Starting /dee2/code/volunteer_pipeline.sh SRR7169794 current disk space = 3048603594752 free memory = 1428751144 SRR7169794 SRAfilesize 7dc8b2067cf46005d18c92f194300593 SRR7169794.sra SRR7169794.sra file validated SRR7169794 is paired end SRR7169794 is conventional basespace SRR7169794 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169794_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.0465 18.0 18.0 28.0 18.0 32.0 2 30.16725 31.0 29.0 33.0 27.0 33.0 3 31.761 33.0 31.0 33.0 29.0 33.0 4 32.53325 33.0 33.0 33.0 31.0 33.0 5 33.16775 33.0 33.0 34.0 33.0 34.0 6 37.17925 38.0 37.0 38.0 36.0 38.0 7 37.42025 38.0 38.0 38.0 37.0 38.0 8 37.5545 38.0 38.0 38.0 38.0 38.0 9 37.64725 38.0 38.0 38.0 38.0 38.0 10-14 37.63945 38.0 38.0 38.0 38.0 38.0 15-19 37.66675 38.0 38.0 38.0 38.0 38.0 20-24 37.6756 38.0 38.0 38.0 38.0 38.0 25-29 37.4938 38.0 38.0 38.0 37.4 38.0 30-34 37.618399999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.50835 38.0 38.0 38.0 37.4 38.0 40-44 37.47624999999999 38.0 38.0 38.0 37.4 38.0 45-49 37.3646 38.0 38.0 38.0 36.8 38.0 50-54 37.45355 38.0 38.0 38.0 37.2 38.0 55-59 37.38175 38.0 38.0 38.0 37.0 38.0 60-64 37.3213 38.0 38.0 38.0 36.8 38.0 65-69 37.081700000000005 38.0 38.0 38.0 35.8 38.0 70-74 37.193000000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.58585 38.0 37.6 38.0 34.0 38.0 80-84 37.0413 38.0 38.0 38.0 35.8 38.0 85-89 36.66005 38.0 37.8 38.0 34.2 38.0 90-94 36.844100000000005 38.0 38.0 38.0 35.2 38.0 95-99 36.86945 38.0 38.0 38.0 35.0 38.0 100-104 36.67999999999999 38.0 38.0 38.0 34.8 38.0 105-109 36.634699999999995 38.0 38.0 38.0 34.4 38.0 110-114 36.1069 38.0 37.4 38.0 32.4 38.0 115-119 34.60275 38.0 34.6 38.0 24.0 38.0 120-124 36.044500000000006 38.0 36.8 38.0 33.0 38.0 125-129 35.8019 38.0 36.6 38.0 32.2 38.0 130-134 35.289049999999996 38.0 35.6 38.0 29.4 38.0 135-139 35.11105 38.0 35.4 38.0 29.2 38.0 140-144 33.7488 37.8 34.0 38.0 22.0 38.0 145-149 34.2356 38.0 35.0 38.0 26.4 38.0 150-151 29.317124999999997 35.5 18.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 2.0 17 1.0 18 3.0 19 2.0 20 2.0 21 2.0 22 3.0 23 2.0 24 4.0 25 7.0 26 16.0 27 12.0 28 15.0 29 21.0 30 36.0 31 44.0 32 59.0 33 98.0 34 189.0 35 351.0 36 1083.0 37 2045.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.67254408060453 11.763224181360203 12.594458438287154 35.96977329974811 2 22.875 15.525 31.3 30.3 3 20.75 20.075000000000003 25.95 33.225 4 22.2 28.175 22.925 26.700000000000003 5 21.55 33.175 24.075 21.2 6 20.1 35.425000000000004 24.7 19.775000000000002 7 14.725 26.825 40.5 17.95 8 17.775 26.025 31.974999999999998 24.224999999999998 9 17.5 25.0 34.475 23.025000000000002 10-14 19.794999999999998 30.165 27.05 22.99 15-19 19.96 29.075 27.685 23.28 20-24 20.044999999999998 28.804999999999996 27.245 23.905 25-29 19.86 29.360000000000003 27.515 23.265 30-34 19.275000000000002 29.235 27.985 23.505000000000003 35-39 20.195 28.625 27.415 23.765 40-44 20.02 28.975 27.47 23.535 45-49 20.41 28.499999999999996 27.589999999999996 23.5 50-54 20.535 28.975 27.055 23.435 55-59 20.25 29.28 27.485 22.985 60-64 20.474999999999998 29.099999999999998 27.029999999999998 23.395 65-69 20.200000000000003 28.994999999999997 27.435 23.369999999999997 70-74 19.935 28.525 27.450000000000003 24.09 75-79 20.345 28.875 