Starting /dee2/code/volunteer_pipeline.sh SRR7169789 current disk space = 3048472662016 free memory = 1454808620 SRR7169789 SRAfilesize 51768a134eb1596e1f5305b3c48c0149 SRR7169789.sra SRR7169789.sra file validated SRR7169789 is paired end SRR7169789 is conventional basespace SRR7169789 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169789_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8575 33.0 33.0 34.0 32.0 34.0 2 33.1775 34.0 33.0 34.0 33.0 34.0 3 33.27025 34.0 33.0 34.0 33.0 34.0 4 33.2205 34.0 33.0 34.0 33.0 34.0 5 33.313 34.0 33.0 34.0 33.0 34.0 6 37.08825 38.0 37.0 38.0 36.0 38.0 7 37.40225 38.0 38.0 38.0 37.0 38.0 8 37.3985 38.0 38.0 38.0 37.0 38.0 9 37.48525 38.0 38.0 38.0 38.0 38.0 10-14 37.56015 38.0 38.0 38.0 38.0 38.0 15-19 37.5162 38.0 38.0 38.0 37.8 38.0 20-24 37.4714 38.0 38.0 38.0 37.8 38.0 25-29 37.53455 38.0 38.0 38.0 38.0 38.0 30-34 37.495900000000006 38.0 38.0 38.0 37.8 38.0 35-39 37.3995 38.0 38.0 38.0 37.4 38.0 40-44 37.33725 38.0 38.0 38.0 37.0 38.0 45-49 37.3694 38.0 38.0 38.0 37.0 38.0 50-54 37.32535 38.0 38.0 38.0 37.0 38.0 55-59 37.1536 38.0 38.0 38.0 36.4 38.0 60-64 37.121050000000004 38.0 38.0 38.0 36.4 38.0 65-69 37.127 38.0 38.0 38.0 36.0 38.0 70-74 37.2137 38.0 38.0 38.0 36.6 38.0 75-79 37.0543 38.0 38.0 38.0 36.0 38.0 80-84 36.941649999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.8118 38.0 38.0 38.0 35.2 38.0 90-94 36.77765 38.0 38.0 38.0 35.2 38.0 95-99 36.81315 38.0 38.0 38.0 35.2 38.0 100-104 36.7705 38.0 38.0 38.0 35.0 38.0 105-109 36.5813 38.0 38.0 38.0 34.6 38.0 110-114 36.3307 38.0 38.0 38.0 34.0 38.0 115-119 36.217650000000006 38.0 37.6 38.0 33.6 38.0 120-124 36.2149 38.0 37.6 38.0 33.6 38.0 125-129 36.11735 38.0 37.8 38.0 33.4 38.0 130-134 35.883500000000005 38.0 37.0 38.0 32.8 38.0 135-139 35.54765 38.0 36.2 38.0 31.4 38.0 140-144 35.07955 38.0 36.0 38.0 29.0 38.0 145-149 34.72105 38.0 35.6 38.0 28.4 38.0 150-151 31.430625 36.5 31.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 2.0 15 2.0 16 2.0 17 1.0 18 1.0 19 3.0 20 2.0 21 2.0 22 2.0 23 7.0 24 9.0 25 6.0 26 20.0 27 15.0 28 17.0 29 22.0 30 39.0 31 34.0 32 70.0 33 95.0 34 120.0 35 226.0 36 529.0 37 2771.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.66566566566567 12.612612612612612 10.135135135135135 36.58658658658659 2 22.6 14.875 33.025 29.5 3 19.7 19.75 25.874999999999996 34.675 4 21.75 28.325 22.05 27.875 5 21.65 32.625 24.275 21.45 6 19.85 36.4 23.925 19.825 7 14.7 28.325 39.35 17.625 8 18.1476846057572 27.359198998748436 31.08886107634543 23.404255319148938 9 16.85 25.775 33.375 24.0 10-14 19.435 30.669999999999998 26.97 22.925 15-19 19.91 29.43 27.46 23.200000000000003 20-24 19.435 30.064999999999998 27.24 23.26 25-29 19.735 29.580000000000002 27.74 22.945 30-34 20.03 29.4 27.169999999999998 23.400000000000002 35-39 19.165 29.365000000000002 27.295 24.175 40-44 19.695 29.195 27.794999999999998 23.315 45-49 19.66 29.215000000000003 27.375 23.75 50-54 19.48 29.404999999999998 27.215 23.9 55-59 19.59 29.654999999999998 27.075 23.68 60-64 19.905 30.020000000000003 26.590000000000003 23.485 65-69 19.71 28.799999999999997 27.894999999999996 