Starting /dee2/code/volunteer_pipeline.sh SRR7169786 current disk space = 3053374595072 free memory = 1579471348 SRR7169786 SRAfilesize 13bcb6605e9ca4dc2b08cc6c9e8f6a69 SRR7169786.sra SRR7169786.sra file validated SRR7169786 is paired end SRR7169786 is conventional basespace SRR7169786 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169786_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.87725 32.0 31.0 33.0 27.0 33.0 2 32.46225 33.0 33.0 33.0 31.0 34.0 3 32.842 33.0 33.0 34.0 31.0 34.0 4 33.14075 34.0 33.0 34.0 33.0 34.0 5 33.3395 34.0 33.0 34.0 33.0 34.0 6 37.06 38.0 37.0 38.0 36.0 38.0 7 37.26275 38.0 38.0 38.0 36.0 38.0 8 37.45625 38.0 38.0 38.0 37.0 38.0 9 37.5465 38.0 38.0 38.0 38.0 38.0 10-14 37.52895 38.0 38.0 38.0 38.0 38.0 15-19 37.55025 38.0 38.0 38.0 38.0 38.0 20-24 37.530950000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.50834999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.5659 38.0 38.0 38.0 38.0 38.0 35-39 37.4666 38.0 38.0 38.0 37.8 38.0 40-44 37.43345 38.0 38.0 38.0 37.8 38.0 45-49 37.382600000000004 38.0 38.0 38.0 37.4 38.0 50-54 37.24695 38.0 38.0 38.0 36.8 38.0 55-59 37.14705 38.0 38.0 38.0 36.6 38.0 60-64 36.97580000000001 38.0 38.0 38.0 36.0 38.0 65-69 37.14275 38.0 38.0 38.0 36.4 38.0 70-74 37.1415 38.0 38.0 38.0 36.6 38.0 75-79 37.06255 38.0 38.0 38.0 36.2 38.0 80-84 37.05799999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.986549999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.7931 38.0 38.0 38.0 35.4 38.0 95-99 36.8526 38.0 38.0 38.0 35.4 38.0 100-104 36.787850000000006 38.0 38.0 38.0 35.6 38.0 105-109 36.702600000000004 38.0 38.0 38.0 35.2 38.0 110-114 36.57675 38.0 38.0 38.0 34.6 38.0 115-119 36.35865 38.0 38.0 38.0 34.0 38.0 120-124 36.283449999999995 38.0 38.0 38.0 33.8 38.0 125-129 36.17335 38.0 38.0 38.0 33.8 38.0 130-134 35.946450000000006 38.0 37.6 38.0 33.2 38.0 135-139 35.6218 38.0 36.4 38.0 32.2 38.0 140-144 35.47465 38.0 36.0 38.0 31.6 38.0 145-149 34.952200000000005 38.0 35.8 38.0 30.4 38.0 150-151 30.7805 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 0.0 13 1.0 14 0.0 15 2.0 16 2.0 17 2.0 18 2.0 19 4.0 20 1.0 21 5.0 22 4.0 23 5.0 24 9.0 25 6.0 26 9.0 27 14.0 28 24.0 29 23.0 30 27.0 31 51.0 32 50.0 33 92.0 34 116.0 35 194.0 36 482.0 37 2869.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.475 12.174999999999999 11.15 37.2 2 22.44744744744745 16.366366366366368 32.35735735735736 28.82882882882883 3 18.525 21.375 25.650000000000002 34.449999999999996 4 22.325 28.675 22.075 26.924999999999997 5 22.475 33.275 23.925 20.325 6 19.825 35.25 24.7 20.225 7 14.499999999999998 27.450000000000003 40.050000000000004 18.0 8 18.425 26.150000000000002 29.75 25.674999999999997 9 17.075000000000003 25.900000000000002 33.650000000000006 23.375 10-14 19.725 31.045 26.584999999999997 22.645 15-19 19.485 29.5 27.36 23.655 20-24 19.81 29.720000000000002 26.755000000000003 23.715 25-29 20.175 29.494999999999997 27.169999999999998 23.16 30-34 19.705000000000002 29.49 26.924999999999997 23.880000000000003 35-39 20.09 29.18 27.224999999999998 23.505000000000003 40-44 19.794999999999998 29.509999999999998 27.22 23.474999999999998 45-49 19.75 29.799999999999997 26.72 23.73 50-54 20.49 29.095 27.060000000000002 23.355 55-59 20.119999999999997 28.615000000000002 27.35 23.915 60-64 20.03 29.085 26.995 23.89 65-69 20.064999999999998 29.01 26.745 24.18 70-74 20.62 28.854999999999997 26.950000000000003 23.575 75-79 20.0 28.93 26.965 24.104999999999997 80-84 19.97 28.744999999999997 26.99 24.295 