Starting /dee2/code/volunteer_pipeline.sh SRR7169791 current disk space = 3050742460416 free memory = 1515612724 SRR7169791 SRAfilesize 421247e2e7a7630e76358ebefc846829 SRR7169791.sra SRR7169791.sra file validated SRR7169791 is paired end SRR7169791 is conventional basespace SRR7169791 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169791_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79975 33.0 33.0 34.0 32.0 34.0 2 33.16875 34.0 33.0 34.0 32.0 34.0 3 33.22875 34.0 33.0 34.0 33.0 34.0 4 33.1675 34.0 33.0 34.0 33.0 34.0 5 33.268 34.0 33.0 34.0 33.0 34.0 6 37.0725 38.0 37.0 38.0 36.0 38.0 7 37.35825 38.0 38.0 38.0 37.0 38.0 8 37.28225 38.0 38.0 38.0 37.0 38.0 9 37.4135 38.0 38.0 38.0 37.0 38.0 10-14 37.502199999999995 38.0 38.0 38.0 37.8 38.0 15-19 37.46295 38.0 38.0 38.0 37.4 38.0 20-24 37.404700000000005 38.0 38.0 38.0 37.2 38.0 25-29 37.4893 38.0 38.0 38.0 37.4 38.0 30-34 37.4335 38.0 38.0 38.0 37.4 38.0 35-39 37.327400000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.26895 38.0 38.0 38.0 37.0 38.0 45-49 37.31965 38.0 38.0 38.0 37.0 38.0 50-54 37.252649999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.0775 38.0 38.0 38.0 36.2 38.0 60-64 36.99005 38.0 38.0 38.0 35.6 38.0 65-69 37.08145 38.0 38.0 38.0 36.0 38.0 70-74 37.153549999999996 38.0 38.0 38.0 36.2 38.0 75-79 36.978849999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.851099999999995 38.0 38.0 38.0 35.4 38.0 85-89 36.7167 38.0 38.0 38.0 34.6 38.0 90-94 36.697199999999995 38.0 38.0 38.0 34.8 38.0 95-99 36.69035 38.0 38.0 38.0 34.8 38.0 100-104 36.6052 38.0 38.0 38.0 34.4 38.0 105-109 36.422250000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.15235 38.0 37.8 38.0 33.6 38.0 115-119 36.10835 38.0 37.4 38.0 33.2 38.0 120-124 36.0509 38.0 37.0 38.0 33.0 38.0 125-129 35.9318 38.0 37.0 38.0 32.8 38.0 130-134 35.6081 38.0 36.4 38.0 31.8 38.0 135-139 35.2766 38.0 35.8 38.0 30.4 38.0 140-144 34.74595 38.0 35.2 38.0 27.4 38.0 145-149 34.38645 38.0 35.0 38.0 27.6 38.0 150-151 30.849125 36.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 3.0 16 3.0 17 0.0 18 4.0 19 1.0 20 5.0 21 2.0 22 6.0 23 5.0 24 9.0 25 7.0 26 14.0 27 15.0 28 24.0 29 30.0 30 37.0 31 60.0 32 74.0 33 80.0 34 140.0 35 254.0 36 597.0 37 2626.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.61241862794191 12.093139709564346 8.5628442663996 37.73159739609414 2 22.375 16.150000000000002 35.25 26.224999999999998 3 18.45 21.75 26.1 33.7 4 22.05 31.3 22.425 24.224999999999998 5 22.075 33.575 25.025 19.325 6 19.975 35.325 25.174999999999997 19.525000000000002 7 15.25 25.224999999999998 41.199999999999996 18.325 8 18.39799749687109 25.481852315394242 31.013767209011263 25.106382978723403 9 17.724999999999998 24.875 33.025 24.375 10-14 19.98 29.645 27.089999999999996 23.285 15-19 20.16 29.12 27.700000000000003 23.02 20-24 20.015 29.34 27.43 23.215 25-29 20.015 28.185 27.800000000000004 24.0 30-34 19.915 29.065 27.76 23.26 35-39 20.330000000000002 28.935 27.595 23.14 40-44 20.419999999999998 29.32 26.815 23.445 45-49 20.29 28.785 27.42 23.505000000000003 50-54 20.16 29.365000000000002 27.339999999999996 23.135 