Starting /dee2/code/volunteer_pipeline.sh SRR7169793 current disk space = 3052658393088 free memory = 1477033764 SRR7169793 SRAfilesize 7d66b3a5cd0da83b3e84fc09fe005986 SRR7169793.sra SRR7169793.sra file validated SRR7169793 is paired end SRR7169793 is conventional basespace SRR7169793 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169793_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.864 18.0 18.0 28.0 18.0 32.0 2 30.73825 31.0 30.0 33.0 27.0 33.0 3 32.037 33.0 33.0 33.0 31.0 33.0 4 32.48125 33.0 33.0 33.0 31.0 34.0 5 33.0075 33.0 33.0 34.0 33.0 34.0 6 36.8135 38.0 37.0 38.0 35.0 38.0 7 37.12275 38.0 38.0 38.0 36.0 38.0 8 36.63575 38.0 38.0 38.0 34.0 38.0 9 37.336 38.0 38.0 38.0 36.0 38.0 10-14 37.4485 38.0 38.0 38.0 36.8 38.0 15-19 36.50404999999999 38.0 37.2 38.0 33.2 38.0 20-24 37.52615 38.0 38.0 38.0 37.2 38.0 25-29 37.477850000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.3189 38.0 38.0 38.0 36.6 38.0 35-39 37.2019 38.0 38.0 38.0 36.8 38.0 40-44 36.95675 38.0 38.0 38.0 35.8 38.0 45-49 36.55955 38.0 37.8 38.0 34.4 38.0 50-54 37.263549999999995 38.0 38.0 38.0 36.2 38.0 55-59 37.2193 38.0 38.0 38.0 36.4 38.0 60-64 37.18065 38.0 38.0 38.0 36.0 38.0 65-69 37.063250000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.97195 38.0 38.0 38.0 35.6 38.0 75-79 36.9031 38.0 38.0 38.0 35.2 38.0 80-84 36.8005 38.0 38.0 38.0 35.0 38.0 85-89 36.7377 38.0 38.0 38.0 34.6 38.0 90-94 36.546200000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.4305 38.0 37.6 38.0 33.8 38.0 100-104 36.4126 38.0 37.8 38.0 34.0 38.0 105-109 36.3287 38.0 37.0 38.0 34.0 38.0 110-114 35.5625 38.0 36.4 38.0 30.8 38.0 115-119 35.63314999999999 38.0 36.2 38.0 30.6 38.0 120-124 35.63674999999999 38.0 36.0 38.0 31.0 38.0 125-129 35.38875 38.0 36.0 38.0 30.6 38.0 130-134 34.67615 38.0 34.8 38.0 25.4 38.0 135-139 34.480599999999995 38.0 34.8 38.0 26.4 38.0 140-144 34.303349999999995 38.0 34.6 38.0 25.8 38.0 145-149 33.608650000000004 38.0 34.2 38.0 21.8 38.0 150-151 29.87975 36.0 27.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 3.0 18 2.0 19 2.0 20 3.0 21 2.0 22 9.0 23 5.0 24 12.0 25 7.0 26 11.0 27 20.0 28 23.0 29 26.0 30 47.0 31 58.0 32 85.0 33 110.0 34 219.0 35 392.0 36 1058.0 37 1900.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.85778781038375 11.81339352896915 11.060948081264108 36.26787057938299 2 22.45 15.65 34.599999999999994 27.3 3 19.09182137481184 21.475163070747616 25.23833416959358 34.194681384846966 4 20.724999999999998 31.175000000000004 23.825 24.275 5 22.225 34.475 23.625 19.675 6 18.575 36.05 25.775 19.6 7 15.075 26.700000000000003 41.575 16.650000000000002 8 17.875 25.074999999999996 31.45 25.6 9 17.25 25.775 32.300000000000004 24.675 10-14 20.165 31.069999999999997 26.11 22.655 15-19 19.555 29.085 27.915 23.445 20-24 19.79 29.285 27.97 22.955000000000002 25-29 19.73 29.654999999999998 27.63 22.985 30-34 20.155 29.15 27.495000000000005 23.200000000000003 35-39 19.82 29.005 28.084999999999997 23.09 40-44 19.89 29.095 27.839999999999996 23.175 45-49 20.064999999999998 29.01 27.61 23.315 50-54 20.18 28.79 27.48 23.549999999999997 55-59 20.025000000000002 29.17 27.685 23.119999999999997 60-64 20.27 28.854999999999997 27.555000000000003 23.32 65-69 20.035 29.68 27.55 22.735 70-74 20.21 29.265 27.415 23.11 75-79 19.705000000000002 29.604999999999997 27.245 23.445 80-84 19.67 