Starting /dee2/code/volunteer_pipeline.sh SRR7169785 current disk space = 3048405209088 free memory = 1504584704 SRR7169785 SRAfilesize 187a535f47e96abb85ff9e09ac98d9cf SRR7169785.sra SRR7169785.sra file validated SRR7169785 is paired end SRR7169785 is conventional basespace SRR7169785 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169785_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.36275 32.0 30.0 33.0 25.0 33.0 2 28.5055 31.0 27.0 33.0 18.0 33.0 3 30.6685 31.0 29.0 33.0 27.0 33.0 4 31.98875 33.0 33.0 33.0 29.0 33.0 5 32.58 33.0 33.0 33.0 32.0 34.0 6 36.47275 38.0 37.0 38.0 34.0 38.0 7 36.808 38.0 37.0 38.0 35.0 38.0 8 37.15675 38.0 38.0 38.0 36.0 38.0 9 37.36175 38.0 38.0 38.0 37.0 38.0 10-14 37.456900000000005 38.0 38.0 38.0 37.6 38.0 15-19 37.47175 38.0 38.0 38.0 37.6 38.0 20-24 37.459050000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.5268 38.0 38.0 38.0 38.0 38.0 30-34 37.463800000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.429449999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.428399999999996 38.0 38.0 38.0 37.6 38.0 45-49 37.29285 38.0 38.0 38.0 36.8 38.0 50-54 37.30205000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.2515 38.0 38.0 38.0 37.0 38.0 60-64 36.79710000000001 38.0 38.0 38.0 35.2 38.0 65-69 37.1009 38.0 38.0 38.0 36.2 38.0 70-74 37.15385 38.0 38.0 38.0 36.8 38.0 75-79 37.08225 38.0 38.0 38.0 36.4 38.0 80-84 36.959500000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.932849999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.73025 38.0 38.0 38.0 35.2 38.0 95-99 36.742599999999996 38.0 38.0 38.0 35.4 38.0 100-104 36.8127 38.0 38.0 38.0 35.6 38.0 105-109 36.5866 38.0 38.0 38.0 35.0 38.0 110-114 36.43135 38.0 38.0 38.0 34.2 38.0 115-119 36.5654 38.0 38.0 38.0 34.6 38.0 120-124 36.417550000000006 38.0 38.0 38.0 34.0 38.0 125-129 36.27974999999999 38.0 38.0 38.0 33.8 38.0 130-134 35.91355 38.0 36.8 38.0 32.6 38.0 135-139 35.72345 38.0 36.4 38.0 32.4 38.0 140-144 35.510200000000005 38.0 36.0 38.0 31.6 38.0 145-149 34.943799999999996 38.0 35.8 38.0 30.4 38.0 150-151 31.019875 35.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 4.0 14 1.0 15 3.0 16 2.0 17 2.0 18 1.0 19 4.0 20 0.0 21 3.0 22 7.0 23 4.0 24 6.0 25 3.0 26 12.0 27 13.0 28 20.0 29 20.0 30 34.0 31 43.0 32 63.0 33 89.0 34 159.0 35 222.0 36 561.0 37 2721.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.62578222778473 11.76470588235294 9.937421777221527 37.6720901126408 2 22.25 14.825 32.725 30.2 3 20.775 20.275000000000002 27.525 31.424999999999997 4 21.375 29.25 23.075000000000003 26.3 5 22.95 32.05 24.925 20.075000000000003 6 19.55 34.9 24.975 20.575 7 14.249999999999998 26.125 41.225 18.4 8 17.8 25.0 30.75 26.450000000000003 9 16.900000000000002 25.374999999999996 33.875 23.849999999999998 10-14 19.259999999999998 30.025000000000002 27.095000000000002 23.62 15-19 19.445 29.28 27.42 23.855 20-24 19.575 28.76 27.6 24.065 25-29 19.265 29.62 27.305 23.810000000000002 30-34 19.43194319431943 29.0979097909791 27.33273327332733 24.137413741374136 35-39 19.501950195019504 29.192919291929194 27.59275927592759 23.712371237123712 40-44 20.135 28.175 