55-59 20.105 29.12 27.084999999999997 23.69 60-64 19.74 28.78 28.425 23.055 65-69 20.105 29.2 27.51 23.185 70-74 20.200000000000003 29.345 27.400000000000002 23.055 75-79 20.565 28.7 27.42 23.315 80-84 20.325 28.985 27.445000000000004 23.244999999999997 85-89 20.44 28.7 27.685 23.175 90-94 20.49 28.77 27.715 23.025000000000002 95-99 20.97 28.705000000000002 27.12 23.205000000000002 100-104 20.825 28.715000000000003 26.979999999999997 23.48 105-109 21.116517028640217 28.660279881627126 26.829512965842405 23.393690123890252 110-114 20.97810805382607 28.504719823257684 27.25446876882908 23.262703354087165 115-119 20.94104705235262 29.361468073403667 26.631331566578332 23.06615330766538 120-124 21.41 28.470000000000002 26.69 23.43 125-129 20.335 29.025000000000002 26.85 23.79 130-134 20.95 28.754999999999995 26.450000000000003 23.845 135-139 21.524304860972194 28.640728145629126 26.350270054010807 23.484696939387877 140-144 21.016304891467442 28.97369210763229 26.387916374912475 23.622086625987794 145-149 20.78 28.470000000000002 26.8 23.95 150-151 20.865108138517314 28.20352544068008 27.078384798099762 23.85298162270284 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 1.5 23 2.0 24 2.0 25 4.0 26 5.5 27 7.0 28 10.0 29 12.0 30 20.0 31 31.0 32 38.0 33 49.5 34 60.5 35 68.5 36 91.5 37 106.0 38 114.0 39 142.5 40 179.0 41 210.0 42 260.0 43 289.0 44 274.0 45 264.5 46 263.0 47 268.0 48 262.0 49 225.0 50 169.5 51 136.5 52 115.5 53 87.0 54 62.0 55 44.0 56 33.5 57 24.0 58 13.5 59 11.0 60 11.5 61 7.5 62 6.0 63 4.0 64 2.5 65 2.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.125 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.315 110-114 0.42 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.02 140-144 0.03 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.81072874493927 97.625 2 1.1639676113360324 2.3 3 0.025303643724696356 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.5249999999999999 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.7875000000000001 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.1124999999999998 0.0 0.0 0.0 0.0 98-99 1.3624999999999998 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.4625 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 3.0375 0.0 0.0 0.0 0.0 112-113 3.5 0.0 0.0 0.0 0.0 114-115 3.8875 0.0 0.0 0.0 0.0 116-117 4.4 0.0 0.0 0.0 0.0 118-119 4.85 0.0 0.0 0.0 0.0 120-121 5.2875 0.0 0.0 0.0 0.0 122-123 5.65 0.0 0.0 0.0 0.0 124-125 6.112500000000001 0.0 0.0 0.0 0.0 126-127 6.5875 0.0 0.0 0.0 0.0 128-129 7.225 0.0 0.0 0.0 0.0 130-131 7.925 0.0 0.0 0.0 0.0 132-133 8.675 0.0 0.0 0.0 0.0 134-135 9.225000000000001 0.0 0.0 0.0 0.0 136-137 9.9125 0.0 0.0 0.0 0.0 138-139 10.