28.810000000000002 27.279999999999998 24.240000000000002 85-89 19.905 29.395 27.11 23.59 90-94 20.44 28.975 26.86 23.724999999999998 95-99 20.255000000000003 28.565 27.794999999999998 23.385 100-104 20.835 29.38 26.565 23.22 105-109 20.638255302120847 28.64145658263305 27.450980392156865 23.269307723089234 110-114 20.674999999999997 29.360000000000003 26.945000000000004 23.02 115-119 20.865000000000002 28.804999999999996 27.55 22.78 120-124 20.48 29.385 26.895000000000003 23.24 125-129 20.775 28.89 26.755000000000003 23.580000000000002 130-134 20.645 28.07 27.634999999999998 23.65 135-139 20.705000000000002 28.82 26.86 23.615 140-144 20.794999999999998 28.025 27.13 24.05 145-149 20.79 28.62 27.26 23.330000000000002 150-151 20.4375 28.275 26.5625 24.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.5 23 2.0 24 2.0 25 3.0 26 4.0 27 8.0 28 10.5 29 16.0 30 22.5 31 25.5 32 39.5 33 56.5 34 68.0 35 83.0 36 98.5 37 117.0 38 149.5 39 182.0 40 197.5 41 204.5 42 230.5 43 248.5 44 274.5 45 295.0 46 269.5 47 236.5 48 216.5 49 195.5 50 161.0 51 138.0 52 112.5 53 91.0 54 78.0 55 49.5 56 26.5 57 22.0 58 18.0 59 12.5 60 9.5 61 5.5 62 3.5 63 3.0 64 1.5 65 1.0 66 1.0 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.35000000000000003 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.04 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 0.9874999999999999 0.0 0.0 0.0 0.0 96-97 1.175 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.925 0.0 0.0 0.0 0.0 106-107 2.1875 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.7 0.0 0.0 0.0 0.0 112-113 3.075 0.0 0.0 0.0 0.0 114-115 3.575 0.0 0.0 0.0 0.0 116-117 4.0375 0.0 0.0 0.0 0.0 118-119 4.5875 0.0 0.0 0.0 0.0 120-121 5.012499999999999 0.0 0.0 0.0 0.0 122-123 5.4625 0.0 0.0 0.0 0.0 124-125 6.0375 0.0 0.0 0.0 0.0 126-127 6.4875 0.0 0.0 0.0 0.0 128-129 6.925000000000001 0.0 0.0 0.0 0.0 130-131 7.4375 0.0 0.0 0.0 0.0 132-133 7.85 0.0 0.0 0.0 0.0 134-135 8.175 0.0 0.0 0.0 0.0 136-137 8.725 0.0 0.0 0.0 0.0 138-139 9.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169793 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169793_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.104 33.0 33.0 34.0 32.0 34.0 2 33.19675 34.0 33.0 34.0 33.0 34.0 3 33.262 34.0 33.0 34.0 33.0 34.0 4 33.2515 34.0 33.0 34.0 33.0 34.0 5 33.3345 34.0 33.0 34.0 33.0 34.0 6 37.493 38.0 38.0 38.0 38.0 38.0 7 37.50025 38.0 38.0 38.0 38.0 38.0 8 37.51975 38.0 38.0 38.0 38.0 38.0 9 37.43525 38.0 38.0 38.0 38.0 38.0 10-14 37.025999999999996 38.0 38.0 38.0 36.0 38.0 15-19 37.339549999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.273250000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.31845 38.0 38.0 38.0 37.2 38.0 30-34 36.872600000000006 38.0 37.8 38.0 35.4 38.0 35-39 37.19695 38.0 38.0 38.0 37.0 38.0 40-44 36.58285 38.0 37.6 38.0 33.8 38.0 45-49 37.29485 38.0 38.0 38.0 37.0 38.0 50-54 36.94815 38.0 37.8 38.0 35.6 38.0 55-59 36.91565 38.0 38.0 38.0 35.8 38.0 60-64 37.0619 38.0 38.0 38.0 36.6 38.0 65-69 36.8565 38.0 38.0 38.0 35.8 38.0 70-74 36.758799999999994 38.0 38.0 38.0 35.6 38.0 75-79 36.77815 38.0 38.0 38.0 35.6 38.0 80-84 36.6426 38.0 38.0 38.0 34.8 38.0 85-89 36.80935 38.0 38.0 38.0 35.8 38.0 90-94 36.55615 38.0 38.0 38.0 34.6 38.0 95-99 36.72055 38.0 38.0 38.0 35.6 38.0 100-104 36.3831 38.0 38.0 38.0 34.2 38.0 105-109 35.143299999999996 38.0 37.2 38.0 