.0 70-74 0.22 75-79 2.8649999999999998 80-84 0.53 85-89 0.0 90-94 0.02 95-99 0.06 100-104 0.065 105-109 3.08 110-114 6.0 115-119 8.584999999999999 120-124 6.88 125-129 4.535 130-134 0.19499999999999998 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.8250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.5032712632108707 1.0 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.025163563160543533 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACTGCACGCAAAGAGCAGAGAGAGAGAGAGAGTATCAAAACTAGCCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.7875000000000001 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2000000000000002 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 2.0250000000000004 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.5250000000000004 0.0 0.0 0.0 0.0 110-111 2.9000000000000004 0.0 0.0 0.0 0.0 112-113 3.2125000000000004 0.0 0.0 0.0 0.0 114-115 3.5625 0.0 0.0 0.0 0.0 116-117 3.975 0.0 0.0 0.0 0.0 118-119 4.375 0.0 0.0 0.0 0.0 120-121 4.7375 0.0 0.0 0.0 0.0 122-123 5.125 0.0 0.0 0.0 0.0 124-125 5.55 0.0 0.0 0.0 0.0 126-127 6.2125 0.0 0.0 0.0 0.0 128-129 6.7875 0.0 0.0 0.0 0.0 130-131 7.550000000000001 0.0 0.0 0.0 0.0 132-133 8.0625 0.0 0.0 0.0 0.0 134-135 8.537500000000001 0.0 0.0 0.0 0.0 136-137 9.225 0.0 0.0 0.0 0.0 138-139 9.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 30 0.0015702426 23.820835 130-134 CGTCGTG 40 0.0083184745 17.865625 140-144 >>END_MODULE Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739658 spots for SRR7169784.sra Written 739658 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra Read 739639 spots for SRR7169784.sra Written 739639 spots for SRR7169784.sra SRR ids: ['SRR7169784.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vxwbpb9c SRR7169784.sra spots: 14792799 blocks: [[1, 739639], [739640, 1479278], [1479279, 2218917], [2218918, 2958556], [2958557, 3698195], [3698196, 4437834], [4437835, 5177473], [5177474, 5917112], [5917113, 6656751], [6656752, 7396390], [7396391, 8136029], [8136030, 8875668], [8875669, 9615307], [9615308, 10354946], [10354947, 11094585], [11094586, 11834224], [11834225, 12573863], [12573864, 13313502], [13313503, 14053141], [14053142, 14792799]] SRR7169784 file size 4991093 SRR7169784 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169784 SRR7169784_1.fastq SRR7169784_2.fastq Input file: SRR7169784_1.fastq Paired file: SRR7169784_2.fastq trimmed: SRR7169784-trimmed-pair1.fastq, SRR7169784-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:02:47 2025 >> started Tue Feb 11 16:03:02 2025 >> done (15.167s) 14792799 read pairs processed; of these: 9789 ( 0.07%) short read pairs filtered out after trimming by size control 12142 ( 0.08%) empty read pairs filtered out after trimming by size control 14770868 (99.85%) read pairs available; of these: 6656906 (45.07%) trimmed read pairs available after processing 8113962 (54.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 6 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 7 0.00% 27 3 0.00% 28 2 0.00% 29 4 0.00% 30 3 0.00% 31 11 0.00% 32 7 0.00% 33 6 0.00% 34 12 0.00% 35 11 0.00% 36 8 0.00% 37 11 0.00% 38 11 0.00% 39 21 0.00% 40 26 0.00% 41 26 0.00% 42 33 0.00% 43 42 0.00% 44 33 0.00% 45 45 0.00% 46 41 0.00% 47 49 0.00% 48 83 0.00% 49 75 0.00% 50 90 0.00% 51 119 0.00% 52 117 0.00% 53 125 0.00% 54 165 0.00% 55 159 0.00% 56 195 0.00% 57 211 0.00% 58 221 0.00% 59 257 0.00% 60 306 0.00% 61 365 0.00% 62 454 0.00% 63 472 0.00% 64 555 0.00% 65 573 0.00% 66 666 0.00% 67 734 0.00% 68 805 0.01% 69 950 0.01% 70 1110 0.01% 71 1241 0.01% 72 1528 0.01% 73 1711 0.01% 74 1936 0.01% 75 2073 0.01% 76 2350 0.02% 77 2493 0.02% 78 2836 0.02% 79 2992 0.02% 80 