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 135 8.7092235E-4 9.660833 140-144 >>END_MODULE SRR7169791 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169791_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8795 33.0 33.0 34.0 32.0 34.0 2 32.9845 34.0 33.0 34.0 32.0 34.0 3 33.1065 34.0 33.0 34.0 32.0 34.0 4 33.034 34.0 33.0 34.0 32.0 34.0 5 32.982 34.0 33.0 34.0 32.0 34.0 6 37.18175 38.0 38.0 38.0 37.0 38.0 7 37.223 38.0 38.0 38.0 37.0 38.0 8 37.1325 38.0 38.0 38.0 37.0 38.0 9 37.1955 38.0 38.0 38.0 37.0 38.0 10-14 37.2077 38.0 38.0 38.0 36.8 38.0 15-19 37.2073 38.0 38.0 38.0 37.0 38.0 20-24 37.16075 38.0 38.0 38.0 37.0 38.0 25-29 37.1121 38.0 38.0 38.0 37.0 38.0 30-34 36.95285 38.0 38.0 38.0 36.4 38.0 35-39 36.84465 38.0 38.0 38.0 36.0 38.0 40-44 36.90335 38.0 38.0 38.0 36.2 38.0 45-49 36.945049999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.497249999999994 38.0 38.0 38.0 34.4 38.0 55-59 36.34525 38.0 37.8 38.0 33.8 38.0 60-64 36.7192 38.0 38.0 38.0 35.0 38.0 65-69 36.94375 38.0 38.0 38.0 36.0 38.0 70-74 36.6886 38.0 38.0 38.0 35.8 38.0 75-79 35.7691 38.0 38.0 38.0 33.6 38.0 80-84 36.34395 38.0 38.0 38.0 34.2 38.0 85-89 36.576800000000006 38.0 38.0 38.0 34.8 38.0 90-94 36.6031 38.0 38.0 38.0 35.0 38.0 95-99 36.4309 38.0 38.0 38.0 34.6 38.0 100-104 36.145 38.0 38.0 38.0 33.8 38.0 105-109 35.35485 38.0 37.4 38.0 31.2 38.0 110-114 33.4623 38.0 35.4 38.0 16.6 38.0 115-119 33.47085 38.0 36.2 38.0 15.0 38.0 120-124 33.579150000000006 38.0 36.0 38.0 17.8 38.0 125-129 34.091150000000006 38.0 36.0 38.0 22.6 38.0 130-134 34.8055 38.0 36.0 38.0 26.4 38.0 135-139 34.43684999999999 38.0 35.2 38.0 24.6 38.0 140-144 33.759949999999996 38.0 34.2 38.0 21.8 38.0 145-149 33.6054 38.0 33.0 38.0 21.8 38.0 150-151 29.469375 35.5 26.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 2.0 5 1.0 6 1.0 7 2.0 8 0.0 9 0.0 10 3.0 11 1.0 12 4.0 13 2.0 14 1.0 15 4.0 16 6.0 17 2.0 18 5.0 19 5.0 20 11.0 21 8.0 22 12.0 23 21.0 24 11.0 25 14.0 26 16.0 27 28.0 28 42.0 29 71.0 30 72.0 31 93.0 32 114.0 33 145.0 34 155.0 35 243.0 36 574.0 37 2326.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.925 19.975 12.075 29.025000000000002 2 26.6 25.0 31.924999999999997 16.475 3 20.549999999999997 28.549999999999997 30.525000000000002 20.375 4 21.85 35.125 24.075 18.95 5 23.059589384076116 37.0555833750626 22.13319979969955 17.751627441161745 6 20.26519889917438 37.45308981736302 24.518388791593697 17.7633224918689 7 19.6 19.25 39.35 21.8 8 20.549999999999997 25.15 27.800000000000004 26.5 9 21.05 24.8 30.775000000000002 23.375 10-14 23.251162558127906 27.946397319865994 27.2013600680034 21.6010800540027 15-19 22.785950165115583 27.974582207545286 27.984589212448714 21.254878414890424 20-24 23.18281938325991 27.843412094513415 28.228874649579495 20.74489387264718 25-29 22.324510932105866 28.17831590533847 28.173312653224595 21.323860509331066 30-34 22.860146160776853 28.641505656221845 27.530283311642805 20.968064871358493 35-39 22.937111956739436 27.448427798918484 28.414780692970158 21.19967955137192 40-44 23.19507679991995 27.57292239955971 28.54355330965127 20.688447490869063 45-49 22.60390585878818 28.047070605908864 28.347521281922884 21.00150225338007 50-54 22.621373816323462 28.047497369607694 28.072548724886015 21.258580089182825 55-59 23.355543309453434 27.73909122789439 28.290165823355544 20.615199639296627 60-64 22.53753753753754 27.64764764764765 28.598598598598603 21.216216216216218 65-69 23.128502802241794 27.702161729383505 28.422738190552444 20.746597277822257 70-74 23.32813364866905 