Starting /dee2/code/volunteer_pipeline.sh SRR7169792 current disk space = 3048836403200 free memory = 1190914652 SRR7169792 SRAfilesize d5b5aa0476925072520099856415a753 SRR7169792.sra SRR7169792.sra file validated SRR7169792 is paired end SRR7169792 is conventional basespace SRR7169792 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169792_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.68475 31.0 27.0 33.0 18.0 33.0 2 32.15 33.0 31.0 33.0 30.0 33.0 3 32.41975 33.0 33.0 33.0 31.0 34.0 4 32.59775 33.0 33.0 33.0 31.0 34.0 5 33.22025 33.0 33.0 34.0 33.0 34.0 6 37.052 38.0 37.0 38.0 36.0 38.0 7 37.348 38.0 38.0 38.0 37.0 38.0 8 37.59175 38.0 38.0 38.0 38.0 38.0 9 37.645 38.0 38.0 38.0 38.0 38.0 10-14 37.6702 38.0 38.0 38.0 38.0 38.0 15-19 37.684749999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.674699999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.619350000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.623400000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.607600000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.4148 38.0 38.0 38.0 37.8 38.0 45-49 37.47435 38.0 38.0 38.0 38.0 38.0 50-54 37.43235 38.0 38.0 38.0 37.8 38.0 55-59 37.4041 38.0 38.0 38.0 38.0 38.0 60-64 37.394600000000004 38.0 38.0 38.0 38.0 38.0 65-69 37.344049999999996 38.0 38.0 38.0 37.2 38.0 70-74 37.24785000000001 38.0 38.0 38.0 37.0 38.0 75-79 36.50365000000001 38.0 38.0 38.0 36.2 38.0 80-84 36.309000000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.2065 38.0 38.0 38.0 35.8 38.0 90-94 36.040949999999995 38.0 38.0 38.0 35.2 38.0 95-99 36.00790000000001 38.0 38.0 38.0 34.8 38.0 100-104 35.955099999999995 38.0 38.0 38.0 34.8 38.0 105-109 35.6729 38.0 38.0 38.0 33.8 38.0 110-114 35.641949999999994 38.0 38.0 38.0 34.0 38.0 115-119 35.593450000000004 38.0 38.0 38.0 33.4 38.0 120-124 35.527100000000004 38.0 38.0 38.0 33.0 38.0 125-129 35.392450000000004 38.0 38.0 38.0 32.4 38.0 130-134 35.13465 38.0 37.2 38.0 30.6 38.0 135-139 34.908550000000005 38.0 36.2 38.0 29.8 38.0 140-144 34.665749999999996 38.0 36.0 38.0 29.0 38.0 145-149 34.224900000000005 38.0 35.6 38.0 26.2 38.0 150-151 30.896 36.5 30.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 2.0 10 1.0 11 1.0 12 0.0 13 2.0 14 2.0 15 2.0 16 5.0 17 7.0 18 21.0 19 86.0 20 7.0 21 1.0 22 6.0 23 5.0 24 3.0 25 5.0 26 11.0 27 11.0 28 17.0 29 18.0 30 15.0 31 29.0 32 43.0 33 62.0 34 90.0 35 166.0 36 408.0 37 2972.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.6797598198649 13.284963722792096 11.883912934701026 35.15136352264198 2 20.849999999999998 16.875 29.7 32.574999999999996 3 18.75 18.625 26.3 36.325 4 21.075 24.2 22.75 31.974999999999998 5 25.45 27.725 24.55 22.275 6 22.775000000000002 31.924999999999997 24.175 21.125 7 13.825000000000001 30.625000000000004 38.5 17.05 8 16.45 30.675 30.55 22.325 9 19.275000000000002 26.6 32.6 21.525 10-14 18.57 31.495 26.795 23.14 15-19 18.92 29.45 27.755000000000003 23.875 20-24 19.18 30.455 26.86 23.505000000000003 25-29 18.91 30.064999999999998 26.955000000000002 24.07 30-34 18.581858185818582 29.167916791679165 27.23272327232723 25.01750175017502 35-39 19.99 29.659999999999997 26.889999999999997 23.46 40-44 19.35 29.565 