85-89 20.275000000000002 29.049999999999997 26.775 23.9 90-94 20.015 28.610000000000003 27.215 24.16 95-99 20.544999999999998 28.999999999999996 26.715 23.74 100-104 20.200000000000003 28.945 27.07 23.785 105-109 20.64 28.044999999999998 27.555000000000003 23.76 110-114 20.811446295462506 29.045975286407522 26.714693081194657 23.427885336935315 115-119 20.645 28.465 26.945000000000004 23.945 120-124 20.865000000000002 28.525 26.345000000000002 24.265 125-129 20.565 28.57 26.365 24.5 130-134 21.255 28.28 26.415 24.05 135-139 20.47 28.310000000000002 26.724999999999998 24.495 140-144 21.505 28.225 26.174999999999997 24.095 145-149 20.74 29.160000000000004 25.805 24.295 150-151 21.75 28.275 25.7875 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 2.0 26 2.5 27 5.0 28 8.0 29 15.0 30 22.5 31 30.0 32 34.5 33 47.0 34 67.0 35 72.0 36 85.0 37 110.0 38 135.5 39 158.0 40 190.5 41 222.0 42 236.5 43 245.0 44 241.5 45 250.0 46 263.0 47 264.5 48 250.0 49 203.0 50 163.5 51 136.0 52 115.0 53 104.5 54 81.0 55 61.0 56 46.0 57 33.0 58 25.0 59 15.0 60 11.0 61 8.5 62 8.0 63 8.0 64 3.5 65 2.5 66 2.5 67 1.5 68 1.0 69 1.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.055 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26970536388819 98.55000000000001 2 0.7302946361118107 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7250000000000001 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 2.35 0.0 0.0 0.0 0.0 106-107 2.7249999999999996 0.0 0.0 0.0 0.0 108-109 2.9375 0.0 0.0 0.0 0.0 110-111 3.2249999999999996 0.0 0.0 0.0 0.0 112-113 3.6625 0.0 0.0 0.0 0.0 114-115 4.262499999999999 0.0 0.0 0.0 0.0 116-117 4.675 0.0 0.0 0.0 0.0 118-119 5.137499999999999 0.0 0.0 0.0 0.0 120-121 5.575 0.0 0.0 0.0 0.0 122-123 6.1625 0.0 0.0 0.0 0.0 124-125 6.7125 0.0 0.0 0.0 0.0 126-127 7.2875 0.0 0.0 0.0 0.0 128-129 7.675000000000001 0.0 0.0 0.0 0.0 130-131 8.25 0.0 0.0 0.0 0.0 132-133 8.975 0.0 0.0 0.0 0.0 134-135 9.6125 0.0 0.0 0.0 0.0 136-137 10.3 0.0 0.0 0.0 0.0 138-139 11.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169786 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169786_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0325 33.0 33.0 34.0 32.0 34.0 2 33.111 34.0 33.0 34.0 33.0 34.0 3 33.10225 34.0 33.0 34.0 33.0 34.0 4 33.0615 34.0 33.0 34.0 33.0 34.0 5 33.11325 34.0 33.0 34.0 33.0 34.0 6 37.213 38.0 38.0 38.0 37.0 38.0 7 37.30675 38.0 38.0 38.0 38.0 38.0 8 37.28075 38.0 38.0 38.0 37.0 38.0 9 37.316 38.0 38.0 38.0 38.0 38.0 10-14 37.255 38.0 38.0 38.0 38.0 38.0 15-19 37.135149999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.24399999999999 38.0 38.0 38.0 37.8 38.0 25-29 37.1606 38.0 38.0 38.0 37.0 38.0 30-34 37.07155 38.0 38.0 38.0 37.4 38.0 35-39 37.09585 38.0 38.0 38.0 37.0 38.0 40-44 37.125099999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.121 38.0 38.0 38.0 37.0 38.0 50-54 37.051199999999994 38.0 38.0 38.0 37.0 38.0 55-59 36.8488 38.0 38.0 38.0 36.2 38.0 60-64 36.73995 38.0 38.0 38.0 35.8 38.0 65-69 37.011199999999995 38.0 38.0 38.0 36.8 38.0 70-74 36.935649999999995 38.0 38.0 38.0 36.8 38.0 75-79 35.86905 38.0 38.0 38.0 33.8 38.0 80-84 36.57395 38.0 38.0 38.0 35.4 38.0 85-89 36.5668 38.0 37.8 38.0 34.6 38.0 90-94 36.67895 38.0 38.0 38.0 35.6 38.0 95-99 36.64055 38.0 38.0 38.0 35.8 38.0 100-104 36.5086 38.0 38.0 38.0 35.2 38.0 105-109 34.98015 38.0 37.0 38.0 27.6 38.0 110-114 34.18775000000001 38.0 37.4 38.0 20.8 38.0 115-119 33.284 38.0 37.0 38.0 11.2 38.0 120-124 33.527750000000005 38.0 36.8 38.0 15.8 38.0 125-129 34.08995 38.0 36.0 38.0 20.0 38.0 130-134 34.90455000000001 38.0 36.0 38.0 27.0 38.0 135-139 34.68645 38.0 35.8 38.0 26.0 38.0 140-144 34.88485000000001 38.0 35.8 38.0 29.4 38.0 145-149 33.4109 38.0 34.0 38.0 21.4 38.0 150-151 30.323749999999997 35.