Starting /dee2/code/volunteer_pipeline.sh SRR7169790 current disk space = 3053420097536 free memory = 1578575268 SRR7169790 SRAfilesize f983658cd35d1e780c31243e9c264d2a SRR7169790.sra SRR7169790.sra file validated SRR7169790 is paired end SRR7169790 is conventional basespace SRR7169790 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169790_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.35375 18.0 18.0 30.0 18.0 32.0 2 29.6785 30.0 29.0 31.0 27.0 33.0 3 31.2985 33.0 31.0 33.0 29.0 33.0 4 32.342 33.0 33.0 33.0 31.0 33.0 5 33.07825 33.0 33.0 34.0 33.0 34.0 6 37.13625 38.0 37.0 38.0 36.0 38.0 7 37.44025 38.0 38.0 38.0 37.0 38.0 8 37.64175 38.0 38.0 38.0 38.0 38.0 9 37.69075 38.0 38.0 38.0 38.0 38.0 10-14 37.669650000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.66165 38.0 38.0 38.0 38.0 38.0 20-24 37.6856 38.0 38.0 38.0 38.0 38.0 25-29 37.64725 38.0 38.0 38.0 38.0 38.0 30-34 37.611599999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.51405 38.0 38.0 38.0 37.8 38.0 40-44 37.512550000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.49975 38.0 38.0 38.0 37.2 38.0 50-54 37.269850000000005 38.0 38.0 38.0 36.4 38.0 55-59 37.378550000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.35359999999999 38.0 38.0 38.0 36.8 38.0 65-69 37.0025 38.0 38.0 38.0 35.8 38.0 70-74 37.2018 38.0 38.0 38.0 36.0 38.0 75-79 37.12205 38.0 38.0 38.0 36.0 38.0 80-84 36.93035 38.0 38.0 38.0 35.6 38.0 85-89 36.8685 38.0 38.0 38.0 35.4 38.0 90-94 36.8972 38.0 38.0 38.0 35.6 38.0 95-99 36.7367 38.0 38.0 38.0 34.8 38.0 100-104 36.637 38.0 38.0 38.0 34.2 38.0 105-109 36.55865000000001 38.0 38.0 38.0 34.4 38.0 110-114 36.2721 38.0 37.4 38.0 33.8 38.0 115-119 35.61895 38.0 36.4 38.0 30.4 38.0 120-124 36.2464 38.0 37.0 38.0 34.0 38.0 125-129 35.30915 38.0 35.4 38.0 27.6 38.0 130-134 35.23315000000001 38.0 35.4 38.0 29.2 38.0 135-139 35.517399999999995 38.0 36.0 38.0 31.0 38.0 140-144 34.81105 38.0 35.2 38.0 28.6 38.0 145-149 34.35145 38.0 35.0 38.0 27.2 38.0 150-151 30.558125 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 2.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 4.0 19 4.0 20 2.0 21 2.0 22 3.0 23 7.0 24 7.0 25 4.0 26 4.0 27 5.0 28 12.0 29 21.0 30 28.0 31 39.0 32 63.0 33 79.0 34 169.0 35 336.0 36 986.0 37 2220.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.047426841574165 9.58627648839556 15.893037336024218 41.47325933400605 2 21.8 14.95 33.575 29.675 3 22.125 18.275 23.525 36.075 4 23.724999999999998 26.8 21.55 27.925 5 23.325000000000003 32.225 25.275 19.175 6 20.075000000000003 35.575 23.724999999999998 20.625 7 14.2 26.35 42.05 17.4 8 19.125 25.85 31.2 23.825 9 18.0 24.3 33.324999999999996 24.375 10-14 19.89 29.794999999999998 26.919999999999998 23.395 15-19 19.744999999999997 28.975 27.779999999999998 23.5 20-24 19.935 28.720000000000002 27.32 24.025 25-29 20.549999999999997 28.634999999999998 27.584999999999997 23.23 30-34 20.369999999999997 29.595 27.35 22.685 35-39 19.975 29.599999999999998 26.625 23.799999999999997 40-44 20.155 28.060000000000002 27.950000000000003 23.835 45-49 19.73 28.765 28.000000000000004 23.505000000000003 50-54 20.365 28.87 27.650000000000002 23.115 55-59 20.330000000000002 28.945 27.439999999999998 23.285 60-64 20.305 28.04 27.73 23.925 65-69 20.355 28.735 27.595 23.315 70-74 20.880000000000003 28.88 27.034999999999997 23.205000000000002 75-79 20.315 28.660000000000004 27.85 23.175 80-84 20.31 28.305000000000003 