Starting /dee2/code/volunteer_pipeline.sh SRR7169788 current disk space = 2810367041536 free memory = 1581365484 SRR7169788 SRAfilesize d6f3e7d0c68979bfedd053d3f72321c4 SRR7169788.sra SRR7169788.sra file validated SRR7169788 is paired end SRR7169788 is conventional basespace SRR7169788 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169788_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.10375 28.0 18.0 32.0 18.0 32.0 2 31.14525 31.0 30.0 33.0 28.0 33.0 3 31.861 33.0 31.0 33.0 29.0 33.0 4 32.1695 33.0 33.0 33.0 31.0 34.0 5 32.923 33.0 33.0 34.0 32.0 34.0 6 36.91675 38.0 37.0 38.0 35.0 38.0 7 37.30125 38.0 38.0 38.0 36.0 38.0 8 37.492 38.0 38.0 38.0 37.0 38.0 9 37.57975 38.0 38.0 38.0 37.0 38.0 10-14 37.54925 38.0 38.0 38.0 37.6 38.0 15-19 37.59595 38.0 38.0 38.0 38.0 38.0 20-24 37.61295 38.0 38.0 38.0 38.0 38.0 25-29 37.5806 38.0 38.0 38.0 38.0 38.0 30-34 37.54815 38.0 38.0 38.0 38.0 38.0 35-39 37.383250000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.12335 38.0 38.0 38.0 36.2 38.0 45-49 37.35195 38.0 38.0 38.0 37.0 38.0 50-54 37.37925 38.0 38.0 38.0 37.0 38.0 55-59 37.39540000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.28555 38.0 38.0 38.0 37.0 38.0 65-69 37.2306 38.0 38.0 38.0 36.2 38.0 70-74 37.1856 38.0 38.0 38.0 36.2 38.0 75-79 37.14450000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.0621 38.0 38.0 38.0 36.0 38.0 85-89 36.931349999999995 38.0 38.0 38.0 35.8 38.0 90-94 36.7654 38.0 38.0 38.0 35.0 38.0 95-99 36.834649999999996 38.0 38.0 38.0 35.2 38.0 100-104 36.6705 38.0 38.0 38.0 34.6 38.0 105-109 36.47805 38.0 38.0 38.0 34.0 38.0 110-114 36.38175 38.0 37.8 38.0 34.0 38.0 115-119 36.231700000000004 38.0 37.2 38.0 33.8 38.0 120-124 36.06785 38.0 37.0 38.0 32.8 38.0 125-129 35.86794999999999 38.0 36.6 38.0 31.8 38.0 130-134 35.4337 38.0 35.8 38.0 29.6 38.0 135-139 35.22805 38.0 35.8 38.0 30.0 38.0 140-144 34.8831 38.0 35.0 38.0 28.6 38.0 145-149 34.41705 38.0 35.0 38.0 27.6 38.0 150-151 30.471625000000003 36.0 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 3.0 16 0.0 17 0.0 18 1.0 19 2.0 20 3.0 21 0.0 22 4.0 23 6.0 24 5.0 25 4.0 26 3.0 27 15.0 28 16.0 29 31.0 30 36.0 31 50.0 32 57.0 33 94.0 34 158.0 35 294.0 36 756.0 37 2458.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.99011907778059 10.666328857360021 10.463643273372183 41.87990879148721 2 20.625 15.325 36.5 27.55 3 21.099999999999998 19.775000000000002 24.875 34.25 4 22.875 28.549999999999997 22.5 26.075 5 22.25 33.375 24.9 19.475 6 18.925 34.925 25.85 20.3 7 13.900000000000002 26.724999999999998 42.075 17.299999999999997 8 17.4 23.825 32.324999999999996 26.450000000000003 9 16.75 24.525 34.175 24.55 10-14 20.150000000000002 29.825000000000003 26.755000000000003 23.27 15-19 19.735 28.575 27.894999999999996 23.794999999999998 20-24 20.080000000000002 28.634999999999998 28.03 23.255 25-29 19.71 27.99 28.395 23.905 30-34 19.805 28.895 27.47 23.830000000000002 35-39 19.814999999999998 28.560000000000002 27.715 23.91 40-44 20.19 28.71 27.505000000000003 23.595 45-49 19.75 29.09 27.35 23.810000000000002 50-54 20.424999999999997 28.95 27.445000000000004 23.18 55-59 20.445 28.34 27.915 23.3 60-64 20.335 28.68 27.185 23.799999999999997 65-69 19.7 28.4 28.175 23.724999999999998 70-74 