27.845 23.845 45-49 19.975 28.715000000000003 27.310000000000002 24.0 50-54 19.97 28.470000000000002 27.405 24.154999999999998 55-59 20.080000000000002 29.154999999999998 26.77 23.995 60-64 20.385 28.634999999999998 26.88 24.099999999999998 65-69 20.0 28.74 27.465 23.794999999999998 70-74 20.080000000000002 28.84 27.73 23.35 75-79 20.01 28.815 26.525 24.65 80-84 20.244999999999997 28.405 27.57 23.78 85-89 20.93 28.93 26.99 23.150000000000002 90-94 20.544999999999998 28.57 26.855 24.03 95-99 20.56102805140257 28.596429821491075 26.866343317165857 23.976198809940495 100-104 20.666199859957988 28.698609582874862 26.81304391317395 23.822146643993197 105-109 20.805133604050734 28.570712387827747 26.765929713741414 23.858224294380108 110-114 20.767879548306148 28.456712672521956 26.659974905897116 24.11543287327478 115-119 21.43 28.494999999999997 26.135 23.94 120-124 20.765 28.694999999999997 26.169999999999998 24.37 125-129 20.794999999999998 28.27 26.700000000000003 24.235 130-134 20.715 28.084999999999997 26.445 24.755 135-139 20.630000000000003 27.67 26.41 25.290000000000003 140-144 21.529999999999998 27.305 26.655 24.51 145-149 21.58 27.66 26.36 24.4 150-151 20.94273568392098 27.731932983245812 25.756439109777446 25.568892223055762 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.5 22 2.0 23 2.0 24 1.5 25 2.5 26 4.5 27 5.5 28 7.0 29 12.0 30 19.0 31 26.5 32 35.5 33 53.0 34 63.5 35 70.0 36 83.0 37 103.5 38 124.0 39 147.0 40 177.5 41 207.0 42 239.0 43 259.5 44 252.0 45 264.5 46 274.5 47 258.5 48 236.5 49 196.5 50 172.0 51 149.5 52 117.0 53 102.5 54 90.0 55 63.0 56 42.0 57 36.5 58 27.5 59 14.5 60 13.5 61 9.5 62 8.0 63 6.0 64 1.5 65 3.0 66 4.0 67 2.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.03 105-109 0.265 110-114 0.375 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42094662638469 98.725 2 0.5287009063444109 1.05 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 6 0.15 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.125 0.0 0.0 0.0 0.0 94-95 1.325 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.8 0.0 0.0 0.0 0.0 100-101 2.0999999999999996 0.0 0.0 0.0 0.0 102-103 2.4 0.0 0.0 0.0 0.0 104-105 2.8375000000000004 0.0 0.0 0.0 0.0 106-107 3.1375 0.0 0.0 0.0 0.0 108-109 3.675 0.0 0.0 0.0 0.0 110-111 4.075 0.0 0.0 0.0 0.0 112-113 4.6 0.0 0.0 0.0 0.0 114-115 5.0 0.0 0.0 0.0 0.0 116-117 5.375 0.0 0.0 0.0 0.0 118-119 5.862500000000001 0.0 0.0 0.0 0.0 120-121 6.4625 0.0 0.0 0.0 0.0 122-123 6.85 0.0 0.0 0.0 0.0 124-125 7.4375 0.0 0.0 0.0 0.0 126-127 8.125 0.0 0.0 0.0 0.0 128-129 8.75 0.0 0.0 0.0 0.0 130-131 9.3 0.0 0.0 0.0 0.0 132-133 9.9875 0.0 0.0 0.0 0.0 134-135 10.675 0.0 0.0 0.0 0.0 136-137 11.4 0.0 0.0 0.0 0.0 138-139 12.287500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAAGAA 10 0.0068502324 144.8625 8 TCTAAGA 10 0.0068502324 144.8625 7 CCTTCTT 10 0.0068502324 144.8625 1 ACGTCTG 60 0.0045203036 14.48625 140-144 CACGTCT 60 0.0045203036 14.48625 140-144 >>END_MODULE SRR7169785 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169785_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0085 33.0 33.0 34.0 32.0 34.0 2 33.07475 34.0 33.0 