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 7.0 4 2.0 5 2.0 6 4.0 7 2.0 8 0.0 9 0.0 10 0.0 11 2.0 12 4.0 13 1.0 14 4.0 15 5.0 16 4.0 17 2.0 18 1.0 19 7.0 20 0.0 21 5.0 22 6.0 23 14.0 24 24.0 25 18.0 26 18.0 27 20.0 28 40.0 29 55.0 30 60.0 31 79.0 32 90.0 33 118.0 34 122.0 35 240.0 36 482.0 37 2553.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.425 19.775000000000002 16.725 25.074999999999996 2 27.045283962972228 25.74430823117338 30.172629472104077 17.03777833375031 3 21.523427712352795 28.063142069656728 30.819343522926584 19.594086695063893 4 24.229516411926834 33.70082686043598 23.803558005512404 18.26609872212478 5 25.36939644377661 34.13473578762835 22.839969947407965 17.65589782118708 6 20.575 37.275000000000006 23.35 18.8 7 20.9 20.25 38.95 19.900000000000002 8 23.25 23.65 29.025000000000002 24.075 9 22.75 24.6 28.050000000000004 24.6 10-14 24.43 27.935 26.36 21.275 15-19 23.86932159295577 26.871122673604162 28.181909145487293 21.077646587952774 20-24 23.91 28.115000000000002 27.41 20.565 25-29 23.53 27.589999999999996 28.005000000000003 20.875 30-34 23.832383238323832 27.467746774677465 27.702770277027707 20.997099709971 35-39 23.880000000000003 27.560000000000002 27.615000000000002 20.945 40-44 24.07 27.634999999999998 27.575 20.72 45-49 23.895973993498373 27.76194048512128 27.846961740435113 20.49512378094524 50-54 23.65074596976069 27.66095924702113 27.906278161610093 20.78201662160809 55-59 23.954372623574145 27.056233740244146 28.652191314788872 20.337202321392837 60-64 23.91358703805571 27.62914437165575 27.98419762964445 20.473070960644097 65-69 23.880000000000003 27.485 27.87 20.765 70-74 23.9945910752742 27.17483848349777 28.196524265037308 20.634046176190715 75-79 23.737244243884927 27.18322137326291 28.36777601148659 20.711758371365573 80-84 23.98251432016883 27.84644759320671 27.97206310923525 20.198974977389206 85-89 23.23 27.61 28.549999999999997 20.61 90-94 23.472347234723472 27.83278327832783 28.152815281528156 20.54205420542054 95-99 23.94197098549275 27.498749374687343 28.61430715357679 19.94497248624312 100-104 23.86812747010856 27.530141577867827 28.24553504427435 20.35619590774926 105-109 24.371174322308523 26.994496167892596 28.450182603775527 20.184146906023354 110-114 24.748308741277366 28.114845789165287 27.70468225643211 19.432163213125232 115-119 24.643150123051683 27.355756084222037 28.20891441071917 19.79217938200711 120-124 24.912601516699834 27.962136287850264 27.257570053245843 19.867692142204056 125-129 25.539267015706805 27.764397905759164 27.204188481675395 19.49214659685864 130-134 25.44808250725944 27.946330229298088 27.8361870431561 18.76940022028637 135-139 25.105 27.66 27.810000000000002 19.425 140-144 25.629999999999995 27.965 27.465 18.94 145-149 25.83629181459073 27.956397819890995 27.411370568528426 18.79593979698985 150-151 26.272681451612907 27.356350806451612 27.961189516129032 18.409778225806452 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.5 24 3.0 25 2.5 26 2.5 27 5.5 28 8.5 29 11.5 30 10.5 31 9.0 32 12.5 33 23.5 34 41.5 35 56.0 36 70.5 37 98.5 38 128.0 39 163.0 40 198.5 41 231.5 42 246.0 43 251.0 44 282.5 45 290.5 46 275.0 47 266.5 48 248.0 49 219.5 50 180.0 51 143.5 52 122.0 53 105.5 54 81.0 55 52.5 56 36.5 57 29.5 58 25.5 59 17.5 60 10.0 61 6.5 62 6.5 63 6.0 64 3.5 65 2.0 66 1.