28.8 38.0 110-114 34.46415 38.0 37.0 38.0 25.2 38.0 115-119 34.01915 38.0 36.6 38.0 21.8 38.0 120-124 33.592 38.0 35.2 38.0 18.4 38.0 125-129 34.43650000000001 38.0 35.8 38.0 24.8 38.0 130-134 34.6351 38.0 35.2 38.0 26.8 38.0 135-139 34.82195 38.0 35.6 38.0 28.2 38.0 140-144 34.755900000000004 38.0 35.4 38.0 28.6 38.0 145-149 34.19255 38.0 34.0 38.0 26.8 38.0 150-151 29.753875 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 2.0 5 3.0 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 2.0 13 1.0 14 0.0 15 2.0 16 1.0 17 1.0 18 3.0 19 3.0 20 5.0 21 7.0 22 6.0 23 7.0 24 6.0 25 15.0 26 15.0 27 24.0 28 29.0 29 36.0 30 59.0 31 101.0 32 102.0 33 108.0 34 171.0 35 285.0 36 719.0 37 2274.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.625 19.2 14.000000000000002 28.175 2 26.05 25.8 31.2 16.950000000000003 3 20.05501375343836 28.707176794198553 31.50787696924231 19.72993248312078 4 24.0 34.425 23.075000000000003 18.5 5 25.3 37.0 21.725 15.975 6 20.599999999999998 37.5 23.35 18.55 7 19.45 20.674999999999997 40.725 19.15 8 20.65 25.025 28.325 26.0 9 22.3 25.025 30.075000000000003 22.6 10-14 23.355 28.915000000000003 26.22 21.51 15-19 23.145 28.055000000000003 28.084999999999997 20.715 20-24 22.835 27.955000000000002 28.244999999999997 20.965 25-29 22.785 27.860000000000003 28.1 21.255 30-34 22.775000000000002 27.825 28.325 21.075 35-39 22.93 28.144999999999996 27.810000000000002 21.115000000000002 40-44 22.98 27.794999999999998 28.439999999999998 20.785 45-49 22.695 27.860000000000003 28.87 20.575 50-54 23.075000000000003 28.345 27.744999999999997 20.835 55-59 23.955000000000002 27.675 28.185 20.185 60-64 23.380000000000003 28.68 28.144999999999996 19.794999999999998 65-69 22.74 28.285 28.499999999999996 20.474999999999998 70-74 23.730258210077714 27.806467786412636 27.83655051391326 20.62672348959639 75-79 23.00760913095715 27.778334000800964 28.56928313976772 20.64477372847417 80-84 22.926878063419025 27.513253976192857 29.128738621586475 20.43112933880164 85-89 23.24 27.915 28.03 20.815 90-94 23.26 27.794999999999998 28.610000000000003 20.335 95-99 23.385 28.499999999999996 27.875 20.24 100-104 23.091163814670267 27.409186430501354 28.840188131692184 20.659461623136195 105-109 23.674785100286535 27.312730249693 28.474212034383957 20.53827261563651 110-114 23.846954711087974 28.438313378448726 27.82404997397189 19.89068193649141 115-119 24.143244248445885 27.862494022634294 28.06439615323309 19.929865575686733 120-124 23.886703383162864 28.07762916338841 27.857330186205086 20.17833726724364 125-129 24.532638676064973 27.566656451118604 27.93952395546021 19.961180917356216 130-134 24.627089798778655 27.910701771949142 28.08589448393233 19.376313945339874 135-139 24.79 28.345 27.68 19.185 140-144 24.46 27.794999999999998 27.66 20.085 145-149 25.06 28.225 27.474999999999998 19.24 150-151 25.5625 29.075 26.075 19.287499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.5 24 2.0 25 1.0 26 2.5 27 3.5 28 5.5 29 9.0 30 14.0 31 22.0 32 29.5 33 42.0 34 55.5 35 67.0 36 82.5 37 94.5 38 135.5 39 194.5 40 204.0 41 221.5 42 252.5 43 276.5 44 300.0 45 302.0 46 276.5 47 256.5 48 234.5 49 193.5 50 172.0 51 134.0 52 96.5 53 79.5 54 72.5 55 52.0 56 29.0 57 25.0 58 20.0 59 12.5 60 6.0 61 4.0 62 3.5 63 3.0 64 1.5 65 0.5 66 0.0 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.27499999999999997 75-79 