26.93 24.154999999999998 45-49 19.72 28.675 27.565 24.04 50-54 20.175 28.715000000000003 26.729999999999997 24.38 55-59 19.585 28.46 28.17 23.785 60-64 19.193435404783347 28.915240668467927 27.65936155308716 24.231962373661563 65-69 18.975 30.385 26.32 24.32 70-74 19.025 30.73 26.795 23.45 75-79 19.259999999999998 30.54 26.029999999999998 24.169999999999998 80-84 19.605 30.099999999999998 26.08 24.215 85-89 19.64 30.314999999999998 25.77 24.275 90-94 19.825 29.235 26.479999999999997 24.46 95-99 20.085 29.744999999999997 26.174999999999997 23.995 100-104 20.07704622773664 29.342605563338005 26.84610766459876 23.734240544326596 105-109 20.45694200351494 28.968114486567913 26.151142355008787 24.42380115490836 110-114 20.393515032876575 29.17231340661547 26.20589268684435 24.228278873663605 115-119 20.145 29.65 26.075 24.13 120-124 20.115 29.794999999999998 25.455 24.635 125-129 20.705000000000002 29.145 25.759999999999998 24.39 130-134 20.294999999999998 29.310000000000002 25.85 24.545 135-139 20.285 29.235 25.569999999999997 24.91 140-144 21.490000000000002 28.050000000000004 25.374999999999996 25.085 145-149 21.125 28.549999999999997 25.365 24.959999999999997 150-151 19.9375 29.1875 25.324999999999996 25.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.5 5 0.5 6 1.0 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 2.0 22 2.5 23 2.0 24 3.5 25 5.0 26 5.5 27 7.5 28 15.0 29 21.0 30 23.5 31 36.0 32 53.0 33 60.0 34 73.5 35 90.5 36 99.5 37 106.5 38 125.5 39 169.5 40 197.5 41 203.0 42 214.0 43 231.0 44 246.5 45 242.5 46 235.5 47 224.0 48 192.0 49 178.5 50 165.0 51 145.0 52 121.0 53 106.0 54 100.5 55 77.0 56 54.5 57 38.5 58 32.0 59 22.0 60 12.5 61 13.5 62 13.5 63 8.0 64 3.0 65 1.5 66 2.5 67 2.5 68 2.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.06999999999999999 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06 105-109 0.42500000000000004 110-114 0.385 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4313725490196 94.125 2 1.2287581699346406 2.35 3 0.1830065359477124 0.525 4 0.10457516339869283 0.4 5 0.026143790849673207 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026143790849673207 2.475 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 99 2.475 TruSeq Adapter, Index 7 (97% over 36bp) CCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.55 0.0 0.0 0.0 0.0 96-97 1.9375 0.0 0.0 0.0 0.0 98-99 2.25 0.0 0.0 0.0 0.0 100-101 2.6500000000000004 0.0 0.0 0.0 0.0 102-103 3.05 0.0 0.0 0.0 0.0 104-105 3.4375 0.0 0.0 0.0 0.0 106-107 3.9499999999999997 0.0 0.0 0.0 0.0 108-109 4.5625 0.0 0.0 0.0 0.0 110-111 5.0 0.0 0.0 0.0 0.0 112-113 5.5125 0.0 0.0 0.0 0.0 114-115 6.125 0.0 0.0 0.0 0.0 116-117 6.7875 0.0 0.0 0.0 0.0 118-119 7.25 0.0 0.0 0.0 0.0 120-121 7.9875 0.0 0.0 0.0 0.0 122-123 8.75 0.0 0.0 0.0 0.0 124-125 9.4125 0.0 0.0 0.0 0.0 126-127 10.2 0.0 0.0 0.0 0.0 128-129 10.9125 0.0 0.0 0.0 0.0 130-131 11.7875 0.0 0.0 0.0 0.0 132-133 12.5 0.0 0.0 0.0 0.0 134-135 13.25 0.0 0.0 0.0 0.0 136-137 14.05 0.0 0.0 0.0 0.0 138-139 14.