34.0 32.0 34.0 3 33.03675 34.0 33.0 34.0 32.0 34.0 4 32.9375 34.0 33.0 34.0 32.0 34.0 5 32.9445 34.0 33.0 34.0 32.0 34.0 6 37.16125 38.0 38.0 38.0 37.0 38.0 7 37.157 38.0 38.0 38.0 37.0 38.0 8 37.201 38.0 38.0 38.0 37.0 38.0 9 37.189 38.0 38.0 38.0 37.0 38.0 10-14 37.09595 38.0 38.0 38.0 37.0 38.0 15-19 37.101299999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.06025 38.0 38.0 38.0 37.0 38.0 25-29 36.9774 38.0 38.0 38.0 36.6 38.0 30-34 36.89845 38.0 38.0 38.0 36.6 38.0 35-39 36.599149999999995 38.0 38.0 38.0 34.8 38.0 40-44 36.9092 38.0 38.0 38.0 36.4 38.0 45-49 37.0204 38.0 38.0 38.0 37.0 38.0 50-54 36.9264 38.0 38.0 38.0 36.4 38.0 55-59 36.84285 38.0 38.0 38.0 36.2 38.0 60-64 36.8657 38.0 38.0 38.0 36.0 38.0 65-69 36.81715 38.0 38.0 38.0 36.0 38.0 70-74 36.6021 38.0 38.0 38.0 35.8 38.0 75-79 35.85785 38.0 38.0 38.0 34.2 38.0 80-84 36.2131 38.0 38.0 38.0 34.0 38.0 85-89 36.60375 38.0 38.0 38.0 35.8 38.0 90-94 36.5398 38.0 38.0 38.0 35.2 38.0 95-99 36.3758 38.0 38.0 38.0 34.6 38.0 100-104 36.23415 38.0 38.0 38.0 34.2 38.0 105-109 35.36395 38.0 38.0 38.0 31.8 38.0 110-114 34.474849999999996 38.0 37.2 38.0 25.8 38.0 115-119 33.526599999999995 38.0 36.4 38.0 15.0 38.0 120-124 33.89425000000001 38.0 36.0 38.0 19.4 38.0 125-129 33.85675 38.0 35.2 38.0 21.6 38.0 130-134 35.15585 38.0 36.0 38.0 29.4 38.0 135-139 35.09929999999999 38.0 36.0 38.0 30.0 38.0 140-144 34.683749999999996 38.0 36.0 38.0 28.4 38.0 145-149 33.494749999999996 38.0 33.6 38.0 20.0 38.0 150-151 29.685875 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 7.0 4 3.0 5 2.0 6 0.0 7 1.0 8 2.0 9 5.0 10 4.0 11 1.0 12 2.0 13 4.0 14 1.0 15 3.0 16 5.0 17 3.0 18 8.0 19 5.0 20 7.0 21 7.0 22 11.0 23 8.0 24 4.0 25 20.0 26 17.0 27 22.0 28 34.0 29 62.0 30 76.0 31 72.0 32 87.0 33 97.0 34 147.0 35 252.0 36 530.0 37 2482.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.1 20.575 15.125 25.2 2 27.1 25.4 29.599999999999998 17.9 3 21.080270067516878 29.532383095773945 29.382345586396596 20.005001250312578 4 24.5311327831958 33.73343335833959 22.280570142535634 19.454863715928983 5 24.9 34.75 22.2 18.15 6 21.625 36.3 23.9 18.175 7 21.2 20.974999999999998 37.2 20.625 8 22.775000000000002 24.075 27.725 25.424999999999997 9 22.5 25.525 28.349999999999998 23.625 10-14 24.23 28.660000000000004 25.705 21.404999999999998 15-19 23.965 27.38 27.575 21.08 20-24 23.996199809990497 28.136406820341016 27.461373068653433 20.40602030101505 25-29 23.875 27.700000000000003 27.639999999999997 20.785 30-34 23.816190809540476 27.621381069053452 27.69138456922846 20.87104355217761 35-39 23.45821037363077 27.859750912819486 27.864752663432203 20.81728605011754 40-44 23.138470770615594 27.989198379756964 28.124218632794918 20.748112216832524 45-49 23.51617580879044 27.83139156957848 27.951397569878495 20.701035051752587 50-54 23.986199309965496 27.51137556877844 28.111405570278514 20.39101955097755 55-59 24.606230311515574 27.45137256862843 27.551377568878443 20.39101955097755 60-64 24.08 27.58 27.705000000000002 20.635 65-69 24.43 27.575 27.560000000000002 20.435 70-74 24.380186069901935 27.75961780236359 27.689212974603972 20.1709831531305 