Starting /dee2/code/volunteer_pipeline.sh SRR7169787 current disk space = 3049138470912 free memory = 1447034564 SRR7169787 SRAfilesize 431214818bcfcb6dafa06352a5ecb47b SRR7169787.sra SRR7169787.sra file validated SRR7169787 is paired end SRR7169787 is conventional basespace SRR7169787 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169787_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.9895 18.0 18.0 25.0 18.0 32.0 2 27.68775 29.0 27.0 30.0 25.0 31.0 3 28.31275 29.0 27.0 31.0 25.0 33.0 4 31.087 33.0 31.0 33.0 29.0 33.0 5 31.78375 33.0 32.0 33.0 30.0 33.0 6 36.41925 37.0 36.0 38.0 34.0 38.0 7 37.09725 38.0 38.0 38.0 36.0 38.0 8 37.15125 38.0 38.0 38.0 36.0 38.0 9 37.43925 38.0 38.0 38.0 37.0 38.0 10-14 37.545100000000005 38.0 38.0 38.0 37.6 38.0 15-19 37.57340000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.5951 38.0 38.0 38.0 38.0 38.0 25-29 37.600649999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.58095 38.0 38.0 38.0 38.0 38.0 35-39 37.5727 38.0 38.0 38.0 38.0 38.0 40-44 37.564499999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.48105 38.0 38.0 38.0 37.6 38.0 50-54 37.471500000000006 38.0 38.0 38.0 37.4 38.0 55-59 37.435249999999996 38.0 38.0 38.0 37.0 38.0 60-64 36.82445 38.0 37.8 38.0 35.2 38.0 65-69 37.147949999999994 38.0 38.0 38.0 36.6 38.0 70-74 37.3013 38.0 38.0 38.0 36.8 38.0 75-79 37.267250000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.13095 38.0 38.0 38.0 36.4 38.0 85-89 37.05535 38.0 38.0 38.0 36.0 38.0 90-94 36.9029 38.0 38.0 38.0 35.4 38.0 95-99 36.8973 38.0 38.0 38.0 35.8 38.0 100-104 36.97585 38.0 38.0 38.0 36.0 38.0 105-109 36.665949999999995 38.0 38.0 38.0 35.0 38.0 110-114 36.52335 38.0 38.0 38.0 35.0 38.0 115-119 36.6634 38.0 38.0 38.0 35.0 38.0 120-124 36.5317 38.0 38.0 38.0 34.4 38.0 125-129 36.4072 38.0 38.0 38.0 34.4 38.0 130-134 36.139050000000005 38.0 37.8 38.0 33.6 38.0 135-139 35.943650000000005 38.0 37.4 38.0 32.8 38.0 140-144 35.77205 38.0 36.8 38.0 32.6 38.0 145-149 35.18895 38.0 36.0 38.0 30.8 38.0 150-151 31.367874999999998 35.5 32.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 2.0 15 0.0 16 1.0 17 2.0 18 3.0 19 5.0 20 1.0 21 1.0 22 7.0 23 2.0 24 2.0 25 7.0 26 5.0 27 9.0 28 19.0 29 17.0 30 26.0 31 45.0 32 58.0 33 91.0 34 116.0 35 257.0 36 625.0 37 2697.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.65946217642624 11.686353355114349 7.539582809751194 36.11460165870822 2 23.25 12.125 34.025 30.599999999999998 3 19.725 22.400000000000002 26.6 31.275 4 24.825 28.125 23.0 24.05 5 23.825 32.025 23.974999999999998 20.175 6 21.5 33.324999999999996 23.775 21.4 7 14.399999999999999 27.175 41.975 16.45 8 18.0 23.625 32.800000000000004 25.575 9 17.575 22.1 33.875 26.450000000000003 10-14 20.05 30.695 27.279999999999998 21.975 15-19 21.005 28.735 27.01 23.25 20-24 21.085 28.025 27.26 23.630000000000003 25-29 20.34 28.349999999999998 27.565 23.745 30-34 19.85 28.689999999999998 27.255000000000003 24.205 35-39 20.02 28.355000000000004 27.400000000000002 24.224999999999998 40-44 20.49 29.4 26.825 23.285 45-49 20.945 28.865000000000002 26.935 23.255 50-54 19.919999999999998 28.555000000000003 