0.12 80-84 0.03 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06999999999999999 105-109 2.2800000000000002 110-114 3.95 115-119 5.8950000000000005 120-124 4.675 125-129 2.11 130-134 0.11 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 2.625 0.0 0.0 0.0 0.0 112-113 2.9625 0.0 0.0 0.0 0.0 114-115 3.4125 0.0 0.0 0.0 0.0 116-117 3.775 0.0 0.0 0.0 0.0 118-119 4.2875 0.0 0.0 0.0 0.0 120-121 4.7125 0.0 0.0 0.0 0.0 122-123 5.1625 0.0 0.0 0.0 0.0 124-125 5.7375 0.0 0.0 0.0 0.0 126-127 6.1875 0.0 0.0 0.0 0.0 128-129 6.6625 0.0 0.0 0.0 0.0 130-131 7.125 0.0 0.0 0.0 0.0 132-133 7.55 0.0 0.0 0.0 0.0 134-135 7.8875 0.0 0.0 0.0 0.0 136-137 8.4 0.0 0.0 0.0 0.0 138-139 9.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918058 spots for SRR7169793.sra Written 918058 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra Read 918055 spots for SRR7169793.sra Written 918055 spots for SRR7169793.sra SRR ids: ['SRR7169793.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mc_5bmat SRR7169793.sra spots: 18361103 blocks: [[1, 918055], [918056, 1836110], [1836111, 2754165], [2754166, 3672220], [3672221, 4590275], [4590276, 5508330], [5508331, 6426385], [6426386, 7344440], [7344441, 8262495], [8262496, 9180550], [9180551, 10098605], [10098606, 11016660], [11016661, 11934715], [11934716, 12852770], [12852771, 13770825], [13770826, 14688880], [14688881, 15606935], [15606936, 16524990], [16524991, 17443045], [17443046, 18361103]] SRR7169793 file size 6200274 SRR7169793 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169793 SRR7169793_1.fastq SRR7169793_2.fastq Input file: SRR7169793_1.fastq Paired file: SRR7169793_2.fastq trimmed: SRR7169793-trimmed-pair1.fastq, SRR7169793-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:58:59 2025 >> started Tue Feb 11 17:59:20 2025 >> done (21.115s) 18361103 read pairs processed; of these: 14317 ( 0.08%) short read pairs filtered out after trimming by size control 15058 ( 0.08%) empty read pairs filtered out after trimming by size control 18331728 (99.84%) read pairs available; of these: 8934029 (48.74%) trimmed read pairs available after processing 9397699 (51.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 7 0.00% 22 7 0.00% 23 9 0.00% 24 7 0.00% 25 8 0.00% 26 4 0.00% 27 7 0.00% 28 4 0.00% 29 11 0.00% 30 8 0.00% 31 12 0.00% 32 9 0.00% 33 14 0.00% 34 15 0.00% 35 10 0.00% 36 13 0.00% 37 19 0.00% 38 24 0.00% 39 33 0.00% 40 29 0.00% 41 40 0.00% 42 43 0.00% 43 45 0.00% 44 47 0.00% 45 48 0.00% 46 62 0.00% 47 78 0.00% 48 92 0.00% 49 102 0.00% 50 113 0.00% 51 149 0.00% 52 147 0.00% 53 202 0.00% 54 183 0.00% 55 162 0.00% 56 224 0.00% 57 245 0.00% 58 288 0.00% 59 325 0.00% 60 395 0.00% 61 454 0.00% 62 533 0.00% 63 601 0.00% 64 714 0.00% 65 676 0.00% 66 846 0.00% 67 878 0.00% 68 967 0.01% 69 1153 0.01% 70 1345 0.01% 71 1467 0.01% 72 1840 0.01% 73 2087 0.01% 74 2321 0.01% 75 2575 0.01% 76 2890 0.02% 77 3286 0.02% 78 3338 0.02% 79 3802 0.02% 80 4155 0.02% 81 4852 0.03% 82 5601 0.03% 83 6290 0.03% 84 7553 0.04% 85 8527 0.05% 86 9307 0.05% 87 9733 0.05% 88 10516 0.06% 89 11133 0.06% 90 12046 0.07% 91 13105 0.07% 92 14238 0.08% 93 15672 0.09% 94 16906 0.09% 95 18008 0.10% 96 19081 0.10% 97 19845 0.11% 98 20371 0.11% 99 21485 0.12% 100 22739 0.12% 101 23949 0.13% 102 25850 0.14% 103 27487 0.15% 104 29302 0.16% 105 30843 0.17% 106 31835 0.17% 107 32747 0.18% 108 