27.485 23.9 85-89 20.68 28.915000000000003 27.265 23.14 90-94 20.34 29.015 27.355 23.29 95-99 21.125 28.494999999999997 27.62 22.759999999999998 100-104 20.474999999999998 29.375 26.715 23.435 105-109 20.76 28.27 27.694999999999997 23.275000000000002 110-114 21.004520341536917 28.427925665494726 27.31290808638875 23.254645906579608 115-119 20.645 29.24 26.889999999999997 23.225 120-124 20.95 28.084999999999997 27.22 23.745 125-129 20.49 28.689999999999998 26.8 24.02 130-134 21.66 27.839999999999996 27.16 23.34 135-139 20.665 28.955 26.57 23.810000000000002 140-144 20.97 29.115000000000002 26.575 23.34 145-149 21.305 29.32 25.965 23.41 150-151 20.4125 29.849999999999998 25.974999999999998 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 0.5 24 2.5 25 2.5 26 3.0 27 7.0 28 10.0 29 13.0 30 17.0 31 25.0 32 32.5 33 40.0 34 53.5 35 65.0 36 81.5 37 101.5 38 133.0 39 164.0 40 180.0 41 222.0 42 253.5 43 255.5 44 271.5 45 275.0 46 272.0 47 277.0 48 254.5 49 207.5 50 165.0 51 133.5 52 106.5 53 94.0 54 77.5 55 48.0 56 33.5 57 30.0 58 23.5 59 19.0 60 13.0 61 6.5 62 7.5 63 5.0 64 3.0 65 3.0 66 1.0 67 1.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.44999999999999996 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52213279678068 98.925 2 0.45271629778672035 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025150905432595575 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.2374999999999998 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.8125 0.0 0.0 0.0 0.0 102-103 2.1875 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.675 0.0 0.0 0.0 0.0 108-109 3.0375 0.0 0.0 0.0 0.0 110-111 3.625 0.0 0.0 0.0 0.0 112-113 4.0125 0.0 0.0 0.0 0.0 114-115 4.324999999999999 0.0 0.0 0.0 0.0 116-117 4.6875 0.0 0.0 0.0 0.0 118-119 5.0125 0.0 0.0 0.0 0.0 120-121 5.5375 0.0 0.0 0.0 0.0 122-123 6.1875 0.0 0.0 0.0 0.0 124-125 6.7125 0.0 0.0 0.0 0.0 126-127 7.3375 0.0 0.0 0.0 0.0 128-129 8.1625 0.0 0.0 0.0 0.0 130-131 8.9375 0.0 0.0 0.0 0.0 132-133 9.524999999999999 0.0 0.0 0.0 0.0 134-135 10.125 0.0 0.0 0.0 0.0 136-137 10.787500000000001 0.0 0.0 0.0 0.0 138-139 11.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGTTC 10 0.0068449317 144.90001 8 >>END_MODULE SRR7169790 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169790_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86325 33.0 33.0 34.0 32.0 34.0 2 33.0475 33.0 33.0 34.0 33.0 34.0 3 32.45575 33.0 33.0 34.0 31.0 34.0 4 32.51475 33.0 33.0 34.0 32.0 34.0 5 33.009 33.0 33.0 34.0 32.0 34.0 6 37.44575 38.0 38.0 38.0 38.0 38.0 7 37.34275 38.0 38.0 38.0 38.0 38.0 8 37.535 38.0 38.0 38.0 38.0 38.0 9 37.47575 38.0 38.0 38.0 38.0 38.0 10-14 37.464999999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.48604999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.03830000000001 38.0 38.0 38.0 35.6 38.0 25-29 37.410000000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.42790000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.41855 38.0 38.0 38.0 38.0 38.0 40-44 37.381099999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.39265 38.0 38.0 38.0 38.0 38.0 50-54 37.36105 38.0 38.0 38.0 38.0 38.0 55-59 37.2763 38.0 38.0 38.0 37.8 38.0 60-64 37.11635 38.0 38.0 38.0 36.8 38.0 65-69 37.10095 38.0 38.0 38.0 36.8 38.0 70-74 37.1415 38.0 38.0 38.0 37.0 38.0 75-79 36.790000000000006 38.0 38.0 38.0 36.4 38.0 80-84 36.4715 38.0 37.8 38.0 34.4 38.0 85-89 36.92805 38.0 38.0 38.0 36.0 38.0 90-94 37.0429 38.0 38.0 38.0 36.8 38.0 95-99 36.92960000000001 38.0 38.0 38.0 36.2 38.0 100-104 36.714150000000004 38.0 38.0 38.0 35.6 38.0 105-109 35.54365 38.0 37.2 38.0 31.0 38.0 110-114 35.2032 38.0 37.8 38.0 31.4 38.0 115-119 34.5165 38.0 37.4 38.0 26.6 38.0 120-124 34.47925 38.0 37.0 38.0 25.8 38.0 125-129 34.5475 38.0 36.8 38.0 26.4 38.0 130-134 35.2483 38.0 36.0 38.0 30.0 38.0 135-139 35.506 38.0 36.2 38.0 31.4 38.0 140-144 35.2539 38.0 36.0 38.0 31.0 38.0 145-149 34.55435 38.0 35.4 38.0 29.2 38.0 150-151 30.2195 35.5 28.