23.595 70-74 19.655 29.37 27.36 23.615 75-79 19.805 29.465000000000003 27.565 23.165 80-84 20.22 28.27 28.035 23.474999999999998 85-89 19.75 28.735 27.61 23.905 90-94 19.885 29.555 26.665 23.895 95-99 19.91 29.4 27.310000000000002 23.380000000000003 100-104 20.57 29.235 26.655 23.54 105-109 20.097252857429314 28.35371967114498 27.471425706837778 24.07760176458793 110-114 21.122029479594907 29.033390153414217 26.346134563320966 23.49844580366991 115-119 20.617061706170617 29.242924292429244 26.982698269826983 23.157315731573156 120-124 20.985 28.865000000000002 26.605 23.544999999999998 125-129 20.205000000000002 28.58 26.740000000000002 24.474999999999998 130-134 20.715 28.88 26.88 23.525 135-139 21.06921384276855 28.815763152630524 26.080216043208644 24.034806961392277 140-144 20.671201360408123 28.64859457837351 26.43292987896369 24.247274182254678 145-149 21.305 28.96 25.995 23.74 150-151 20.587867417135712 27.79237023139462 26.641651031894938 24.978111319574733 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 3.0 25 3.5 26 4.5 27 8.0 28 10.5 29 9.5 30 17.5 31 31.0 32 39.5 33 52.5 34 65.5 35 78.0 36 97.5 37 115.0 38 143.5 39 178.0 40 210.5 41 219.5 42 228.0 43 262.0 44 276.0 45 265.0 46 259.5 47 253.5 48 219.5 49 190.5 50 167.0 51 139.0 52 114.0 53 90.5 54 73.0 55 53.5 56 33.0 57 21.5 58 16.5 59 10.5 60 9.0 61 5.5 62 3.5 63 3.5 64 3.5 65 4.0 66 1.5 67 1.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.125 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.26 110-114 0.27 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.02 140-144 0.03 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96438494569337 97.95 2 1.035615054306643 2.0500000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.9624999999999999 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.8625 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.8 0.0 0.0 0.0 0.0 110-111 3.3375 0.0 0.0 0.0 0.0 112-113 3.65 0.0 0.0 0.0 0.0 114-115 4.0625 0.0 0.0 0.0 0.0 116-117 4.4625 0.0 0.0 0.0 0.0 118-119 4.9 0.0 0.0 0.0 0.0 120-121 5.425000000000001 0.0 0.0 0.0 0.0 122-123 5.8125 0.0 0.0 0.0 0.0 124-125 6.525 0.0 0.0 0.0 0.0 126-127 7.05 0.0 0.0 0.0 0.0 128-129 7.5625 0.0 0.0 0.0 0.0 130-131 8.3125 0.0 0.0 0.0 0.0 132-133 8.825 0.0 0.0 0.0 0.0 134-135 9.3875 0.0 0.0 0.0 0.0 136-137 10.3125 0.0 0.0 0.0 0.0 138-139 10.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169789 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169789_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90925 33.0 33.0 34.0 32.0 34.0 2 33.0655 34.0 33.0 34.0 32.0 34.0 3 33.09775 34.0 33.0 34.0 33.0 34.0 4 33.11275 34.0 33.0 34.0 33.0 34.0 5 33.0585 34.0 33.0 34.0 33.0 34.0 6 37.28425 38.0 38.0 38.0 37.0 38.0 7 37.23175 38.0 38.0 38.0 37.0 38.0 8 37.219 38.0 38.0 38.0 37.0 38.0 9 37.279 38.0 38.0 38.0 37.0 38.0 10-14 37.23455 38.0 38.0 38.0 37.0 38.0 15-19 37.139649999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.1207 38.0 38.0 38.0 37.0 38.0 25-29 37.0728 38.0 38.0 38.0 37.0 38.0 30-34 36.94525 38.0 38.0 38.0 36.4 38.0 35-39 36.8406 38.0 38.0 38.0 36.0 38.0 40-44 36.8764 38.0 38.0 38.0 36.2 38.0 