3466 0.02% 81 4020 0.03% 82 4517 0.03% 83 5266 0.04% 84 6314 0.04% 85 7277 0.05% 86 7560 0.05% 87 7949 0.05% 88 8945 0.06% 89 9307 0.06% 90 9808 0.07% 91 10880 0.07% 92 11967 0.08% 93 13176 0.09% 94 14078 0.10% 95 15047 0.10% 96 15989 0.11% 97 16515 0.11% 98 17175 0.12% 99 18127 0.12% 100 19115 0.13% 101 20096 0.14% 102 21646 0.15% 103 22862 0.15% 104 24291 0.16% 105 25687 0.17% 106 26302 0.18% 107 27003 0.18% 108 27934 0.19% 109 28810 0.20% 110 29658 0.20% 111 30879 0.21% 112 32263 0.22% 113 33761 0.23% 114 35296 0.24% 115 36795 0.25% 116 37823 0.26% 117 38860 0.26% 118 39367 0.27% 119 39839 0.27% 120 40518 0.27% 121 41564 0.28% 122 42362 0.29% 123 44615 0.30% 124 46336 0.31% 125 47986 0.32% 126 49442 0.33% 127 51517 0.35% 128 51349 0.35% 129 52745 0.36% 130 53227 0.36% 131 54065 0.37% 132 55488 0.38% 133 57665 0.39% 134 59374 0.40% 135 61540 0.42% 136 64552 0.44% 137 66884 0.45% 138 68837 0.47% 139 71133 0.48% 140 74917 0.51% 141 78571 0.53% 142 83099 0.56% 143 90304 0.61% 144 101005 0.68% 145 115639 0.78% 146 136834 0.93% 147 175447 1.19% 148 260620 1.76% 149 569247 3.85% 150 3055945 20.69% 151 8113962 54.93% 14770868 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=37 prefix-density=0.22 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=294.94 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=19.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=41 prefix-density=0.20 prefix-fanout=2.1 sequence=ATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=58.78 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.7 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169784 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:03:47 Started mapping on | Feb 11 16:03:47 Finished on | Feb 11 16:04:57 Mapping speed, Million of reads per hour | 759.64 Number of input reads | 14770868 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14236900 Uniquely mapped reads % | 96.38% Average mapped length | 291.74 Number of splices: Total | 12919658 Number of splices: Annotated (sjdb) | 12694709 Number of splices: GT/AG | 12740112 Number of splices: GC/AG | 142658 Number of splices: AT/AC | 10280 Number of splices: Non-canonical | 26608 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245655 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 16902 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.81% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 298168 298168 298168 N_multimapping 245655 245655 245655 N_noFeature 376997 14057949 451984 N_ambiguous 159310 882 54689 UnstrandedReadsAssigned:13700593 PositiveStrandReadsAssigned:178069 NegativeStrandReadsAssigned:13730227 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169784 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169784-trimmed-pair1.fastq SRR7169784-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,770,868 reads, 13,622,640 reads pseudoaligned [quant] estimated average fragment length: 218.741 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR7169784.ke.tsv 34699 SRR7169784.se.tsv 87100 total ==> SRR7169784.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.26 335 15.1607 Potri.005G024800.1.v4.1 1035 817.259 7 0.697827 Potri.004G059700.1.v4.1 961 743.276 2 0.219225 Potri.007G009000.2.v4.1 1416 1198.26 0 0 Potri.003G141000.2.v4.1 2943 2725.26 274.035 8.19234 Potri.016G087400.1.v4.1 270 89.8299 1022 926.914 Potri.015G069301.1.v4.1 564 348.858 0 0 Potri.010G195200.1.v4.1 1773 1555.26 7 0.366695 Potri.012G127500.1.v4.1 977 759.276 2476 265.681 ==> SRR7169784.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1344 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7169784 completed mapping pipeline successfully