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 2.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 4.0 15 2.0 16 2.0 17 1.0 18 3.0 19 4.0 20 9.0 21 2.0 22 5.0 23 6.0 24 11.0 25 11.0 26 12.0 27 16.0 28 14.0 29 35.0 30 45.0 31 54.0 32 67.0 33 109.0 34 133.0 35 213.0 36 570.0 37 2652.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.125 17.05 21.85 31.974999999999998 2 24.9 25.825 30.925000000000004 18.35 3 21.175 27.275 30.325000000000003 21.224999999999998 4 23.175 32.324999999999996 24.275 20.225 5 25.275 33.95 23.849999999999998 16.925 6 20.45 38.65 23.1 17.8 7 18.425 19.925 41.05 20.599999999999998 8 21.3 25.324999999999996 27.950000000000003 25.424999999999997 9 22.875 24.55 30.349999999999998 22.225 10-14 23.96 29.15 25.89 21.0 15-19 22.615 27.744999999999997 28.285 21.355 20-24 22.6 27.435 28.544999999999998 21.42 25-29 22.975 27.76 28.12 21.145 30-34 23.07 27.889999999999997 28.050000000000004 20.990000000000002 35-39 23.24 27.735 27.88 21.145 40-44 23.1 27.99 27.905 21.005 45-49 22.64 27.67 28.599999999999998 21.09 50-54 23.119999999999997 28.655 27.76 20.465 55-59 22.73 27.860000000000003 28.139999999999997 21.27 60-64 23.44 27.42 28.24 20.9 65-69 22.96 27.765 28.21 21.065 70-74 23.54 28.465 27.655 20.34 75-79 22.82356501563603 28.1297286391607 28.41722990013114 20.62947644507213 80-84 23.57135683438787 28.151049512905495 27.598674299487797 20.67891935321884 85-89 23.830000000000002 27.534999999999997 28.194999999999997 20.44 90-94 23.544999999999998 28.23 27.584999999999997 20.64 95-99 23.7 27.73 28.139999999999997 20.43 100-104 23.590615777099693 27.607423340503228 28.077634935721075 20.724325946676004 105-109 23.449456302859446 28.05074506645187 27.84937575513492 20.650422875553765 110-114 24.427441451687947 27.415602543555806 27.575867238794395 20.581088765961848 115-119 24.758587937312015 27.592211492797215 28.193762862118092 19.455437707772678 120-124 24.428877620366983 28.17188561869413 27.507972188823253 19.891264572115634 125-129 24.626787764902392 28.36934961895814 27.006994467063368 19.996868149076104 130-134 24.629050166548904 28.09124861209246 26.99101645301302 20.288684768345615 135-139 24.759999999999998 28.470000000000002 27.205000000000002 19.564999999999998 140-144 25.06 27.67 27.36 19.91 145-149 25.715 27.91 27.235 19.139999999999997 150-151 25.337500000000002 28.3375 26.687499999999996 19.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 2.5 26 2.0 27 2.0 28 4.0 29 6.5 30 9.0 31 17.0 32 25.0 33 32.0 34 55.0 35 66.0 36 77.0 37 112.0 38 141.0 39 162.0 40 206.0 41 248.0 42 258.5 43 274.5 44 281.0 45 274.0 46 284.0 47 282.5 48 249.0 49 193.5 50 157.5 51 144.0 52 115.5 53 86.5 54 65.0 55 42.5 56 32.0 57 24.5 58 14.0 59 10.5 60 10.0 61 8.5 62 5.0 63 5.0 64 3.5 65 2.5 66 2.0 67 1.0 68 0.5 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.8699999999999999 80-84 0.43 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.045 