27.405 24.12 55-59 20.26 28.84 26.900000000000002 24.0 60-64 20.305 28.595 26.91 24.19 65-69 20.630000000000003 28.794999999999998 27.175 23.400000000000002 70-74 20.77 28.82 26.61 23.799999999999997 75-79 20.945 28.93 26.775 23.35 80-84 20.365 28.189999999999998 27.250000000000004 24.195 85-89 20.64 28.46 27.084999999999997 23.815 90-94 21.125 28.395 27.055 23.425 95-99 21.17 28.694999999999997 26.46 23.674999999999997 100-104 21.49214921492149 28.61286128612861 26.792679267926793 23.1023102310231 105-109 21.05236757624398 28.531300160513645 26.575040128410915 23.84129213483146 110-114 20.858679804936905 28.399778794429643 26.87647679855211 23.865064602081343 115-119 21.404999999999998 28.76 26.16 23.674999999999997 120-124 21.42 28.294999999999998 26.245 24.04 125-129 21.43 27.994999999999997 26.99 23.585 130-134 21.335 28.65 25.955000000000002 24.060000000000002 135-139 21.255 28.134999999999998 26.985 23.625 140-144 21.72 28.749999999999996 25.905 23.625 145-149 21.5 29.315 25.805 23.380000000000003 150-151 21.375 28.762500000000003 25.937500000000004 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 1.5 25 4.5 26 6.0 27 7.0 28 11.0 29 11.0 30 16.0 31 17.5 32 25.5 33 39.5 34 53.0 35 70.5 36 77.5 37 93.0 38 116.5 39 143.5 40 177.0 41 212.5 42 228.0 43 249.0 44 261.0 45 256.0 46 274.5 47 265.5 48 240.0 49 217.5 50 180.5 51 163.0 52 136.0 53 106.5 54 89.5 55 66.5 56 52.0 57 37.0 58 23.0 59 16.5 60 13.0 61 8.0 62 5.0 63 3.5 64 5.0 65 5.5 66 2.5 67 0.5 68 1.5 69 3.0 70 1.5 71 1.0 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.32 110-114 0.545 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34525308486528 98.625 2 0.6043817678166709 1.2 3 0.02518257365902795 0.075 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.45 0.0 0.0 0.0 0.0 76-77 0.5874999999999999 0.0 0.0 0.0 0.0 78-79 0.75 0.0 0.0 0.0 0.0 80-81 0.95 0.0 0.0 0.0 0.0 82-83 1.1125 0.0 0.0 0.0 0.0 84-85 1.375 0.0 0.0 0.0 0.0 86-87 1.625 0.0 0.0 0.0 0.0 88-89 1.8875000000000002 0.0 0.0 0.0 0.0 90-91 2.1375 0.0 0.0 0.0 0.0 92-93 2.375 0.0 0.0 0.0 0.0 94-95 2.775 0.0 0.0 0.0 0.0 96-97 3.0999999999999996 0.0 0.0 0.0 0.0 98-99 3.425 0.0 0.0 0.0 0.0 100-101 3.8 0.0 0.0 0.0 0.0 102-103 4.2375 0.0 0.0 0.0 0.0 104-105 4.7375 0.0 0.0 0.0 0.0 106-107 5.225 0.0 0.0 0.0 0.0 108-109 5.875 0.0 0.0 0.0 0.0 110-111 6.375 0.0 0.0 0.0 0.0 112-113 6.7875 0.0 0.0 0.0 0.0 114-115 7.2625 0.0 0.0 0.0 0.0 116-117 7.75 0.0 0.0 0.0 0.0 118-119 8.2375 0.0 0.0 0.0 0.0 120-121 8.7875 0.0 0.0 0.0 0.0 122-123 9.35 0.0 0.0 0.0 0.0 124-125 9.975000000000001 0.0 0.0 0.0 0.0 126-127 10.675 0.0 0.0 0.0 0.0 128-129 11.462499999999999 0.0 0.0 0.0 0.0 130-131 12.175 0.0 0.0 0.0 0.0 132-133 13.1 0.0 0.0 0.0 0.0 134-135 14.05 0.0 0.0 0.0 0.0 136-137 14.9125 0.0 0.0 0.0 0.0 138-139 15.