75-79 23.29838915878292 27.54794170288929 28.44796727179749 20.705701866530298 80-84 23.885109599395314 27.709750566893426 27.699672461577222 20.70546737213404 85-89 24.279999999999998 27.060000000000002 28.315 20.345 90-94 23.880000000000003 27.534999999999997 28.084999999999997 20.5 95-99 23.98 27.55 28.09 20.380000000000003 100-104 24.50990198039608 28.375675135027006 27.215443088617725 19.898979795959193 105-109 24.757578850668573 27.85036235582321 27.385934469735634 20.006124323772585 110-114 24.700465651650706 27.74551352482603 27.876314550306073 19.677706273217183 115-119 24.507283633247642 27.345758354755784 27.892030848329046 20.254927163667524 120-124 25.473827899406732 27.442641885861292 27.82590434189111 19.257625872840865 125-129 25.35560957947551 27.538405834583358 27.522888325660787 19.58309626028035 130-134 26.012515644555695 27.414267834793492 27.0738423028786 19.499374217772214 135-139 26.619999999999997 27.534999999999997 26.71 19.134999999999998 140-144 26.229999999999997 27.644999999999996 27.3 18.825 145-149 26.85 27.450000000000003 27.21 18.490000000000002 150-151 26.700850425212607 27.388694347173587 26.93846923461731 18.971985992996498 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 1.0 24 0.5 25 2.0 26 3.5 27 3.0 28 4.0 29 5.0 30 5.5 31 14.0 32 21.5 33 29.0 34 41.0 35 54.5 36 71.0 37 96.5 38 134.5 39 156.0 40 180.0 41 218.0 42 246.0 43 280.5 44 284.5 45 284.0 46 277.5 47 253.0 48 245.5 49 211.0 50 177.0 51 154.0 52 123.5 53 108.0 54 87.5 55 57.0 56 43.5 57 36.5 58 25.5 59 17.0 60 11.0 61 7.0 62 5.5 63 6.0 64 5.0 65 2.5 66 1.0 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.005 35-39 0.034999999999999996 40-44 0.015 45-49 0.005 50-54 0.005 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.575 75-79 2.225 80-84 0.775 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 2.03 110-114 4.4350000000000005 115-119 6.64 120-124 4.765 125-129 3.335 130-134 0.125 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.5283018867924528 1.05 3 0.0 0.0 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.2625000000000002 0.0 0.0 0.0 0.0 96-97 1.3624999999999998 0.0 0.0 0.0 0.0 98-99 1.725 0.0 0.0 0.0 0.0 100-101 2.025 0.0 0.0 0.0 0.0 102-103 2.325 0.0 0.0 0.0 0.0 104-105 2.75 0.0 0.0 0.0 0.0 106-107 3.0375 0.0 0.0 0.0 0.0 108-109 3.4875 0.0 0.0 0.0 0.0 110-111 3.8375 0.0 0.0 0.0 0.0 112-113 4.3875 0.0 0.0 0.0 0.0 114-115 4.7375 0.0 0.0 0.0 0.0 116-117 5.075 0.0 0.0 0.0 0.0 118-119 5.5375 0.0 0.0 0.0 0.0 120-121 6.1875 0.0 0.0 0.0 0.0 122-123 6.5625 0.0 0.0 0.0 0.0 124-125 7.15 0.0 0.0 0.0 0.0 126-127 7.7625 0.0 0.0 0.0 0.0 128-129 8.325 0.0 0.0 0.0 0.0 130-131 8.875 0.0 0.0 0.0 0.0 132-133 9.5375 0.0 0.0 0.0 0.0 134-135 10.274999999999999 0.0 0.0 0.0 0.0 136-137 11.037500000000001 0.0 0.0 0.0 0.0 138-139 11.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 95 0.0077416943 10.59579 140-144 >>END_MODULE Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra Read 583296 spots for SRR7169785.sra Written 583296 spots for SRR7169785.sra Read 583291 spots for SRR7169785.sra Written 583291 spots for SRR7169785.sra SRR ids: ['SRR7169785.