19.775000000000002 28.51 27.55 24.165 75-79 19.73 28.415000000000003 27.965 23.89 80-84 19.939999999999998 28.79 27.68 23.59 85-89 20.185 28.475 27.72 23.62 90-94 20.075000000000003 28.575 27.800000000000004 23.549999999999997 95-99 20.44 28.52 27.584999999999997 23.455000000000002 100-104 20.68 28.64 27.045 23.635 105-109 21.145 28.265 27.169999999999998 23.419999999999998 110-114 20.04 29.075 27.315 23.57 115-119 20.59 28.494999999999997 27.375 23.54 120-124 21.075 28.7 26.735 23.49 125-129 21.135 28.28 26.445 24.14 130-134 21.23 28.494999999999997 26.855 23.419999999999998 135-139 20.810000000000002 28.634999999999998 26.855 23.7 140-144 20.979999999999997 28.754999999999995 26.805 23.46 145-149 20.82 28.449999999999996 26.455000000000002 24.275 150-151 20.75 29.025000000000002 26.4125 23.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 1.5 24 2.5 25 2.0 26 4.0 27 5.0 28 11.5 29 15.0 30 13.0 31 26.0 32 38.0 33 49.0 34 65.5 35 75.5 36 81.5 37 97.0 38 123.0 39 161.5 40 201.5 41 210.5 42 236.5 43 258.5 44 249.0 45 264.5 46 281.5 47 269.5 48 238.0 49 209.0 50 179.5 51 145.5 52 120.0 53 98.5 54 77.0 55 55.0 56 37.5 57 26.5 58 16.5 59 11.0 60 7.5 61 6.0 62 5.0 63 4.0 64 4.5 65 3.5 66 2.5 67 1.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.7000000000000002 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.125 0.0 0.0 0.0 0.0 106-107 2.45 0.0 0.0 0.0 0.0 108-109 2.875 0.0 0.0 0.0 0.0 110-111 3.2750000000000004 0.0 0.0 0.0 0.0 112-113 3.6625 0.0 0.0 0.0 0.0 114-115 4.125 0.0 0.0 0.0 0.0 116-117 4.6375 0.0 0.0 0.0 0.0 118-119 5.1875 0.0 0.0 0.0 0.0 120-121 5.675 0.0 0.0 0.0 0.0 122-123 6.3 0.0 0.0 0.0 0.0 124-125 6.9125 0.0 0.0 0.0 0.0 126-127 7.8 0.0 0.0 0.0 0.0 128-129 8.287500000000001 0.0 0.0 0.0 0.0 130-131 8.9375 0.0 0.0 0.0 0.0 132-133 9.600000000000001 0.0 0.0 0.0 0.0 134-135 10.3875 0.0 0.0 0.0 0.0 136-137 11.0375 0.0 0.0 0.0 0.0 138-139 11.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.0035366106 41.428574 145 >>END_MODULE SRR7169788 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169788_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04925 33.0 33.0 34.0 32.0 34.0 2 32.16025 33.0 33.0 34.0 30.0 34.0 3 32.987 33.0 33.0 34.0 32.0 34.0 4 33.1145 34.0 33.0 34.0 32.0 34.0 5 33.328 34.0 33.0 34.0 33.0 34.0 6 37.49575 38.0 38.0 38.0 38.0 38.0 7 37.56675 38.0 38.0 38.0 38.0 38.0 8 37.536 38.0 38.0 38.0 38.0 38.0 9 37.629 38.0 38.0 38.0 38.0 38.0 10-14 37.5724 38.0 38.0 38.0 38.0 38.0 15-19 37.5787 38.0 38.0 38.0 38.0 38.0 20-24 37.562400000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.53385000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.51175 38.0 38.0 38.0 38.0 38.0 35-39 37.15695 38.0 38.0 38.0 37.0 38.0 40-44 37.4366 38.0 38.0 38.0 37.4 38.0 45-49 37.0749 38.0 38.0 38.0 36.4 38.0 50-54 37.28815000000001 38.0 38.0 38.0 37.2 38.0 55-59 36.7724 38.0 37.8 38.0 34.8 38.0 60-64 37.2509 38.0 38.0 38.0 37.0 38.0 65-69 37.16865 38.0 38.0 38.0 36.6 38.0 70-74 37.10915 38.0 38.0 38.0 36.8 38.0 75-79 37.147800000000004 38.0 38.0 38.0 36.8 38.0 80-84 37.0818 38.0 38.0 38.0 36.4 38.0 85-89 36.266949999999994 38.0 37.6 38.0 32.6 38.0 90-94 36.988400000000006 38.0 38.0 38.0 36.0 38.0 95-99 37.006150000000005 38.0 38.0 38.0 36.0 38.0 100-104 36.7961 38.0 