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCGAGT 10 0.006631775 146.41772 1 CGAGTGT 10 0.0068892627 144.5875 3 TCGAGTG 10 0.0068892627 144.5875 2 >>END_MODULE SRR7169787 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169787_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09625 33.0 33.0 34.0 32.0 34.0 2 33.2075 34.0 33.0 34.0 33.0 34.0 3 33.24925 34.0 33.0 34.0 33.0 34.0 4 33.16175 34.0 33.0 34.0 33.0 34.0 5 33.13775 34.0 33.0 34.0 33.0 34.0 6 37.32075 38.0 38.0 38.0 38.0 38.0 7 37.352 38.0 38.0 38.0 38.0 38.0 8 37.35 38.0 38.0 38.0 38.0 38.0 9 37.3625 38.0 38.0 38.0 37.0 38.0 10-14 37.27265 38.0 38.0 38.0 37.2 38.0 15-19 37.28475 38.0 38.0 38.0 37.2 38.0 20-24 37.2863 38.0 38.0 38.0 37.2 38.0 25-29 37.243199999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.155899999999995 38.0 38.0 38.0 37.0 38.0 35-39 36.76585 38.0 38.0 38.0 35.2 38.0 40-44 37.137100000000004 38.0 38.0 38.0 36.8 38.0 45-49 37.1685 38.0 38.0 38.0 37.0 38.0 50-54 37.076350000000005 38.0 38.0 38.0 36.8 38.0 55-59 36.97915 38.0 38.0 38.0 36.6 38.0 60-64 37.079750000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.04345000000001 38.0 38.0 38.0 36.8 38.0 70-74 36.628249999999994 38.0 38.0 38.0 36.0 38.0 75-79 35.66265 38.0 38.0 38.0 34.0 38.0 80-84 36.219049999999996 38.0 38.0 38.0 33.8 38.0 85-89 36.79375 38.0 38.0 38.0 36.0 38.0 90-94 36.7543 38.0 38.0 38.0 36.0 38.0 95-99 36.505250000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.36955 38.0 38.0 38.0 34.6 38.0 105-109 35.18795 38.0 38.0 38.0 31.0 38.0 110-114 33.986000000000004 38.0 37.2 38.0 19.2 38.0 115-119 32.87175 38.0 36.4 38.0 2.0 38.0 120-124 33.2338 38.0 35.8 38.0 12.2 38.0 125-129 33.4739 38.0 35.4 38.0 18.2 38.0 130-134 35.06025 38.0 36.0 38.0 28.0 38.0 135-139 35.02515 38.0 36.0 38.0 29.8 38.0 140-144 34.758399999999995 38.0 36.0 38.0 28.4 38.0 145-149 34.0064 38.0 34.2 38.0 25.0 38.0 150-151 30.011625000000002 35.5 27.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 6.0 5 3.0 6 4.0 7 3.0 8 1.0 9 1.0 10 3.0 11 0.0 12 1.0 13 2.0 14 4.0 15 1.0 16 4.0 17 3.0 18 5.0 19 0.0 20 12.0 21 7.0 22 9.0 23 21.0 24 11.0 25 19.0 26 17.0 27 20.0 28 55.0 29 58.0 30 64.0 31 65.0 32 89.0 33 122.0 34 154.0 35 250.0 36 487.0 37 2497.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.3 13.775 14.149999999999999 27.775 2 29.45 16.925 33.125 20.5 3 19.35483870967742 23.43085771442861 37.43435858964741 19.779944986246562 4 25.481370342585645 31.30782695673918 23.15578894723681 20.05501375343836 5 23.95 36.125 21.675 18.25 6 19.675 37.625 24.125 18.575 7 21.7 19.900000000000002 38.775 19.625 8 21.2 25.55 27.250000000000004 26.0 9 20.474999999999998 24.575 30.599999999999998 24.349999999999998 10-14 23.615 28.07 27.465 20.849999999999998 15-19 22.905 28.475 27.97 20.65 20-24 22.572257225722574 28.677867786778677 27.547754775477546 21.202120212021203 25-29 23.04 28.15 27.765 21.044999999999998 30-34 23.1911595579779 28.15640782039102 28.271413570678533 20.38101905095255 35-39 23.083079077677187 28.284899714900213 27.719701895663484 20.912319311759113 40-44 23.379675935187038 26.845369073814762 28.615723144628923 21.159231846369273 45-49 23.196159807990398 27.896394819740987 28.116405820291014 20.7910395519776 50-54 22.80114005700285 28.121406070303518 28.431421571078552 20.64603230161508 55-59 23.286164308215408 27.946397319865994 28.016400820041003 20.751037551877594 60-64 22.925 27.839999999999996 28.405 20.830000000000002 65-69 23.544999999999998 27.715 