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.075 3 0.22499999999999998 4 0.22499999999999998 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.06 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.025 50-54 0.13 55-59 0.06 60-64 0.015 65-69 0.0 70-74 0.165 75-79 2.495 80-84 0.49 85-89 0.0 90-94 0.01 95-99 0.05 100-104 0.055 105-109 2.795 110-114 6.135 115-119 8.575000000000001 120-124 7.034999999999999 125-129 4.5 130-134 0.13 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.8 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.7625 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.5999999999999996 0.0 0.0 0.0 0.0 108-109 2.75 0.0 0.0 0.0 0.0 110-111 2.9875 0.0 0.0 0.0 0.0 112-113 3.375 0.0 0.0 0.0 0.0 114-115 3.9125 0.0 0.0 0.0 0.0 116-117 4.3 0.0 0.0 0.0 0.0 118-119 4.7375 0.0 0.0 0.0 0.0 120-121 5.125 0.0 0.0 0.0 0.0 122-123 5.699999999999999 0.0 0.0 0.0 0.0 124-125 6.262499999999999 0.0 0.0 0.0 0.0 126-127 6.7875 0.0 0.0 0.0 0.0 128-129 7.2125 0.0 0.0 0.0 0.0 130-131 7.75 0.0 0.0 0.0 0.0 132-133 8.412500000000001 0.0 0.0 0.0 0.0 134-135 8.9875 0.0 0.0 0.0 0.0 136-137 9.675 0.0 0.0 0.0 0.0 138-139 10.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745808 spots for SRR7169786.sra Written 745808 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra Read 745795 spots for SRR7169786.sra Written 745795 spots for SRR7169786.sra SRR ids: ['SRR7169786.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6qcwklqd SRR7169786.sra spots: 14915913 blocks: [[1, 745795], [745796, 1491590], [1491591, 2237385], [2237386, 2983180], [2983181, 3728975], [3728976, 4474770], [4474771, 5220565], [5220566, 5966360], [5966361, 6712155], [6712156, 7457950], [7457951, 8203745], [8203746, 8949540], [8949541, 9695335], [9695336, 10441130], [10441131, 11186925], [11186926, 11932720], [11932721, 12678515], [12678516, 13424310], [13424311, 14170105], [14170106, 14915913]] SRR7169786 file size 5032813 SRR7169786 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169786 SRR7169786_1.fastq SRR7169786_2.fastq Input file: SRR7169786_1.fastq Paired file: SRR7169786_2.fastq trimmed: SRR7169786-trimmed-pair1.fastq, SRR7169786-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:12:37 2025 >> started Tue Feb 11 18:12:54 2025 >> done (16.717s) 14915913 read pairs processed; of these: 19919 ( 0.13%) short read pairs filtered out after trimming by size control 24349 ( 0.16%) empty read pairs filtered out after trimming by size control 14871645 (99.70%) read pairs available; of these: 6844433 (46.02%) trimmed read pairs available after processing 8027212 (53.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 7 0.00% 25 3 0.00% 26 8 0.00% 27 5 0.00% 28 4 0.00% 29 5 0.00% 30 9 0.00% 31 7 0.00% 32 10 0.00% 33 13 0.00% 34 16 0.00% 35 17 0.00% 36 10 0.00% 37 14 0.00% 38 12 0.00% 39 18 0.00% 40 14 0.00% 41 26 0.00% 42 21 0.00% 43 26 0.00% 44 30 0.00% 45 39 0.00% 46 40 0.00% 47 56 0.00% 48 60 0.00% 49 79 0.00% 50 87 0.00% 51 96 0.00% 52 121 0.00% 53 143 0.00% 54 154 0.00% 55 154 0.00% 56 174 0.00% 57 225 0.00% 58 246 0.00% 59 300 0.00% 60 388 0.00% 61 386 0.00% 62 480 0.00% 63 601 0.00% 64 627 0.00% 65 660 0.00% 66 719 0.00% 67 819 0.01% 68 959 0.01% 69 1083 0.01% 70 1247 0.01% 71 1457 0.01% 72 1700 0.01% 73 1965 0.01% 74 2162 0.01% 75 2463 0.02% 76 3024 0.02% 77 3525 0.02% 78 3289 0.02% 79 3586 0.02% 80 4047 0.03% 81 4596 0.03% 82 5336 0.04% 83 5968 0.04% 84 7536 0.05% 85 8627 0.06% 86 9265 0.06% 87 9862 0.07% 88 10548 