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169792 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169792_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.099 34.0 33.0 34.0 33.0 34.0 2 33.0925 34.0 33.0 34.0 33.0 34.0 3 33.10675 34.0 33.0 34.0 33.0 34.0 4 33.1115 34.0 33.0 34.0 33.0 34.0 5 33.0575 34.0 33.0 34.0 33.0 34.0 6 37.28225 38.0 38.0 38.0 38.0 38.0 7 37.229 38.0 38.0 38.0 38.0 38.0 8 37.2515 38.0 38.0 38.0 38.0 38.0 9 37.19575 38.0 38.0 38.0 38.0 38.0 10-14 37.201049999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.1265 38.0 38.0 38.0 38.0 38.0 20-24 37.09740000000001 38.0 38.0 38.0 37.8 38.0 25-29 37.1212 38.0 38.0 38.0 38.0 38.0 30-34 37.06075 38.0 38.0 38.0 37.6 38.0 35-39 37.0347 38.0 38.0 38.0 37.8 38.0 40-44 36.974650000000004 38.0 38.0 38.0 37.0 38.0 45-49 36.6142 38.0 38.0 38.0 35.8 38.0 50-54 36.73895 38.0 38.0 38.0 36.2 38.0 55-59 36.5482 38.0 38.0 38.0 35.8 38.0 60-64 36.0869 38.0 37.8 38.0 33.0 38.0 65-69 36.795049999999996 38.0 38.0 38.0 36.8 38.0 70-74 36.723200000000006 38.0 38.0 38.0 36.8 38.0 75-79 36.261199999999995 38.0 38.0 38.0 36.0 38.0 80-84 35.80095 38.0 38.0 38.0 34.6 38.0 85-89 35.83895 38.0 38.0 38.0 35.2 38.0 90-94 35.8327 38.0 38.0 38.0 35.2 38.0 95-99 35.7526 38.0 38.0 38.0 34.6 38.0 100-104 35.554649999999995 38.0 38.0 38.0 34.0 38.0 105-109 34.643800000000006 38.0 37.8 38.0 28.2 38.0 110-114 34.415749999999996 38.0 38.0 38.0 25.8 38.0 115-119 33.94595 38.0 37.4 38.0 18.0 38.0 120-124 33.6619 38.0 36.0 38.0 18.8 38.0 125-129 34.1296 38.0 36.8 38.0 23.2 38.0 130-134 34.34565 38.0 36.6 38.0 25.2 38.0 135-139 34.279199999999996 38.0 36.0 38.0 25.2 38.0 140-144 33.541549999999994 38.0 35.0 38.0 19.4 38.0 145-149 33.52985 38.0 35.6 38.0 19.4 38.0 150-151 29.536875 35.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 8.0 4 2.0 5 3.0 6 3.0 7 5.0 8 1.0 9 3.0 10 3.0 11 1.0 12 0.0 13 5.0 14 3.0 15 4.0 16 11.0 17 13.0 18 26.0 19 37.0 20 39.0 21 7.0 22 7.0 23 14.0 24 12.0 25 13.0 26 10.0 27 23.0 28 22.0 29 33.0 30 37.0 31 41.0 32 49.0 33 71.0 34 114.0 35 176.0 36 436.0 37 2748.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.1 19.8 16.075 25.025 2 27.090635953930896 27.41612418627942 28.11717576364547 17.376064096144216 3 21.775 28.475 29.825000000000003 19.925 4 24.349999999999998 31.474999999999998 23.35 20.825 5 27.125 33.800000000000004 22.0 17.075000000000003 6 24.075 36.725 23.0 16.2 7 21.2 24.4 36.975 17.424999999999997 8 23.724999999999998 26.35 26.25 23.674999999999997 9 26.474999999999998 22.25 29.575000000000003 21.7 10-14 25.245 28.125 25.785000000000004 20.845 15-19 25.724999999999998 26.674999999999997 27.115000000000002 20.485 20-24 25.515 28.110000000000003 26.61 19.765 25-29 25.019999999999996 29.17 25.47 20.34 30-34 24.349999999999998 27.395000000000003 28.435 19.82 35-39 25.33880082012302 27.65414812221833 27.30409561434215 19.702955443316498 40-44 25.232523252325233 28.102810281028102 26.907690769076908 19.756975697569757 45-49 24.29 28.455000000000002 26.715 20.54 50-54 25.380000000000003 26.6 27.255000000000003 20.765 55-59 25.20878131719758 27.04905735860379 27.77916687503125 19.962994449167375 60-64 24.245 27.275 27.22 21.26 65-69 23.95 27.71 27.855 20.485 70-74 23.869447508272334 29.123633811290482 27.208462849694175 19.798455830743006 75-79 24.313506940926132 28.766845678386865 26.973350896747387 19.94629648393961 80-84 