28.79 19.950000000000003 70-74 23.36580687496845 27.928928373126038 28.22169501791934 20.48356973398617 75-79 23.460743801652892 27.763429752066116 28.04235537190083 20.733471074380166 80-84 23.322215484131796 27.65312310491207 28.299979785728723 20.72468162522741 85-89 23.47 27.200000000000003 28.189999999999998 21.14 90-94 23.39 27.650000000000002 28.115000000000002 20.845 95-99 23.865 27.975 27.43 20.73 100-104 24.712241016915222 27.419677709938945 27.58482634370934 20.28325492943649 105-109 24.339768339768337 27.382239382239383 27.979407979407977 20.2985842985843 110-114 24.33484404158891 27.459344174886695 27.9445481205012 20.261263663023193 115-119 25.09381898454746 27.28476821192053 27.433774834437084 20.187637969094922 120-124 24.465290806754222 27.01688555347092 27.94961136424551 20.568212275529348 125-129 25.3617110505347 27.138813168379116 27.62109456909205 19.878381211994128 130-134 25.175350701402806 27.434869739478955 27.104208416833668 20.28557114228457 135-139 25.515 27.07 26.979999999999997 20.435 140-144 25.465 26.99 27.245 20.3 145-149 26.505000000000003 26.46 26.745 20.29 150-151 26.40611299010397 26.481272704497055 27.370662658148564 19.741951647250406 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 1.0 23 3.0 24 3.0 25 1.0 26 2.0 27 5.0 28 8.0 29 9.5 30 11.0 31 16.0 32 23.5 33 44.0 34 63.0 35 68.5 36 73.5 37 102.0 38 127.0 39 146.0 40 195.0 41 230.5 42 254.5 43 290.0 44 293.0 45 274.5 46 266.0 47 247.0 48 233.5 49 202.5 50 163.0 51 143.0 52 122.5 53 104.0 54 75.0 55 51.5 56 41.0 57 29.0 58 20.0 59 13.5 60 8.5 61 5.5 62 5.0 63 7.5 64 6.0 65 2.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.005 35-39 0.034999999999999996 40-44 0.02 45-49 0.005 50-54 0.005 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.9450000000000001 75-79 3.2 80-84 1.06 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.09 105-109 2.875 110-114 6.225 115-119 9.4 120-124 6.7250000000000005 125-129 4.62 130-134 0.2 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5537377296753083 1.0999999999999999 3 0.025169896803423106 0.075 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.4625 0.0 0.0 0.0 0.0 76-77 0.5874999999999999 0.0 0.0 0.0 0.0 78-79 0.7125 0.0 0.0 0.0 0.0 80-81 0.8875 0.0 0.0 0.0 0.0 82-83 1.0375 0.0 0.0 0.0 0.0 84-85 1.3 0.0 0.0 0.0 0.0 86-87 1.5875 0.0 0.0 0.0 0.0 88-89 1.8875000000000002 0.0 0.0 0.0 0.0 90-91 2.1375 0.0 0.0 0.0 0.0 92-93 2.375 0.0 0.0 0.0 0.0 94-95 2.7874999999999996 0.0 0.0 0.0 0.0 96-97 3.0875 0.0 0.0 0.0 0.0 98-99 3.3875 0.0 0.0 0.0 0.0 100-101 3.7625 0.0 0.0 0.0 0.0 102-103 4.125 0.0 0.0 0.0 0.0 104-105 4.6125 0.0 0.0 0.0 0.0 106-107 5.074999999999999 0.0 0.0 0.0 0.0 108-109 5.6875 0.0 0.0 0.0 0.0 110-111 6.137499999999999 0.0 0.0 0.0 0.0 112-113 6.5 0.0 0.0 0.0 0.0 114-115 6.949999999999999 0.0 0.0 0.0 0.0 116-117 7.3875 0.0 0.0 0.0 0.0 118-119 7.8875 0.0 0.0 0.0 0.0 120-121 8.3375 0.0 0.0 0.0 0.0 122-123 8.8125 0.0 0.0 0.0 0.0 124-125 9.4125 0.0 0.0 0.0 0.0 126-127 10.0375 0.0 0.0 0.0 0.0 128-129 10.775 0.0 0.0 0.0 0.0 130-131 11.5125 0.0 0.0 0.0 0.0 132-133 12.475 0.0 0.0 0.0 0.0 134-135 13.425 0.0 0.0 0.0 0.0 136-137 14.2125 0.0 0.0 0.0 0.0 138-139 14.