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bhjcgomi SRR7169785.sra spots: 11665825 blocks: [[1, 583291], [583292, 1166582], [1166583, 1749873], [1749874, 2333164], [2333165, 2916455], [2916456, 3499746], [3499747, 4083037], [4083038, 4666328], [4666329, 5249619], [5249620, 5832910], [5832911, 6416201], [6416202, 6999492], [6999493, 7582783], [7582784, 8166074], [8166075, 8749365], [8749366, 9332656], [9332657, 9915947], [9915948, 10499238], [10499239, 11082529], [11082530, 11665825]] SRR7169785 file size 3931464 SRR7169785 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169785 SRR7169785_1.fastq SRR7169785_2.fastq Input file: SRR7169785_1.fastq Paired file: SRR7169785_2.fastq trimmed: SRR7169785-trimmed-pair1.fastq, SRR7169785-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:01:57 2025 >> started Tue Feb 11 17:02:10 2025 >> done (12.656s) 11665825 read pairs processed; of these: 21770 ( 0.19%) short read pairs filtered out after trimming by size control 23209 ( 0.20%) empty read pairs filtered out after trimming by size control 11620846 (99.61%) read pairs available; of these: 5457259 (46.96%) trimmed read pairs available after processing 6163587 (53.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 7 0.00% 21 7 0.00% 22 6 0.00% 23 7 0.00% 24 6 0.00% 25 7 0.00% 26 6 0.00% 27 12 0.00% 28 8 0.00% 29 10 0.00% 30 10 0.00% 31 12 0.00% 32 11 0.00% 33 8 0.00% 34 11 0.00% 35 15 0.00% 36 17 0.00% 37 8 0.00% 38 13 0.00% 39 21 0.00% 40 30 0.00% 41 29 0.00% 42 34 0.00% 43 34 0.00% 44 30 0.00% 45 47 0.00% 46 35 0.00% 47 55 0.00% 48 59 0.00% 49 88 0.00% 50 101 0.00% 51 96 0.00% 52 133 0.00% 53 129 0.00% 54 137 0.00% 55 186 0.00% 56 208 0.00% 57 220 0.00% 58 251 0.00% 59 334 0.00% 60 335 0.00% 61 425 0.00% 62 476 0.00% 63 574 0.00% 64 628 0.01% 65 663 0.01% 66 785 0.01% 67 860 0.01% 68 963 0.01% 69 1100 0.01% 70 1387 0.01% 71 1575 0.01% 72 1797 0.02% 73 2087 0.02% 74 2342 0.02% 75 2524 0.02% 76 2849 0.02% 77 2964 0.03% 78 3214 0.03% 79 3712 0.03% 80 4131 0.04% 81 4766 0.04% 82 5420 0.05% 83 6097 0.05% 84 7621 0.07% 85 8623 0.07% 86 9111 0.08% 87 9766 0.08% 88 10390 0.09% 89 10998 0.09% 90 11560 0.10% 91 12169 0.10% 92 12831 0.11% 93 14054 0.12% 94 14922 0.13% 95 15966 0.14% 96 16661 0.14% 97 16988 0.15% 98 17557 0.15% 99 17981 0.15% 100 19052 0.16% 101 19583 0.17% 102 20928 0.18% 103 22566 0.19% 104 23426 0.20% 105 24375 0.21% 106 25302 0.22% 107 25732 0.22% 108 26080 0.22% 109 26771 0.23% 110 27550 0.24% 111 28377 0.24% 112 29716 0.26% 113 30999 0.27% 114 32258 0.28% 115 33178 0.29% 116 34255 0.29% 117 34582 0.30% 118 34915 0.30% 119 35131 0.30% 120 35956 0.31% 121 36962 0.32% 122 37713 0.32% 123 39447 0.34% 124 40945 0.35% 125 41545 0.36% 126 43313 0.37% 127 44459 0.38% 128 45148 0.39% 129 45106 0.39% 130 45752 0.39% 131 46392 0.40% 132 47820 0.41% 133 48793 0.42% 134 50662 0.44% 135 52094 0.45% 136 54023 0.46% 137 56035 0.48% 138 57923 0.50% 139 59922 0.52% 140 61924 0.53% 141 65826 0.57% 142 69682 0.60% 143 75320 0.65% 144 84739 0.73% 145 99132 0.85% 146 112906 0.97% 147 145345 1.25% 148 209585 1.80% 149 395759 3.41% 150 2390940 20.57% 151 6163587 53.04% 11620846 