24.510885923547708 29.116083074144676 26.97401424701515 19.399016755292465 85-89 25.080000000000002 28.199999999999996 27.36 19.36 90-94 24.535 28.13 27.589999999999996 19.744999999999997 95-99 25.15 27.694999999999997 28.275 18.88 100-104 25.640768922707245 27.83840608730477 27.317781337605123 19.20304365238286 105-109 24.54411540610555 28.048966322954232 27.67308376085742 19.733834510082797 110-114 25.420503060542153 27.66832981842498 28.16727534591842 18.74389177511445 115-119 25.145228215767634 29.27385892116183 27.05912863070539 18.521784232365146 120-124 24.99614177684037 28.50455270332836 27.558001954833067 18.9413035649982 125-129 25.459652706843716 28.830439223697653 27.538304392236977 18.171603677221654 130-134 25.525194284281778 28.698922035597896 27.485585359739282 18.290298320381048 135-139 26.495 28.194999999999997 27.455000000000002 17.854999999999997 140-144 26.061303065153258 28.07140357017851 27.67138356917846 18.195909795489776 145-149 26.345000000000002 28.235 27.685 17.735 150-151 26.35542168674699 28.275602409638555 27.510040160642568 17.858935742971887 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 2.0 26 2.5 27 3.5 28 6.0 29 10.5 30 11.5 31 13.5 32 20.5 33 27.5 34 42.5 35 56.5 36 78.5 37 100.0 38 118.5 39 161.0 40 175.5 41 175.0 42 215.5 43 252.5 44 272.0 45 284.5 46 279.5 47 264.5 48 236.5 49 214.5 50 187.0 51 145.0 52 133.5 53 121.5 54 86.0 55 69.5 56 58.5 57 43.0 58 35.5 59 24.0 60 16.5 61 17.5 62 14.0 63 5.5 64 3.0 65 3.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.015 60-64 0.0 65-69 0.0 70-74 0.27 75-79 1.31 80-84 0.33 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.12 105-109 1.5650000000000002 110-114 2.795 115-119 3.5999999999999996 120-124 2.8049999999999997 125-129 2.1 130-134 0.27499999999999997 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75065070275897 94.85 2 0.9109838625715773 1.7500000000000002 3 0.18219677251431546 0.525 4 0.07808433107756377 0.3 5 0.026028110359187923 0.125 6 0.026028110359187923 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026028110359187923 2.3 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 92 2.3 Illumina Single End PCR Primer 1 (96% over 32bp) GGGTGAGTCGACCCCTAAGGCGAGGCCGAAAGGCGTAGTCGATGGGAAAC 6 0.15 No Hit GGTGAGTCGACCCCTAAGGCGAGGCCGAAAGGCGTAGTCGATGGGAAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.55 0.0 0.0 0.0 0.0 96-97 1.9125 0.0 0.0 0.0 0.0 98-99 2.2375 0.0 0.0 0.0 0.0 100-101 2.5999999999999996 0.0 0.0 0.0 0.0 102-103 2.9749999999999996 0.0 0.0 0.0 0.0 104-105 3.3875 0.0 0.0 0.0 0.0 106-107 3.925 0.0 0.0 0.0 0.0 108-109 4.5 0.0 0.0 0.0 0.0 110-111 4.9375 0.0 0.0 0.0 0.0 112-113 5.4375 0.0 0.0 0.0 0.0 114-115 6.0375 0.0 0.0 0.0 0.0 116-117 6.612500000000001 0.0 0.0 0.0 0.0 118-119 7.0875 0.0 0.0 0.0 0.0 120-121 7.75 0.0 0.0 0.0 0.0 122-123 8.4875 0.0 0.0 0.0 0.0 124-125 9.125 0.0 0.0 0.0 0.0 126-127 9.875 0.0 0.0 0.0 0.0 128-129 10.55 0.0 0.0 0.0 0.0 130-131 11.399999999999999 0.0 0.0 0.0 0.0 132-133 12.1375 0.0 0.0 0.0 0.0 134-135 12.9125 0.0 0.0 0.0 0.0 136-137 13.712499999999999 0.0 0.0 0.0 0.0 138-139 14.