33692 0.18% 109 34514 0.19% 110 35228 0.19% 111 36953 0.20% 112 38529 0.21% 113 40485 0.22% 114 42883 0.23% 115 44607 0.24% 116 45865 0.25% 117 47002 0.26% 118 47653 0.26% 119 48146 0.26% 120 48824 0.27% 121 50502 0.28% 122 52582 0.29% 123 54737 0.30% 124 56981 0.31% 125 60001 0.33% 126 60925 0.33% 127 62266 0.34% 128 63707 0.35% 129 64235 0.35% 130 65475 0.36% 131 66544 0.36% 132 69698 0.38% 133 71970 0.39% 134 74557 0.41% 135 76978 0.42% 136 80227 0.44% 137 83259 0.45% 138 87435 0.48% 139 91493 0.50% 140 96095 0.52% 141 102914 0.56% 142 112055 0.61% 143 123391 0.67% 144 142435 0.78% 145 169368 0.92% 146 212777 1.16% 147 285995 1.56% 148 416894 2.27% 149 830468 4.53% 150 4095483 22.34% 151 9397699 51.26% 18331728 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=36 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=269.99 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=20.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.60 fanout-score-rank=15 prefix-density=0.33 prefix-fanout=3.9 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=36 fanout-score=47.85 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=12.1 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169793 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:00:06 Started mapping on | Feb 11 18:00:06 Finished on | Feb 11 18:01:38 Mapping speed, Million of reads per hour | 717.33 Number of input reads | 18331728 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17735204 Uniquely mapped reads % | 96.75% Average mapped length | 291.73 Number of splices: Total | 15484340 Number of splices: Annotated (sjdb) | 15213551 Number of splices: GT/AG | 15266373 Number of splices: GC/AG | 169141 Number of splices: AT/AC | 13970 Number of splices: Non-canonical | 34856 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 277645 % of reads mapped to multiple loci | 1.51% Number of reads mapped to too many loci | 27420 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.56% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 332939 332939 332939 N_multimapping 277645 277645 277645 N_noFeature 541355 17481440 654037 N_ambiguous 216484 1016 74668 UnstrandedReadsAssigned:16977365 PositiveStrandReadsAssigned:252748 NegativeStrandReadsAssigned:17006499 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169793 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169793-trimmed-pair1.fastq SRR7169793-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,331,728 reads, 16,900,878 reads pseudoaligned [quant] estimated average fragment length: 219.077 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR7169793.ke.tsv 34699 SRR7169793.se.tsv 87100 total ==> SRR7169793.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.92 321 11.4479 Potri.005G024800.1.v4.1 1035 816.923 28 2.20015 Potri.004G059700.1.v4.1 961 742.934 0 0 Potri.007G009000.2.v4.1 1416 1197.92 0 0 Potri.003G141000.2.v4.1 2943 2724.92 320.161 7.54206 Potri.016G087400.1.v4.1 270 89.0445 1481 1067.64 Potri.015G069301.1.v4.1 564 347.869 0 0 Potri.010G195200.1.v4.1 1773 1554.92 17 0.701804 Potri.012G127500.1.v4.1 977 758.928 3377 285.632 ==> SRR7169793.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2996 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 321 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169793 completed mapping pipeline successfully