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818314 spots for SRR7169787.sra Written 818314 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra Read 818304 spots for SRR7169787.sra Written 818304 spots for SRR7169787.sra SRR ids: ['SRR7169787.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kwshkqis SRR7169787.sra spots: 16366090 blocks: [[1, 818304], [818305, 1636608], [1636609, 2454912], [2454913, 3273216], [3273217, 4091520], [4091521, 4909824], [4909825, 5728128], [5728129, 6546432], [6546433, 7364736], [7364737, 8183040], [8183041, 9001344], [9001345, 9819648], [9819649, 10637952], [10637953, 11456256], [11456257, 12274560], [12274561, 13092864], [13092865, 13911168], [13911169, 14729472], [14729473, 15547776], [15547777, 16366090]] SRR7169787 file size 5524230 SRR7169787 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169787 SRR7169787_1.fastq SRR7169787_2.fastq Input file: SRR7169787_1.fastq Paired file: SRR7169787_2.fastq trimmed: SRR7169787-trimmed-pair1.fastq, SRR7169787-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:14:56 2025 >> started Tue Feb 11 16:15:15 2025 >> done (18.432s) 16366090 read pairs processed; of these: 12451 ( 0.08%) short read pairs filtered out after trimming by size control 18843 ( 0.12%) empty read pairs filtered out after trimming by size control 16334796 (99.81%) read pairs available; of these: 7997981 (48.96%) trimmed read pairs available after processing 8336815 (51.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 1 0.00% 21 5 0.00% 22 0 0.00% 23 5 0.00% 24 4 0.00% 25 3 0.00% 26 4 0.00% 27 6 0.00% 28 8 0.00% 29 7 0.00% 30 8 0.00% 31 11 0.00% 32 12 0.00% 33 15 0.00% 34 19 0.00% 35 16 0.00% 36 19 0.00% 37 36 0.00% 38 55 0.00% 39 59 0.00% 40 72 0.00% 41 82 0.00% 42 104 0.00% 43 120 0.00% 44 75 0.00% 45 147 0.00% 46 146 0.00% 47 201 0.00% 48 241 0.00% 49 312 0.00% 50 387 0.00% 51 442 0.00% 52 488 0.00% 53 516 0.00% 54 552 0.00% 55 614 0.00% 56 669 0.00% 57 835 0.01% 58 974 0.01% 59 1117 0.01% 60 1550 0.01% 61 1824 0.01% 62 2084 0.01% 63 2182 0.01% 64 2319 0.01% 65 2414 0.01% 66 2588 0.02% 67 2932 0.02% 68 3369 0.02% 69 3907 0.02% 70 4746 0.03% 71 5573 0.03% 72 6506 0.04% 73 7329 0.04% 74 7721 0.05% 75 7908 0.05% 76 8818 0.05% 77 9153 0.06% 78 9442 0.06% 79 10795 0.07% 80 12281 0.08% 81 14193 0.09% 82 16122 0.10% 83 17366 0.11% 84 19252 0.12% 85 20207 0.12% 86 19828 0.12% 87 20009 0.12% 88 20927 0.13% 89 21554 0.13% 90 23422 0.14% 91 26151 0.16% 92 28861 0.18% 93 31107 0.19% 94 32635 0.20% 95 33179 0.20% 96 33106 0.20% 97 32293 0.20% 98 31882 0.20% 99 33311 0.20% 100 34805 0.21% 101 37464 0.23% 102 39872 0.24% 103 43026 0.26% 104 44776 0.27% 105 46275 0.28% 106 46145 0.28% 107 45258 0.28% 108 44036 0.27% 109 44048 0.27% 110 45254 0.28% 111 48394 0.30% 112 50797 0.31% 113 53483 0.33% 114 57100 0.35% 115 58610 0.36% 116 57945 0.35% 117 58108 0.36% 118 56173 0.34% 119 55059 0.34% 120 55758 0.34% 121 57359 0.35% 122 60651 0.37% 123 63751 0.39% 124 67648 0.41% 125 69773 0.43% 126 71692 0.44% 127 71249 0.44% 128 70219 0.43% 129 69112 0.42% 130 68631 0.42% 131 69479 