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTGC 10 0.0069700265 144.02501 9 CTTTTAC 10 0.0069700265 144.02501 8 >>END_MODULE Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304423 spots for SRR7169792.sra Written 304423 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra Read 304413 spots for SRR7169792.sra Written 304413 spots for SRR7169792.sra SRR ids: ['SRR7169792.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wqxlkgsp SRR7169792.sra spots: 6088270 blocks: [[1, 304413], [304414, 608826], [608827, 913239], [913240, 1217652], [1217653, 1522065], [1522066, 1826478], [1826479, 2130891], [2130892, 2435304], [2435305, 2739717], [2739718, 3044130], [3044131, 3348543], [3348544, 3652956], [3652957, 3957369], [3957370, 4261782], [4261783, 4566195], [4566196, 4870608], [4870609, 5175021], [5175022, 5479434], [5479435, 5783847], [5783848, 6088270]] SRR7169792 file size 2049054 SRR7169792 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169792 SRR7169792_1.fastq SRR7169792_2.fastq Input file: SRR7169792_1.fastq Paired file: SRR7169792_2.fastq trimmed: SRR7169792-trimmed-pair1.fastq, SRR7169792-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:21:48 2025 >> started Tue Feb 11 17:21:55 2025 >> done (7.086s) 6088270 read pairs processed; of these: 15134 ( 0.25%) short read pairs filtered out after trimming by size control 144375 ( 2.37%) empty read pairs filtered out after trimming by size control 5928761 (97.38%) read pairs available; of these: 2928832 (49.40%) trimmed read pairs available after processing 2999929 (50.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 10 0.00% 20 9 0.00% 21 9 0.00% 22 16 0.00% 23 10 0.00% 24 14 0.00% 25 16 0.00% 26 18 0.00% 27 20 0.00% 28 11 0.00% 29 15 0.00% 30 16 0.00% 31 30 0.00% 32 16 0.00% 33 18 0.00% 34 30 0.00% 35 17 0.00% 36 17 0.00% 37 28 0.00% 38 27 0.00% 39 31 0.00% 40 33 0.00% 41 34 0.00% 42 40 0.00% 43 46 0.00% 44 49 0.00% 45 84 0.00% 46 96 0.00% 47 106 0.00% 48 101 0.00% 49 109 0.00% 50 117 0.00% 51 135 0.00% 52 138 0.00% 53 148 0.00% 54 166 0.00% 55 169 0.00% 56 206 0.00% 57 215 0.00% 58 225 0.00% 59 289 0.00% 60 338 0.01% 61 350 0.01% 62 357 0.01% 63 451 0.01% 64 519 0.01% 65 547 0.01% 66 577 0.01% 67 599 0.01% 68 663 0.01% 69 817 0.01% 70 902 0.02% 71 1061 0.02% 72 1336 0.02% 73 1505 0.03% 74 1609 0.03% 75 2523 0.04% 76 7724 0.13% 77 11448 0.19% 78 4999 0.08% 79 3462 0.06% 80 3304 0.06% 81 3441 0.06% 82 3559 0.06% 83 3987 0.07% 84 4914 0.08% 85 5683 0.10% 86 6024 0.10% 87 6724 0.11% 88 7593 0.13% 89 7969 0.13% 90 8191 0.14% 91 7902 0.13% 92 8446 0.14% 93 9439 0.16% 94 9784 0.17% 95 10991 0.19% 96 11328 0.19% 97 11915 0.20% 98 12054 0.20% 99 12046 0.20% 100 12601 0.21% 101 12954 0.22% 102 13875 0.23% 103 14367 0.24% 104 15286 0.26% 105 16143 0.27% 106 16498 0.28% 107 16641 0.28% 108 17159 0.29% 109 17987 0.30% 110 18737 0.32% 111 19171 0.32% 112 19470 0.33% 113 20472 0.35% 114 21267 0.36% 115 21832 0.37% 116 22483 0.38% 117 23006 0.39% 118 23471 0.40% 119 22961 0.39% 120 23631 0.40% 121 23867 0.40% 122 24162 0.41% 123 25273 0.43% 124 25938 0.44% 125 26427 0.45% 126 26863 0.45% 127 27584 0.47% 128 28148 0.47% 129 28259 0.48% 130 28890 0.49% 131 28370 0.48% 132 29112 0.49% 133 29734 0.50% 134 30807 0.52% 135 31673 0.53% 136 32648 0.55% 137 33373 0.56% 138 34129 0.58% 139 