105-109 0.6799999999999999 110-114 3.2849999999999997 115-119 5.244999999999999 120-124 4.3549999999999995 125-129 4.21 130-134 0.9299999999999999 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4778672032193159 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025150905432595575 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.2625000000000002 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.8624999999999998 0.0 0.0 0.0 0.0 102-103 2.2125000000000004 0.0 0.0 0.0 0.0 104-105 2.4749999999999996 0.0 0.0 0.0 0.0 106-107 2.7375 0.0 0.0 0.0 0.0 108-109 3.1125 0.0 0.0 0.0 0.0 110-111 3.625 0.0 0.0 0.0 0.0 112-113 4.025 0.0 0.0 0.0 0.0 114-115 4.3625 0.0 0.0 0.0 0.0 116-117 4.699999999999999 0.0 0.0 0.0 0.0 118-119 5.0 0.0 0.0 0.0 0.0 120-121 5.45 0.0 0.0 0.0 0.0 122-123 6.0625 0.0 0.0 0.0 0.0 124-125 6.575 0.0 0.0 0.0 0.0 126-127 7.1625 0.0 0.0 0.0 0.0 128-129 7.925 0.0 0.0 0.0 0.0 130-131 8.662500000000001 0.0 0.0 0.0 0.0 132-133 9.1875 0.0 0.0 0.0 0.0 134-135 9.775 0.0 0.0 0.0 0.0 136-137 10.462499999999999 0.0 0.0 0.0 0.0 138-139 11.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra Read 586019 spots for SRR7169790.sra Written 586019 spots for SRR7169790.sra SRR ids: ['SRR7169790.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_esyjv33s SRR7169790.sra spots: 11720380 blocks: [[1, 586019], [586020, 1172038], [1172039, 1758057], [1758058, 2344076], [2344077, 2930095], [2930096, 3516114], [3516115, 4102133], [4102134, 4688152], [4688153, 5274171], [5274172, 5860190], [5860191, 6446209], [6446210, 7032228], [7032229, 7618247], [7618248, 8204266], [8204267, 8790285], [8790286, 9376304], [9376305, 9962323], [9962324, 10548342], [10548343, 11134361], [11134362, 11720380]] SRR7169790 file size 3949951 SRR7169790 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169790 SRR7169790_1.fastq SRR7169790_2.fastq Input file: SRR7169790_1.fastq Paired file: SRR7169790_2.fastq trimmed: SRR7169790-trimmed-pair1.fastq, SRR7169790-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:51:29 2025 >> started Tue Feb 11 18:51:41 2025 >> done (12.728s) 11720380 read pairs processed; of these: 12422 ( 0.11%) short read pairs filtered out after trimming by size control 47944 ( 0.41%) empty read pairs filtered out after trimming by size control 11660014 (99.48%) read pairs available; of these: 5708699 (48.96%) trimmed read pairs available after processing 5951315 (51.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 8 0.00% 21 8 0.00% 22 8 0.00% 23 7 0.00% 24 9 0.00% 25 5 0.00% 26 9 0.00% 27 6 0.00% 28 3 0.00% 29 7 0.00% 30 8 0.00% 31 28 0.00% 32 10 0.00% 33 32 0.00% 34 28 0.00% 35 17 0.00% 36 43 0.00% 37 23 0.00% 38 29 0.00% 39 36 0.00% 40 42 0.00% 41 53 0.00% 42 43 0.00% 43 53 0.00% 44 60 0.00% 45 53 0.00% 46 77 0.00% 47 75 0.00% 48 77 0.00% 49 105 0.00% 50 121 0.00% 51 142 0.00% 52 179 0.00% 53 202 0.00% 54 198 0.00% 55 210 0.00% 56 206 0.00% 57 275 0.00% 58 317 0.00% 59 358 0.00% 60 395 0.00% 61 613 0.01% 62 579 0.00% 63 644 0.01% 64 655 0.01% 65 656 0.01% 66 738 0.01% 67 868 0.01% 68 973 0.01% 69 1094 0.01% 70 1177 0.01% 71 1327 0.01% 72 1667 0.01% 73 1942 0.02% 74 2202 0.02% 75 2454 0.02% 76 3127 0.03% 77 3558 0.03% 78 3306 0.03% 79 3354 0.03% 80 3813 0.03% 81 4200 0.04% 82 4819 0.04% 83 5235 0.04% 84 6454 0.06% 85 7330 0.06% 86 7636 0.07% 87 8260 0.07% 88 8777 0.08% 89 9291 0.08% 90 10059 0.09% 91 10746 0.09% 92 11307 0.10% 93 12209 0.10% 94 13322 0.11% 95 