38.0 38.0 35.6 38.0 105-109 36.27115 38.0 38.0 38.0 34.0 38.0 110-114 35.5005 38.0 37.2 38.0 31.8 38.0 115-119 34.6785 38.0 36.8 38.0 27.8 38.0 120-124 35.12795 38.0 36.6 38.0 29.4 38.0 125-129 35.112 38.0 36.2 38.0 28.4 38.0 130-134 34.96715 38.0 35.4 38.0 27.6 38.0 135-139 34.81275 38.0 35.0 38.0 27.8 38.0 140-144 33.6425 37.8 32.8 38.0 22.4 38.0 145-149 33.4183 38.0 32.6 38.0 21.8 38.0 150-151 29.846875 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 0.0 5 3.0 6 1.0 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 2.0 13 1.0 14 2.0 15 0.0 16 0.0 17 2.0 18 4.0 19 3.0 20 3.0 21 3.0 22 3.0 23 5.0 24 4.0 25 10.0 26 13.0 27 16.0 28 19.0 29 26.0 30 30.0 31 53.0 32 80.0 33 178.0 34 153.0 35 295.0 36 722.0 37 2362.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.9 18.15 15.375 29.575000000000003 2 25.45 25.374999999999996 31.324999999999996 17.849999999999998 3 20.325 27.05 31.724999999999998 20.9 4 24.45 33.25 22.95 19.35 5 24.05 36.1 22.975 16.875 6 20.3 38.574999999999996 23.7 17.424999999999997 7 20.200000000000003 21.4 38.324999999999996 20.075000000000003 8 20.5 24.8 28.449999999999996 26.25 9 20.5 24.325 31.724999999999998 23.45 10-14 23.380000000000003 28.4 26.640000000000004 21.58 15-19 23.255 27.21 28.38 21.154999999999998 20-24 23.52 27.875 27.865000000000002 20.74 25-29 23.3 28.575 27.38 20.745 30-34 23.09 28.01 28.28 20.62 35-39 22.8 28.735 27.41 21.055 40-44 23.32 27.915 28.21 20.555 45-49 23.345 28.02 28.294999999999998 20.34 50-54 22.48 28.345 28.22 20.955 55-59 23.235 28.505000000000003 27.815 20.445 60-64 23.61 27.71 28.384999999999998 20.294999999999998 65-69 24.16 27.495000000000005 28.360000000000003 19.985 70-74 24.11 27.54 28.315 20.035 75-79 23.36 27.775 28.634999999999998 20.23 80-84 23.515 27.85 28.305000000000003 20.330000000000002 85-89 23.54 27.61 28.225 20.625 90-94 23.105 27.68 28.33 20.885 95-99 23.805 28.165000000000003 28.185 19.845 100-104 24.349999999999998 27.500000000000004 28.175 19.975 105-109 23.425 28.044999999999998 28.055000000000003 20.474999999999998 110-114 23.605567495650394 27.37181455326988 28.088220243577933 20.93439770750179 115-119 24.415204678362574 28.47222222222222 27.62635756056809 19.48621553884712 120-124 24.27869858809085 27.94659300184162 27.603846940863512 20.17086146920401 125-129 24.647708195553747 28.142646385511522 27.750928422444932 19.458716996489798 130-134 25.679999999999996 28.63 27.155 18.535 135-139 25.569999999999997 28.194999999999997 26.674999999999997 19.56 140-144 25.455 28.785 26.86 18.9 145-149 26.279999999999998 28.549999999999997 26.669999999999998 18.5 150-151 25.937500000000004 28.325 26.424999999999997 19.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 1.5 25 1.5 26 2.0 27 2.0 28 5.5 29 12.0 30 14.5 31 15.0 32 19.5 33 38.0 34 58.5 35 61.0 36 85.5 37 115.5 38 136.5 39 174.0 40 200.0 41 226.0 42 250.5 43 275.5 44 294.0 45 308.5 46 277.0 47 241.0 48 223.0 49 187.5 50 175.5 51 142.5 52 111.5 53 91.0 54 68.5 55 51.0 56 33.0 57 26.0 58 20.5 59 13.5 60 9.0 61 6.5 62 4.0 63 2.0 64 2.5 65 4.0 66 3.0 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 2.29 115-119 4.24 120-124 2.26 125-129 1.7149999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.9 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.85 0.0 0.0 0.0 0.0 110-111 3.2 0.0 0.0 0.0 0.0 112-113 3.5125 0.0 0.0 0.0 0.0 114-115 3.95 0.0 0.0 0.0 0.0 116-117 4.4625 0.0 0.0 0.0 0.0 118-119 4.9875 0.0 0.0 0.0 0.0 120-121 5.45 0.0 0.0 0.0 0.0 122-123 6.0625 0.0 0.0 0.0 0.0 124-125 6.65 0.0 0.0 0.0 0.0 126-127 7.5 0.0 0.0 0.0 0.0 128-129 7.9875 0.0 0.0 0.0 0.0 130-131 8.6125 0.0 0.0 0.0 0.0 132-133 9.1875 0.0 0.0 0.0 0.0 134-135 9.9375 0.0 0.0 0.0 0.0 136-137 10.5 0.0 0.0 0.0 0.0 138-139 10.