45-49 36.91185 38.0 38.0 38.0 36.2 38.0 50-54 36.4801 38.0 38.0 38.0 34.8 38.0 55-59 36.441649999999996 38.0 37.8 38.0 34.2 38.0 60-64 36.74655 38.0 38.0 38.0 35.6 38.0 65-69 36.9191 38.0 38.0 38.0 36.4 38.0 70-74 36.694100000000006 38.0 38.0 38.0 36.2 38.0 75-79 35.8261 38.0 38.0 38.0 34.2 38.0 80-84 36.328900000000004 38.0 38.0 38.0 34.2 38.0 85-89 36.64535 38.0 38.0 38.0 35.8 38.0 90-94 36.6423 38.0 38.0 38.0 35.6 38.0 95-99 36.42855 38.0 38.0 38.0 34.8 38.0 100-104 36.13545 38.0 38.0 38.0 33.8 38.0 105-109 35.3293 38.0 38.0 38.0 31.0 38.0 110-114 33.6462 38.0 36.0 38.0 17.8 38.0 115-119 33.50705 38.0 36.6 38.0 15.0 38.0 120-124 33.742599999999996 38.0 36.0 38.0 19.8 38.0 125-129 34.0087 38.0 36.0 38.0 20.0 38.0 130-134 34.931400000000004 38.0 36.0 38.0 28.0 38.0 135-139 34.63355 38.0 35.6 38.0 27.0 38.0 140-144 33.942899999999995 38.0 34.8 38.0 23.4 38.0 145-149 33.8707 38.0 34.6 38.0 24.6 38.0 150-151 29.58625 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 5.0 5 0.0 6 0.0 7 5.0 8 0.0 9 2.0 10 3.0 11 6.0 12 2.0 13 2.0 14 2.0 15 1.0 16 6.0 17 3.0 18 4.0 19 2.0 20 8.0 21 5.0 22 8.0 23 20.0 24 12.0 25 11.0 26 23.0 27 28.0 28 49.0 29 69.0 30 64.0 31 68.0 32 108.0 33 126.0 34 134.0 35 237.0 36 523.0 37 2452.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.6 21.025 14.674999999999999 27.700000000000003 2 25.7 25.25 30.9 18.15 3 20.25 29.375 31.3 19.075 4 23.275000000000002 33.25 24.4 19.075 5 24.41161742613921 34.3014521782674 23.234852278417627 18.052078117175764 6 22.511255627813906 35.89294647323662 22.836418209104554 18.75937968984492 7 19.950000000000003 22.075 38.550000000000004 19.425 8 24.525 24.325 26.400000000000002 24.75 9 21.8 24.55 30.125 23.525 10-14 23.635 27.994999999999997 26.834999999999997 21.535 15-19 23.57650355248674 27.954568197738418 27.489242469728808 20.979685780046033 20-24 23.782349702157482 27.276367822996445 28.07228312559443 20.86899934925164 25-29 23.53647553287301 27.809466626638645 27.559291504052837 21.094766336435505 30-34 23.066913567889493 28.411991391822234 27.646263950753212 20.87483108953506 35-39 23.126220397536674 28.35828368297201 27.69739147849597 20.818104440995345 40-44 23.76926155693416 27.821693015809483 27.671602961777065 20.73744246547929 45-49 23.24335153002454 27.350127710722695 28.446937446787203 20.95958331246557 50-54 23.50819179317601 27.862117340548124 28.062528182774688 20.567162683501177 55-59 24.055705841098085 27.90301572988679 27.85292054904318 20.188357879971946 60-64 22.94023425768345 28.366202823105418 28.010811893082387 20.68275102612874 65-69 23.8116681677174 27.724407084959473 28.269788852196537 20.19413589512659 70-74 24.12666499120382 27.589846695149532 28.167881377230458 20.115606936416185 75-79 22.99393814856673 27.56087537244426 28.757834172403165 20.687352306585844 80-84 23.832763131414772 27.837593077077884 28.14449587442141 20.18514791708593 85-89 23.572430374674415 27.34421959527149 28.927068723702664 20.15628130635143 90-94 24.148978774529436 27.36784140969163 28.809571485782943 19.673608329995997 95-99 23.684342296329678 27.660107155375297 28.811777076761302 19.843773471533723 