35535 0.60% 140 35934 0.61% 141 37206 0.63% 142 39807 0.67% 143 41316 0.70% 144 45079 0.76% 145 48552 0.82% 146 55312 0.93% 147 68008 1.15% 148 95832 1.62% 149 188600 3.18% 150 1132403 19.10% 151 2999929 50.60% 5928761 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=30 prefix-density=0.56 prefix-fanout=1.2 sequence=CACTCGTCAGCGAAACAGCAAGCTGTTTCCTGTTACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=44 fanout-score=292.40 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=20.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCAGGACCACCATTGCAAGTAGCAAAGGTTGGCAAACCACATGTCATGGCCTCAACAACAGTCAAT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=40 prefix-density=0.63 prefix-fanout=1.0 sequence=GGTAACAGGAAACAGCTTGCTGTTTCGCTGACGAGTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=65.99 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.9 sequence=GAAAATGGAGGCAATGAAAATGAAGATCTTTGTTGTGTTGATGGTGGTCTTGATGGCCTTCTCAACCATGCAAAAGGCTGCAGCTGCCGATGCACCAGCACCAAGCCCAACATCTGATGCCACTATCTTTGTTCCCACGTTCTTGGCATCTCTTGTTGCTCTTGCTTTCGGGTTGCTCTTTTGAGCCAACT SRR7169792 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:22:44 Started mapping on | Feb 11 17:22:45 Finished on | Feb 11 17:23:47 Mapping speed, Million of reads per hour | 344.25 Number of input reads | 5928761 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 5337389 Uniquely mapped reads % | 90.03% Average mapped length | 288.62 Number of splices: Total | 4080181 Number of splices: Annotated (sjdb) | 4000857 Number of splices: GT/AG | 4015418 Number of splices: GC/AG | 49379 Number of splices: AT/AC | 3496 Number of splices: Non-canonical | 11888 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 100561 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 22226 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.74% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 501983 501983 501983 N_multimapping 100561 100561 100561 N_noFeature 134704 5268650 162145 N_ambiguous 63624 337 22134 UnstrandedReadsAssigned:5139061 PositiveStrandReadsAssigned:68402 NegativeStrandReadsAssigned:5153110 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR7169792 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169792-trimmed-pair1.fastq SRR7169792-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,928,761 reads, 5,155,418 reads pseudoaligned [quant] estimated average fragment length: 202.174 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR7169792.ke.tsv 34699 SRR7169792.se.tsv 87100 total ==> SRR7169792.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1816.83 98 9.61255 Potri.005G024800.1.v4.1 1035 833.826 15 3.20584 Potri.004G059700.1.v4.1 961 759.83 4 0.938143 Potri.007G009000.2.v4.1 1416 1214.83 0 0 Potri.003G141000.2.v4.1 2943 2741.83 69 4.48472 Potri.016G087400.1.v4.1 270 95.1023 574.793 1077.08 Potri.015G069301.1.v4.1 564 363.938 0 0 Potri.010G195200.1.v4.1 1773 1571.83 28 3.17453 Potri.012G127500.1.v4.1 977 775.826 3099 711.841 ==> SRR7169792.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 548 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 163 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169792 completed mapping pipeline successfully