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=41 prefix-density=0.26 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=74.61 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=11.2 sequence=CATCAAATTACAAGCACGTATGGTCTTGTAATATTTGCAGTAAACCGAGCTTTTTTTTCTAAAAAGGAAGAAAAACAGTAGATGGACATAACCAAACAAGCCACACATCAAGCATCATCATCACCGTTCTATAGAACACAAGAATACTGCCTGCTGCCCTACTGGGAAGCACTCTCCTTTTCTTTCTCCTTCTC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=44 prefix-density=0.25 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=10 fanout-score=46.99 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=11.9 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAGCGTGCCCAAAGCAGATGCCGTTTTCATGAAGTGGATATGCCATGATTGGAGCGACGCACACTGCTTAAAATTCTTGAAGAATTGCTATGACGCCTTGCCGGAAAACGGCAAGGTGATACTTGTTGAGTGCATTCTTCCCGTGGCTCCTGACACAAGCCTTGCCACCAAGGGAGTCGTGCACATTGATGTTATCATGCTGGCGCACAACCCCGGTGGGAAAGAGAGGACCGAAAAGGAATTTGAGGGCTTAGCAAAGGGAGCTGGCTTTCAAGGTTTTGAAGTAATGTGCTGTGCATTCAACACACATGTCATTGAATTCCGCAAGAACTAAGGCTCAAGTCCAAGCTCCAAGT SRR7169785 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:02:52 Started mapping on | Feb 11 17:02:53 Finished on | Feb 11 17:04:08 Mapping speed, Million of reads per hour | 557.80 Number of input reads | 11620846 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 10912660 Uniquely mapped reads % | 93.91% Average mapped length | 289.93 Number of splices: Total | 9504759 Number of splices: Annotated (sjdb) | 9334747 Number of splices: GT/AG | 9364890 Number of splices: GC/AG | 108179 Number of splices: AT/AC | 8301 Number of splices: Non-canonical | 23389 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 203907 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 17370 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.14% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 522820 522820 522820 N_multimapping 203907 203907 203907 N_noFeature 256658 10775421 308388 N_ambiguous 128153 695 42129 UnstrandedReadsAssigned:10527849 PositiveStrandReadsAssigned:136544 NegativeStrandReadsAssigned:10562143 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169785 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169785-trimmed-pair1.fastq SRR7169785-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,620,846 reads, 10,529,367 reads pseudoaligned [quant] estimated average fragment length: 213.077 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR7169785.ke.tsv 34699 SRR7169785.se.tsv 87100 total ==> SRR7169785.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.92 171 8.72516 Potri.005G024800.1.v4.1 1035 822.923 26 2.91132 Potri.004G059700.1.v4.1 961 748.923 3 0.369114 Potri.007G009000.2.v4.1 1416 1203.92 0 0 Potri.003G141000.2.v4.1 2943 2730.92 143 4.82506 Potri.016G087400.1.v4.1 270 92.7806 1485.63 1475.47 Potri.015G069301.1.v4.1 564 354.157 0 0 Potri.010G195200.1.v4.1 1773 1560.92 8 0.472264 Potri.012G127500.1.v4.1 977 764.923 3337 401.99 ==> SRR7169785.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1042 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 186 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169785 completed mapping pipeline successfully