100-104 24.703408920258298 27.24633328327577 28.41768033238224 19.6325774640837 105-109 24.18166939443535 27.603314238952535 28.27332242225859 19.94169394435352 110-114 24.15090340698352 27.563185503099668 28.501033222063267 19.78487786785355 115-119 24.76489028213166 27.19705977732137 27.867257593773648 20.17079234677332 120-124 24.85549132947977 27.857029219918335 27.73505859892878 19.55242085167312 125-129 25.5280217482225 27.561689669594315 27.546005855290673 19.364282726892515 130-134 25.405676965586537 27.822155237377544 27.31474503893494 19.45742275810098 135-139 24.79603583762951 27.889283747935334 27.929325792081688 19.38535462235347 140-144 25.055077107951128 28.4197877027839 27.678750250350493 18.846384938914483 145-149 25.932228840282296 27.583963161319385 27.729115571349915 18.7546924270484 150-151 25.850850850850847 28.37837837837838 26.68918918918919 19.08158158158158 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 0.5 25 1.0 26 3.0 27 4.0 28 5.5 29 7.0 30 8.5 31 11.5 32 14.0 33 25.0 34 44.5 35 55.0 36 75.0 37 117.0 38 144.0 39 173.5 40 213.0 41 237.5 42 260.5 43 288.0 44 302.5 45 282.5 46 262.5 47 255.5 48 243.0 49 207.0 50 170.5 51 146.0 52 112.5 53 93.0 54 73.5 55 49.0 56 31.5 57 19.5 58 16.0 59 11.0 60 7.5 61 6.5 62 4.0 63 4.0 64 3.5 65 2.0 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.15 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.06999999999999999 20-24 0.11499999999999999 25-29 0.06999999999999999 30-34 0.095 35-39 0.135 40-44 0.06 45-49 0.165 50-54 0.20500000000000002 55-59 0.19 60-64 0.11 65-69 0.06999999999999999 70-74 0.525 75-79 2.67 80-84 0.62 85-89 0.18 90-94 0.12 95-99 0.145 100-104 0.11499999999999999 105-109 2.2399999999999998 110-114 5.635 115-119 7.489999999999999 120-124 5.715 125-129 4.36 130-134 0.475 135-139 0.105 140-144 0.13999999999999999 145-149 0.105 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19354838709677 98.4 2 0.8064516129032258 1.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0125 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0125 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.037500000000000006 0.0 0.0 0.025 0.0 62-63 0.05 0.0 0.0 0.025 0.0 64-65 0.05 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.0625 0.0 0.0 0.025 0.0 70-71 0.075 0.0 0.0 0.025 0.0 72-73 0.0875 0.0 0.0 0.025 0.0 74-75 0.1 0.0 0.0 0.025 0.0 76-77 0.125 0.0 0.0 0.025 0.0 78-79 0.175 0.0 0.0 0.025 0.0 80-81 0.2375 0.0 0.0 0.025 0.0 82-83 0.3125 0.0 0.0 0.025 0.0 84-85 0.4125 0.0 0.0 0.025 0.0 86-87 0.5125 0.0 0.0 0.025 0.0 88-89 0.625 0.0 0.0 0.025 0.0 90-91 0.7625 0.0 0.0 0.025 0.0 92-93 0.85 0.0 0.0 0.025 0.0 94-95 1.0125 0.0 0.0 0.025 0.0 96-97 1.25 0.0 0.0 0.025 0.0 98-99 1.4 0.0 0.0 0.025 0.0 100-101 1.6375000000000002 0.0 0.0 0.025 0.0 102-103 1.9 0.0 0.0 0.025 0.0 104-105 2.1875 0.0 0.0 0.025 0.0 106-107 2.4875 0.0 0.0 0.025 0.0 108-109 2.7750000000000004 0.0 0.0 0.025 0.0 110-111 3.2249999999999996 0.0 0.0 0.025 0.0 112-113 3.55 0.0 0.0 0.025 0.0 114-115 3.9875 0.0 0.0 0.025 0.0 116-117 4.3625 0.0 0.0 0.025 0.0 118-119 4.725 0.0 0.0 0.025 0.0 120-121 5.2125 0.0 0.0 0.025 0.0 122-123 5.6 