0.43% 132 72069 0.44% 133 75779 0.46% 134 79219 0.48% 135 83483 0.51% 136 85600 0.52% 137 86718 0.53% 138 87688 0.54% 139 87863 0.54% 140 89464 0.55% 141 94044 0.58% 142 98767 0.60% 143 106797 0.65% 144 122182 0.75% 145 140639 0.86% 146 159277 0.98% 147 202979 1.24% 148 282984 1.73% 149 519607 3.18% 150 3161630 19.36% 151 8336815 51.04% 16334796 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=2 fanout-score=2.74 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.5 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=190.68 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=34 prefix-density=0.22 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.16 sequence-density-rank=5 fanout-score=33.18 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=10.5 sequence=TGTTGGTGGTGGTACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAACATGTTGGTGGGGACATGTTTGTTAGTGTGCCCAAAGCAGATGCCGTTTTCATGAAGTGGATATGCCATGATTGGAGCGACGCACACTGCTTAAAATTCTTGAAGAATTGCTATGACGCGTTGCCGGAAAACGGCAAGGTGATACTTGTTGAGTGCATTCTTCCCGTGGCTCCTGACACAAGCCTTGCCACCAA SRR7169787 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:15:58 Started mapping on | Feb 11 16:15:58 Finished on | Feb 11 16:17:12 Mapping speed, Million of reads per hour | 794.67 Number of input reads | 16334796 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 15758415 Uniquely mapped reads % | 96.47% Average mapped length | 286.64 Number of splices: Total | 14058275 Number of splices: Annotated (sjdb) | 13834476 Number of splices: GT/AG | 13857712 Number of splices: GC/AG | 156388 Number of splices: AT/AC | 11586 Number of splices: Non-canonical | 32589 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 261686 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 57489 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 325596 325596 325596 N_multimapping 261686 261686 261686 N_noFeature 420492 15592485 484365 N_ambiguous 163361 776 60759 UnstrandedReadsAssigned:15174562 PositiveStrandReadsAssigned:165154 NegativeStrandReadsAssigned:15213291 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7169787 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169787-trimmed-pair1.fastq SRR7169787-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,334,796 reads, 15,160,439 reads pseudoaligned [quant] estimated average fragment length: 200.717 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR7169787.ke.tsv 34699 SRR7169787.se.tsv 87100 total ==> SRR7169787.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1818.28 263 11.1848 Potri.005G024800.1.v4.1 1035 835.283 26 2.40698 Potri.004G059700.1.v4.1 961 761.29 0 0 Potri.007G009000.2.v4.1 1416 1216.28 0 0 Potri.003G141000.2.v4.1 2943 2743.28 296.038 8.34469 Potri.016G087400.1.v4.1 270 100.217 974 751.538 Potri.015G069301.1.v4.1 564 365.574 0 0 Potri.010G195200.1.v4.1 1773 1573.28 18 0.884706 Potri.012G127500.1.v4.1 977 777.29 4029 400.818 ==> SRR7169787.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1351 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 232 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169787 completed mapping pipeline successfully