14236 0.12% 96 15174 0.13% 97 16312 0.14% 98 16389 0.14% 99 17323 0.15% 100 17903 0.15% 101 18811 0.16% 102 19858 0.17% 103 21057 0.18% 104 22213 0.19% 105 23199 0.20% 106 24483 0.21% 107 25104 0.22% 108 25969 0.22% 109 26826 0.23% 110 27591 0.24% 111 28166 0.24% 112 29033 0.25% 113 29965 0.26% 114 31482 0.27% 115 32492 0.28% 116 33413 0.29% 117 34590 0.30% 118 35359 0.30% 119 36254 0.31% 120 36381 0.31% 121 37645 0.32% 122 38062 0.33% 123 38906 0.33% 124 40340 0.35% 125 41446 0.36% 126 42796 0.37% 127 44002 0.38% 128 44780 0.38% 129 45906 0.39% 130 47201 0.40% 131 47573 0.41% 132 48090 0.41% 133 49586 0.43% 134 50639 0.43% 135 51842 0.44% 136 54028 0.46% 137 56337 0.48% 138 58954 0.51% 139 60686 0.52% 140 63420 0.54% 141 68117 0.58% 142 72888 0.63% 143 76435 0.66% 144 86478 0.74% 145 100599 0.86% 146 118493 1.02% 147 159038 1.36% 148 234267 2.01% 149 471118 4.04% 150 2541479 21.80% 151 5951315 51.04% 11660014 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=42 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=94.57 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.4 sequence=ATATTCATCATAACTCAATTACATTATTCCCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=32 prefix-density=0.30 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=48.36 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=12.9 sequence=TGTTGGTGGTGG SRR7169790 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:52:23 Started mapping on | Feb 11 18:52:23 Finished on | Feb 11 18:53:20 Mapping speed, Million of reads per hour | 736.42 Number of input reads | 11660014 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11300507 Uniquely mapped reads % | 96.92% Average mapped length | 290.40 Number of splices: Total | 10321383 Number of splices: Annotated (sjdb) | 10148469 Number of splices: GT/AG | 10179575 Number of splices: GC/AG | 113850 Number of splices: AT/AC | 8476 Number of splices: Non-canonical | 19482 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 196739 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 28765 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 171421 171421 171421 N_multimapping 196739 196739 196739 N_noFeature 273180 11174251 329784 N_ambiguous 112137 558 42093 UnstrandedReadsAssigned:10915190 PositiveStrandReadsAssigned:125698 NegativeStrandReadsAssigned:10928630 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169790 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169790-trimmed-pair1.fastq SRR7169790-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,660,014 reads, 10,869,037 reads pseudoaligned [quant] estimated average fragment length: 212.406 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52401 SRR7169790.ke.tsv 34699 SRR7169790.se.tsv 87100 total ==> SRR7169790.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.59 171 9.34285 Potri.005G024800.1.v4.1 1035 823.594 25 2.9962 Potri.004G059700.1.v4.1 961 749.608 2 0.263354 Potri.007G009000.2.v4.1 1416 1204.59 0 0 Potri.003G141000.2.v4.1 2943 2731.59 214 7.73289 Potri.016G087400.1.v4.1 270 92.8155 1214 1291.05 Potri.015G069301.1.v4.1 564 354.731 0 0 Potri.010G195200.1.v4.1 1773 1561.59 2 0.126417 Potri.012G127500.1.v4.1 977 765.594 3560 458.982 ==> SRR7169790.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 874 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 176 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169790 completed mapping pipeline successfully