0.0 0.0 0.025 0.0 124-125 6.262499999999999 0.0 0.0 0.025 0.0 126-127 6.7875 0.0 0.0 0.025 0.0 128-129 7.262499999999999 0.0 0.0 0.025 0.0 130-131 7.975 0.0 0.0 0.025 0.0 132-133 8.475 0.0 0.0 0.025 0.0 134-135 9.0625 0.0 0.0 0.025 0.0 136-137 9.9125 0.0 0.0 0.025 0.0 138-139 10.55 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552994 spots for SRR7169789.sra Written 552994 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra Read 552986 spots for SRR7169789.sra Written 552986 spots for SRR7169789.sra SRR ids: ['SRR7169789.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_umw8rnay SRR7169789.sra spots: 11059728 blocks: [[1, 552986], [552987, 1105972], [1105973, 1658958], [1658959, 2211944], [2211945, 2764930], [2764931, 3317916], [3317917, 3870902], [3870903, 4423888], [4423889, 4976874], [4976875, 5529860], [5529861, 6082846], [6082847, 6635832], [6635833, 7188818], [7188819, 7741804], [7741805, 8294790], [8294791, 8847776], [8847777, 9400762], [9400763, 9953748], [9953749, 10506734], [10506735, 11059728]] SRR7169789 file size 3726078 SRR7169789 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169789 SRR7169789_1.fastq SRR7169789_2.fastq Input file: SRR7169789_1.fastq Paired file: SRR7169789_2.fastq trimmed: SRR7169789-trimmed-pair1.fastq, SRR7169789-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:00:00 2025 >> started Tue Feb 11 17:00:16 2025 >> done (15.735s) 11059728 read pairs processed; of these: 15866 ( 0.14%) short read pairs filtered out after trimming by size control 15042 ( 0.14%) empty read pairs filtered out after trimming by size control 11028820 (99.72%) read pairs available; of these: 5104742 (46.29%) trimmed read pairs available after processing 5924078 (53.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 0 0.00% 21 2 0.00% 22 5 0.00% 23 4 0.00% 24 5 0.00% 25 8 0.00% 26 10 0.00% 27 9 0.00% 28 9 0.00% 29 10 0.00% 30 3 0.00% 31 14 0.00% 32 4 0.00% 33 14 0.00% 34 7 0.00% 35 12 0.00% 36 9 0.00% 37 12 0.00% 38 10 0.00% 39 17 0.00% 40 20 0.00% 41 19 0.00% 42 23 0.00% 43 26 0.00% 44 22 0.00% 45 37 0.00% 46 42 0.00% 47 42 0.00% 48 51 0.00% 49 50 0.00% 50 56 0.00% 51 74 0.00% 52 89 0.00% 53 95 0.00% 54 99 0.00% 55 121 0.00% 56 149 0.00% 57 180 0.00% 58 148 0.00% 59 184 0.00% 60 237 0.00% 61 253 0.00% 62 282 0.00% 63 331 0.00% 64 358 0.00% 65 459 0.00% 66 501 0.00% 67 531 0.00% 68 614 0.01% 69 674 0.01% 70 748 0.01% 71 867 0.01% 72 1025 0.01% 73 1241 0.01% 74 1435 0.01% 75 1498 0.01% 76 1770 0.02% 77 2026 0.02% 78 2107 0.02% 79 2222 0.02% 80 2539 0.02% 81 2857 0.03% 82 3331 0.03% 83 3767 0.03% 84 4823 0.04% 85 5592 0.05% 86 5883 0.05% 87 6455 0.06% 88 6774 0.06% 89 7246 0.07% 90 7739 0.07% 91 8318 0.08% 92 8990 0.08% 93 9904 0.09% 94 10645 0.10% 95 11490 0.10% 96 12214 0.11% 97 12807 0.12% 98 13247 0.12% 99 13937 0.13% 100 14865 0.13% 101 15645 0.14% 102 16677 0.15% 103 17977 0.16% 104 19029 0.17% 105 20124 0.18% 106 21188 0.19% 107 21571 0.20% 108 22386 0.20% 109 23251 0.21% 110 23573 0.21% 111 24864 0.23% 112 25834 0.23% 113 27207 0.25% 114 28453 0.26% 115 29766 0.27% 116 30925 0.28% 117 31469 0.29% 118 31747 0.29% 119 32499 0.29% 