27.781411965984 28.67206762944699 20.218386755899964 75-79 23.43059693825131 27.3040172608651 28.61399362991883 20.65139217096476 80-84 23.378977043898512 27.366089407974226 28.418244059605318 20.83668948852195 85-89 23.54856484496318 27.12017231878976 28.37749837198818 20.953764464258878 90-94 23.186301507034496 28.198067390977823 27.882641566114252 20.73298953587343 95-99 23.37272181053475 28.049268976567195 28.484878830362508 20.09313038253555 100-104 23.916090918193653 27.430659857815158 28.20666866927005 20.446580554721137 105-109 23.178096212896623 27.85568065506653 28.42374616171955 20.542476970317296 110-114 23.760067825349722 28.089232725731243 27.983255616786774 20.16744383213226 115-119 24.131785039157442 27.907102349446394 27.80988387793681 20.151228733459355 120-124 24.056678872790958 28.180226078649895 27.691981107042402 20.071113941516742 125-129 24.352142110762802 28.249738766980148 27.7533960292581 19.644723092998955 130-134 24.787571019156317 27.57303031826638 28.121071949318722 19.518326713258585 135-139 24.715951749336803 27.523900095099858 28.069472946593926 19.69067520896942 140-144 25.38426876282982 28.06288489460772 27.66735092374706 18.885495418815403 145-149 25.717002852995645 28.11452024625857 27.548926372691323 18.619550528054457 150-151 26.001001001001 27.990490490490487 28.203203203203202 17.805305305305303 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 2.0 24 3.5 25 2.5 26 3.5 27 6.5 28 9.0 29 8.5 30 13.5 31 23.0 32 25.0 33 37.0 34 55.0 35 67.0 36 84.0 37 115.0 38 145.0 39 167.5 40 191.0 41 221.0 42 255.5 43 264.5 44 286.5 45 296.5 46 268.0 47 261.5 48 246.0 49 211.5 50 174.0 51 145.0 52 113.5 53 78.5 54 60.0 55 42.0 56 29.5 57 25.0 58 19.5 59 11.0 60 4.5 61 3.5 62 4.5 63 4.5 64 4.0 65 3.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.15 6 0.075 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.06999999999999999 20-24 0.12 25-29 0.065 30-34 0.11 35-39 0.13999999999999999 40-44 0.065 45-49 0.15 50-54 0.20500000000000002 55-59 0.19499999999999998 60-64 0.1 65-69 0.08 70-74 0.635 75-79 2.67 80-84 0.6799999999999999 85-89 0.185 90-94 0.135 95-99 0.13999999999999999 100-104 0.13 105-109 2.3 110-114 5.64 115-119 7.425 120-124 5.785 125-129 4.3 130-134 0.555 135-139 0.105 140-144 0.135 145-149 0.105 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9388580090955 97.89999999999999 2 1.0611419909044972 2.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.4874999999999998 0.0 0.0 0.0 0.0 102-103 1.7374999999999998 0.0 0.0 0.0 0.0 104-105 2.1375 0.0 0.0 0.0 0.0 106-107 2.3499999999999996 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 2.9125 0.0 0.0 0.0 0.0 112-113 3.3375000000000004 0.0 0.0 0.0 0.0 114-115 3.6625 0.0 0.0 0.0 0.0 116-117 4.15 0.0 0.0 0.0 0.0 118-119 4.575 0.0 0.0 0.0 0.0 120-121 4.987500000000001 0.0 0.0 0.0 0.0 122-123 5.3125 0.0 0.0 0.0 0.0 124-125 5.762499999999999 0.0 0.0 0.0 0.0 126-127 6.225 0.0 0.0 0.0 0.0 128-129 6.8 0.0 0.0 0.0 0.0 130-131 7.4625 0.0 0.0 0.0 0.0 132-133 8.149999999999999 0.0 0.0 0.0 0.0 134-135 8.7375 0.0 0.0 0.0 0.0 136-137 9.425 0.0 0.0 0.0 0.0 138-139 9.