27.47 23.31 80-84 20.485 28.884999999999998 26.875 23.755000000000003 85-89 20.005 28.749999999999996 26.68 24.565 90-94 20.31 28.355000000000004 27.625 23.71 95-99 20.155 28.199999999999996 27.615000000000002 24.03 100-104 20.330000000000002 28.535 27.08 24.055 105-109 21.035 28.43 27.07 23.465 110-114 20.745 28.299999999999997 26.939999999999998 24.015 115-119 20.580000000000002 28.165000000000003 27.465 23.79 120-124 21.135 28.255000000000003 27.255000000000003 23.355 125-129 21.01 28.27 26.66 24.060000000000002 130-134 20.95 28.084999999999997 26.88 24.085 135-139 20.465 28.765 26.875 23.895 140-144 21.310000000000002 28.110000000000003 26.815 23.765 145-149 21.17 28.549999999999997 25.97 24.310000000000002 150-151 21.1125 28.1 26.637499999999996 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 1.5 25 1.5 26 4.5 27 6.0 28 9.5 29 13.5 30 18.5 31 21.5 32 34.5 33 50.5 34 51.5 35 65.5 36 86.0 37 107.0 38 140.0 39 166.0 40 190.0 41 234.5 42 249.5 43 254.5 44 268.0 45 263.0 46 257.0 47 239.5 48 221.0 49 211.5 50 189.5 51 153.0 52 118.0 53 97.0 54 84.0 55 61.0 56 36.0 57 24.0 58 18.5 59 11.0 60 8.5 61 7.5 62 7.0 63 4.5 64 2.5 65 3.0 66 1.0 67 0.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.2999999999999998 0.0 0.0 0.0 0.0 102-103 1.6375 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.225 0.0 0.0 0.0 0.0 108-109 2.5625 0.0 0.0 0.0 0.0 110-111 2.8 0.0 0.0 0.0 0.0 112-113 3.25 0.0 0.0 0.0 0.0 114-115 3.7375 0.0 0.0 0.0 0.0 116-117 4.25 0.0 0.0 0.0 0.0 118-119 4.6625 0.0 0.0 0.0 0.0 120-121 5.112500000000001 0.0 0.0 0.0 0.0 122-123 5.6875 0.0 0.0 0.0 0.0 124-125 6.25 0.0 0.0 0.0 0.0 126-127 6.725 0.0 0.0 0.0 0.0 128-129 7.125 0.0 0.0 0.0 0.0 130-131 7.55 0.0 0.0 0.0 0.0 132-133 8.3375 0.0 0.0 0.0 0.0 134-135 9.100000000000001 0.0 0.0 0.0 0.0 136-137 9.875 0.0 0.0 0.0 0.0 138-139 10.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCATC 40 0.005621335 54.375 2 >>END_MODULE SRR7169794 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169794_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1315 33.0 33.0 34.0 33.0 34.0 2 33.2735 34.0 33.0 34.0 33.0 34.0 3 33.272 34.0 33.0 34.0 33.0 34.0 4 33.23575 34.0 33.0 34.0 33.0 34.0 5 33.2655 34.0 33.0 34.0 33.0 34.0 6 37.5265 38.0 38.0 38.0 38.0 38.0 7 37.51025 38.0 38.0 38.0 38.0 38.0 8 37.53875 38.0 38.0 38.0 38.0 38.0 9 37.362 38.0 38.0 38.0 38.0 38.0 10-14 37.513 38.0 38.0 38.0 38.0 38.0 15-19 36.965799999999994 38.0 38.0 38.0 36.0 38.0 20-24 37.36220000000001 38.0 38.0 38.0 37.6 38.0 25-29 36.475849999999994 38.0 37.6 38.0 33.2 38.0 30-34 37.36295 38.0 38.0 38.0 37.8 38.0 35-39 37.3936 38.0 38.0 38.0 38.0 38.0 40-44 37.397800000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.31505 38.0 38.0 38.0 37.8 38.0 50-54 37.30195 38.0 38.0 38.0 37.4 38.0 55-59 37.28405 38.0 38.0 38.0 37.6 38.0 60-64 37.19565 38.0 38.0 38.0 36.8 38.0 65-69 36.01885 38.0 37.2 38.0 31.4 38.0 70-74 36.208549999999995 38.0 37.6 38.0 32.4 38.0 75-79 36.9755 38.0 38.0 38.0 36.6 38.0 80-84 36.335950000000004 38.0 37.4 38.0 31.6 38.0 85-89 36.9827 38.0 38.0 38.0 36.4 38.0 90-94 37.00575 38.0 38.0 38.0 36.6 38.0 95-99 36.88415 38.0 38.0 38.0 36.0 38.0 100-104 36.71895 38.0 38.0 38.0 35.8 38.0 105-109 35.903099999999995 38.0 37.6 38.0 32.6 38.0 110-114 35.86935 38.0 38.0 38.0 33.8 38.0 