120 32834 0.30% 121 33859 0.31% 122 34938 0.32% 123 36034 0.33% 124 38031 0.34% 125 38624 0.35% 126 40530 0.37% 127 41448 0.38% 128 42625 0.39% 129 42708 0.39% 130 43186 0.39% 131 43780 0.40% 132 45349 0.41% 133 47292 0.43% 134 49197 0.45% 135 50468 0.46% 136 52268 0.47% 137 53757 0.49% 138 56943 0.52% 139 58589 0.53% 140 62551 0.57% 141 65200 0.59% 142 68584 0.62% 143 74736 0.68% 144 83220 0.75% 145 95175 0.86% 146 112544 1.02% 147 144650 1.31% 148 207715 1.88% 149 392467 3.56% 150 2256957 20.46% 151 5924078 53.71% 11028820 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=31 prefix-density=0.26 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=36 fanout-score=143.07 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=13.7 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=42 prefix-density=0.27 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=13 fanout-score=44.58 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=12.0 sequence=TGTTGGTGGTGG SRR7169789 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:00:57 Started mapping on | Feb 11 17:00:57 Finished on | Feb 11 17:01:54 Mapping speed, Million of reads per hour | 696.56 Number of input reads | 11028820 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 10581215 Uniquely mapped reads % | 95.94% Average mapped length | 291.16 Number of splices: Total | 9166602 Number of splices: Annotated (sjdb) | 9013460 Number of splices: GT/AG | 9036999 Number of splices: GC/AG | 102240 Number of splices: AT/AC | 8151 Number of splices: Non-canonical | 19212 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 181421 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 11948 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.27% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 278530 278530 278530 N_multimapping 181421 181421 181421 N_noFeature 250761 10450529 298925 N_ambiguous 124891 594 41988 UnstrandedReadsAssigned:10205563 PositiveStrandReadsAssigned:130092 NegativeStrandReadsAssigned:10240302 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169789 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169789-trimmed-pair1.fastq SRR7169789-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,028,820 reads, 10,189,387 reads pseudoaligned [quant] estimated average fragment length: 212.729 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 982 rounds 52401 SRR7169789.ke.tsv 34699 SRR7169789.se.tsv 87100 total ==> SRR7169789.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.27 206 11.142 Potri.005G024800.1.v4.1 1035 823.271 50 5.93346 Potri.004G059700.1.v4.1 961 749.277 3 0.391165 Potri.007G009000.2.v4.1 1416 1204.27 0 0 Potri.003G141000.2.v4.1 2943 2731.27 138 4.93623 Potri.016G087400.1.v4.1 270 90.9567 991.565 1065.04 Potri.015G069301.1.v4.1 564 354.14 0 0 Potri.010G195200.1.v4.1 1773 1561.27 14 0.876053 Potri.012G127500.1.v4.1 977 765.277 3183 406.349 ==> SRR7169789.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 859 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 187 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169789 completed mapping pipeline successfully