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGACCA 10 0.0069196247 144.375 1 >>END_MODULE Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681982 spots for SRR7169788.sra Written 681982 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra Read 681977 spots for SRR7169788.sra Written 681977 spots for SRR7169788.sra SRR ids: ['SRR7169788.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fxxni21f SRR7169788.sra spots: 13639545 blocks: [[1, 681977], [681978, 1363954], [1363955, 2045931], [2045932, 2727908], [2727909, 3409885], [3409886, 4091862], [4091863, 4773839], [4773840, 5455816], [5455817, 6137793], [6137794, 6819770], [6819771, 7501747], [7501748, 8183724], [8183725, 8865701], [8865702, 9547678], [9547679, 10229655], [10229656, 10911632], [10911633, 11593609], [11593610, 12275586], [12275587, 12957563], [12957564, 13639545]] SRR7169788 file size 4600293 SRR7169788 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169788 SRR7169788_1.fastq SRR7169788_2.fastq Input file: SRR7169788_1.fastq Paired file: SRR7169788_2.fastq trimmed: SRR7169788-trimmed-pair1.fastq, SRR7169788-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Apr 11 12:13:44 2025 >> started Fri Apr 11 12:13:59 2025 >> done (15.183s) 13639545 read pairs processed; of these: 7268 ( 0.05%) short read pairs filtered out after trimming by size control 11649 ( 0.09%) empty read pairs filtered out after trimming by size control 13620628 (99.86%) read pairs available; of these: 6804765 (49.96%) trimmed read pairs available after processing 6815863 (50.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 5 0.00% 21 4 0.00% 22 0 0.00% 23 7 0.00% 24 5 0.00% 25 0 0.00% 26 5 0.00% 27 5 0.00% 28 7 0.00% 29 9 0.00% 30 8 0.00% 31 9 0.00% 32 11 0.00% 33 7 0.00% 34 14 0.00% 35 12 0.00% 36 22 0.00% 37 23 0.00% 38 21 0.00% 39 31 0.00% 40 41 0.00% 41 41 0.00% 42 40 0.00% 43 46 0.00% 44 63 0.00% 45 71 0.00% 46 82 0.00% 47 82 0.00% 48 95 0.00% 49 116 0.00% 50 140 0.00% 51 135 0.00% 52 188 0.00% 53 197 0.00% 54 213 0.00% 55 229 0.00% 56 229 0.00% 57 303 0.00% 58 317 0.00% 59 408 0.00% 60 472 0.00% 61 556 0.00% 62 617 0.00% 63 733 0.01% 64 745 0.01% 65 894 0.01% 66 954 0.01% 67 1014 0.01% 68 1196 0.01% 69 1272 0.01% 70 1496 0.01% 71 1704 0.01% 72 1994 0.01% 73 2307 0.02% 74 2470 0.02% 75 2938 0.02% 76 3307 0.02% 77 3577 0.03% 78 3807 0.03% 79 4211 0.03% 80 4628 0.03% 81 5150 0.04% 82 5830 0.04% 83 6537 0.05% 84 7697 0.06% 85 8527 0.06% 86 9090 0.07% 87 9563 0.07% 88 10560 0.08% 89 11238 0.08% 90 11696 0.09% 91 12862 0.09% 92 13758 0.10% 93 15314 0.11% 94 16002 0.12% 95 17130 0.13% 96 18405 0.14% 97 18811 0.14% 98 19341 0.14% 99 20266 0.15% 100 21357 0.16% 101 22275 0.16% 102 23557 0.17% 103 25082 0.18% 104 25993 0.19% 105 27698 0.20% 106 28898 0.21% 107 29430 