0.07% 89 11234 0.08% 90 11943 0.08% 91 13074 0.09% 92 14029 0.09% 93 15162 0.10% 94 16470 0.11% 95 17389 0.12% 96 18351 0.12% 97 19228 0.13% 98 19741 0.13% 99 20910 0.14% 100 21720 0.15% 101 22686 0.15% 102 24259 0.16% 103 25928 0.17% 104 27563 0.19% 105 29324 0.20% 106 30442 0.20% 107 30972 0.21% 108 31809 0.21% 109 32996 0.22% 110 33221 0.22% 111 34939 0.23% 112 37012 0.25% 113 38648 0.26% 114 40478 0.27% 115 41713 0.28% 116 42589 0.29% 117 44027 0.30% 118 44710 0.30% 119 44543 0.30% 120 45881 0.31% 121 46867 0.32% 122 48016 0.32% 123 49929 0.34% 124 52260 0.35% 125 54010 0.36% 126 55971 0.38% 127 56946 0.38% 128 57807 0.39% 129 58721 0.39% 130 59019 0.40% 131 60451 0.41% 132 61783 0.42% 133 63669 0.43% 134 65432 0.44% 135 67403 0.45% 136 70011 0.47% 137 72485 0.49% 138 74541 0.50% 139 77179 0.52% 140 80043 0.54% 141 83949 0.56% 142 87803 0.59% 143 94849 0.64% 144 104612 0.70% 145 118558 0.80% 146 138622 0.93% 147 174840 1.18% 148 255608 1.72% 149 549240 3.69% 150 3001633 20.18% 151 8027212 53.98% 14871645 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=36 prefix-density=0.26 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=248.75 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=18.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=42 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=156.27 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=12.8 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169786 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:13:39 Started mapping on | Feb 11 18:13:39 Finished on | Feb 11 18:15:25 Mapping speed, Million of reads per hour | 505.07 Number of input reads | 14871645 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14022508 Uniquely mapped reads % | 94.29% Average mapped length | 290.65 Number of splices: Total | 12516076 Number of splices: Annotated (sjdb) | 12306356 Number of splices: GT/AG | 12332380 Number of splices: GC/AG | 145378 Number of splices: AT/AC | 10529 Number of splices: Non-canonical | 27789 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 266404 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 35705 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 599537 599537 599537 N_multimapping 266404 266404 266404 N_noFeature 283124 13857341 348514 N_ambiguous 151833 676 51695 UnstrandedReadsAssigned:13587551 PositiveStrandReadsAssigned:164491 NegativeStrandReadsAssigned:13622299 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169786 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169786-trimmed-pair1.fastq SRR7169786-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,871,645 reads, 13,560,741 reads pseudoaligned [quant] estimated average fragment length: 209.912 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR7169786.ke.tsv 34699 SRR7169786.se.tsv 87100 total ==> SRR7169786.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.09 218 8.27958 Potri.005G024800.1.v4.1 1035 826.088 52 4.32503 Potri.004G059700.1.v4.1 961 752.093 1 0.0913566 Potri.007G009000.2.v4.1 1416 1207.09 0 0 Potri.003G141000.2.v4.1 2943 2734.09 330.044 8.29412 Potri.016G087400.1.v4.1 270 92.0296 1451.05 1083.35 Potri.015G069301.1.v4.1 564 356.818 0 0 Potri.010G195200.1.v4.1 1773 1564.09 23 1.01036 Potri.012G127500.1.v4.1 977 768.093 4424 395.742 ==> SRR7169786.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 944 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 319 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169786 completed mapping pipeline successfully