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCCAC 10 0.007174714 142.6375 145 GCACCAA 20 0.0053304103 29.638958 75-79 >>END_MODULE Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567606 spots for SRR7169791.sra Written 567606 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra Read 567596 spots for SRR7169791.sra Written 567596 spots for SRR7169791.sra SRR ids: ['SRR7169791.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yxlw0f0p SRR7169791.sra spots: 11351930 blocks: [[1, 567596], [567597, 1135192], [1135193, 1702788], [1702789, 2270384], [2270385, 2837980], [2837981, 3405576], [3405577, 3973172], [3973173, 4540768], [4540769, 5108364], [5108365, 5675960], [5675961, 6243556], [6243557, 6811152], [6811153, 7378748], [7378749, 7946344], [7946345, 8513940], [8513941, 9081536], [9081537, 9649132], [9649133, 10216728], [10216729, 10784324], [10784325, 11351930]] SRR7169791 file size 3825096 SRR7169791 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169791 SRR7169791_1.fastq SRR7169791_2.fastq Input file: SRR7169791_1.fastq Paired file: SRR7169791_2.fastq trimmed: SRR7169791-trimmed-pair1.fastq, SRR7169791-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:38:05 2025 >> started Tue Feb 11 17:38:17 2025 >> done (11.428s) 11351930 read pairs processed; of these: 11931 ( 0.11%) short read pairs filtered out after trimming by size control 9308 ( 0.08%) empty read pairs filtered out after trimming by size control 11330691 (99.81%) read pairs available; of these: 5312897 (46.89%) trimmed read pairs available after processing 6017794 (53.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 3 0.00% 22 6 0.00% 23 4 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 4 0.00% 28 3 0.00% 29 4 0.00% 30 3 0.00% 31 2 0.00% 32 7 0.00% 33 5 0.00% 34 6 0.00% 35 7 0.00% 36 5 0.00% 37 7 0.00% 38 19 0.00% 39 16 0.00% 40 23 0.00% 41 24 0.00% 42 26 0.00% 43 32 0.00% 44 35 0.00% 45 32 0.00% 46 36 0.00% 47 57 0.00% 48 52 0.00% 49 66 0.00% 50 103 0.00% 51 88 0.00% 52 119 0.00% 53 127 0.00% 54 127 0.00% 55 135 0.00% 56 152 0.00% 57 172 0.00% 58 230 0.00% 59 233 0.00% 60 316 0.00% 61 374 0.00% 62 398 0.00% 63 466 0.00% 64 521 0.00% 65 532 0.00% 66 632 0.01% 67 672 0.01% 68 820 0.01% 69 930 0.01% 70 1069 0.01% 71 1242 0.01% 72 1421 0.01% 73 1683 0.01% 74 1892 0.02% 75 1996 0.02% 76 2243 0.02% 77 2446 0.02% 78 2608 0.02% 79 2927 0.03% 80 3371 0.03% 81 3776 0.03% 82 4262 0.04% 83 4852 0.04% 84 5794 0.05% 85 6660 0.06% 86 6848 0.06% 87 7347 0.06% 88 7633 0.07% 89 8129 0.07% 90 8674 0.08% 91 9429 0.08% 92 10620 0.09% 93 11333 0.10% 94 12601 0.11% 95 13205 0.12% 96 13866 0.12% 97 13925 0.12% 98 14553 0.13% 99 15266 0.13% 100 16097 0.14% 101 16651 0.15% 102 17874 0.16% 103 18987 0.17% 104 20133 0.18% 105 21583 0.19% 106 22409 0.20% 107 22474 0.20% 108 22992 0.20% 109 23354 0.21% 110 23831 0.21% 111 25200 0.22% 112 26192 0.23% 113 27143 0.24% 114 28597 0.25% 115 30393 0.27% 116 30704 0.27% 117 31294 0.28% 118 31687 0.28% 119 31751 0.28% 120 31857 0.28% 121 33538 0.30% 122 34475 0.30% 123 35829 0.32% 124 37462 0.33% 125 38645 0.34% 126 40424 0.36% 127 41289 0.36% 128 41530 0.37% 129 