0.22% 108 30050 0.22% 109 30616 0.22% 110 31623 0.23% 111 32243 0.24% 112 33818 0.25% 113 34853 0.26% 114 36145 0.27% 115 37745 0.28% 116 38801 0.28% 117 39781 0.29% 118 40432 0.30% 119 40986 0.30% 120 41622 0.31% 121 42962 0.32% 122 43498 0.32% 123 45134 0.33% 124 46312 0.34% 125 47357 0.35% 126 49217 0.36% 127 50405 0.37% 128 51155 0.38% 129 52390 0.38% 130 53096 0.39% 131 54378 0.40% 132 55478 0.41% 133 56897 0.42% 134 58137 0.43% 135 61245 0.45% 136 63483 0.47% 137 65887 0.48% 138 68390 0.50% 139 70972 0.52% 140 74894 0.55% 141 78838 0.58% 142 84536 0.62% 143 92483 0.68% 144 104749 0.77% 145 122479 0.90% 146 146876 1.08% 147 193586 1.42% 148 289769 2.13% 149 567687 4.17% 150 3057558 22.45% 151 6815863 50.04% 13620628 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=42 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=96.63 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=15.5 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=30 prefix-density=0.26 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=12 fanout-score=46.23 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=12.9 sequence=TGTTGGTGGTGG SRR7169788 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 11 12:15:01 Started mapping on | Apr 11 12:15:01 Finished on | Apr 11 12:16:10 Mapping speed, Million of reads per hour | 710.64 Number of input reads | 13620628 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 11383520 Uniquely mapped reads % | 83.58% Average mapped length | 285.02 Number of splices: Total | 10572775 Number of splices: Annotated (sjdb) | 10393374 Number of splices: GT/AG | 10413153 Number of splices: GC/AG | 123711 Number of splices: AT/AC | 9123 Number of splices: Non-canonical | 26788 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217556 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 13645 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.71% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2028666 2028666 2028666 N_multimapping 217556 217556 217556 N_noFeature 289690 11254377 345594 N_ambiguous 162033 2949 86239 UnstrandedReadsAssigned:10931797 PositiveStrandReadsAssigned:126194 NegativeStrandReadsAssigned:10951687 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169788 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169788-trimmed-pair1.fastq SRR7169788-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,620,628 reads, 12,541,742 reads pseudoaligned [quant] estimated average fragment length: 203.413 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,020 rounds 52401 SRR7169788.ke.tsv 34699 SRR7169788.se.tsv 87100 total ==> SRR7169788.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1815.59 224 10.9375 Potri.005G024800.1.v4.1 1035 832.587 51 5.43036 Potri.004G059700.1.v4.1 961 758.587 1 0.116865 Potri.007G009000.2.v4.1 1416 1213.59 0 0 Potri.003G141000.2.v4.1 2943 2740.59 298.086 9.64242 Potri.016G087400.1.v4.1 270 98.1704 898 810.932 Potri.015G069301.1.v4.1 564 363.104 0 0 Potri.010G195200.1.v4.1 1773 1570.59 17 0.959567 Potri.012G127500.1.v4.1 977 774.587 4803 549.706 ==> SRR7169788.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 977 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169788 completed mapping pipeline successfully