41933 0.37% 130 42673 0.38% 131 43340 0.38% 132 44674 0.39% 133 46980 0.41% 134 48293 0.43% 135 49814 0.44% 136 52085 0.46% 137 54171 0.48% 138 56280 0.50% 139 58523 0.52% 140 62561 0.55% 141 65166 0.58% 142 69304 0.61% 143 76351 0.67% 144 85366 0.75% 145 99477 0.88% 146 118747 1.05% 147 155240 1.37% 148 226237 2.00% 149 428219 3.78% 150 2353751 20.77% 151 6017794 53.11% 11330691 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=39 prefix-density=0.19 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=163.46 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.7 sequence=AGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTGAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTACTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=23 prefix-density=0.25 prefix-fanout=2.7 sequence=GTTGACTGGTGCCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=40 fanout-score=60.65 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=13.7 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169791 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:39:00 Started mapping on | Feb 11 17:39:01 Finished on | Feb 11 17:40:02 Mapping speed, Million of reads per hour | 668.70 Number of input reads | 11330691 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 10891917 Uniquely mapped reads % | 96.13% Average mapped length | 290.94 Number of splices: Total | 9683799 Number of splices: Annotated (sjdb) | 9521709 Number of splices: GT/AG | 9549349 Number of splices: GC/AG | 103453 Number of splices: AT/AC | 8089 Number of splices: Non-canonical | 22908 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 187539 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 12016 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.08% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 260542 260542 260542 N_multimapping 187539 187539 187539 N_noFeature 325903 10743122 400253 N_ambiguous 118594 683 43640 UnstrandedReadsAssigned:10447420 PositiveStrandReadsAssigned:148112 NegativeStrandReadsAssigned:10448024 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169791 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169791-trimmed-pair1.fastq SRR7169791-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,330,691 reads, 10,382,640 reads pseudoaligned [quant] estimated average fragment length: 219.543 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7169791.ke.tsv 34699 SRR7169791.se.tsv 87100 total ==> SRR7169791.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.46 199 13.0192 Potri.005G024800.1.v4.1 1035 816.457 20 2.88382 Potri.004G059700.1.v4.1 961 742.483 0 0 Potri.007G009000.2.v4.1 1416 1197.46 0 0 Potri.003G141000.2.v4.1 2943 2724.46 221 9.54959 Potri.016G087400.1.v4.1 270 91.5661 710.582 913.592 Potri.015G069301.1.v4.1 564 348.389 0 0 Potri.010G195200.1.v4.1 1773 1554.46 18 1.36322 Potri.012G127500.1.v4.1 977 758.473 1588 246.481 ==> SRR7169791.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1550 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 135 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169791 completed mapping pipeline successfully