115-119 34.8913 38.0 37.2 38.0 28.6 38.0 120-124 34.86435 38.0 36.8 38.0 27.8 38.0 125-129 34.9425 38.0 36.4 38.0 27.8 38.0 130-134 35.63205 38.0 36.4 38.0 31.6 38.0 135-139 35.575599999999994 38.0 36.2 38.0 32.2 38.0 140-144 35.3095 38.0 36.0 38.0 31.0 38.0 145-149 34.38805 38.0 35.2 38.0 25.8 38.0 150-151 29.924374999999998 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 4.0 5 3.0 6 0.0 7 0.0 8 1.0 9 1.0 10 4.0 11 2.0 12 0.0 13 1.0 14 2.0 15 3.0 16 0.0 17 4.0 18 4.0 19 2.0 20 2.0 21 7.0 22 6.0 23 6.0 24 3.0 25 6.0 26 8.0 27 15.0 28 17.0 29 25.0 30 34.0 31 48.0 32 77.0 33 111.0 34 127.0 35 256.0 36 711.0 37 2502.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.09762202753441 19.22403003754693 16.470588235294116 26.207759699624532 2 26.0 27.05 29.5 17.45 3 21.875 27.975 30.025000000000002 20.125 4 24.45 33.575 22.975 19.0 5 24.349999999999998 36.075 22.525000000000002 17.05 6 20.275000000000002 37.1 23.775 18.85 7 20.5 21.525 38.224999999999994 19.75 8 22.05 24.275 27.275 26.400000000000002 9 24.0 23.549999999999997 30.225 22.225 10-14 23.43 28.28 26.375 21.915000000000003 15-19 23.43 27.82 27.87 20.880000000000003 20-24 23.215 28.57 27.375 20.84 25-29 23.830000000000002 28.84 26.534999999999997 20.794999999999998 30-34 23.695 27.93 27.235 21.14 35-39 23.745 28.265 27.089999999999996 20.9 40-44 23.5 28.305000000000003 27.315 20.880000000000003 45-49 23.54 28.585 26.85 21.025 50-54 23.625 27.905 27.74 20.73 55-59 23.645 27.27 28.665000000000003 20.419999999999998 60-64 23.595 27.815 28.000000000000004 20.59 65-69 23.275000000000002 27.839999999999996 28.38 20.505000000000003 70-74 23.375 28.299999999999997 27.675 20.65 75-79 23.695684859419636 27.419435673833508 28.316543878113563 20.56833558863329 80-84 23.674999999999997 28.155 27.83 20.34 85-89 23.86 27.74 28.53 19.869999999999997 90-94 24.415 27.860000000000003 27.575 20.150000000000002 95-99 24.474999999999998 27.839999999999996 27.725 19.96 100-104 24.560876745233447 28.118901065906023 27.19311414702497 20.12710804183556 105-109 24.152989007679565 27.38041459619535 28.078100687647446 20.388495708477638 110-114 24.072104916704642 28.153324218947795 27.36341080561041 20.411160058737153 115-119 24.29375613283066 28.3323865103548 27.356298094303565 20.017559262510975 120-124 24.581982816278234 27.931265112928948 27.61743067345784 19.86932139733498 125-129 24.919981710105166 28.049585937103082 27.531372250165116 19.49906010262663 130-134 25.110088070456367 28.242594075260207 26.85648518815052 19.790832666132907 135-139 25.145 28.305000000000003 27.200000000000003 19.35 140-144 25.814999999999998 28.46 26.939999999999998 18.785 145-149 25.505 28.134999999999998 27.345000000000002 19.015 150-151 26.4625 27.200000000000003 27.375 18.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.0 27 1.0 28 5.5 29 6.5 30 5.0 31 11.0 32 17.0 33 25.0 34 45.5 35 64.5 36 82.0 37 118.0 38 138.5 39 152.0 40 192.5 41 230.0 42 259.0 43 274.0 44 294.0 45 294.5 46 273.0 47 251.0 48 222.5 49 212.5 50 177.0 51 138.0 52 127.5 53 109.0 54 71.5 55 44.0 56 38.0 57 34.0 58 26.5 59 14.5 60 7.5 61 6.5 62 5.0 63 3.5 64 4.0 65 4.0 66 2.5 67 1.5 68 1.0 69 1.5 70 1.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.23500000000000001 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08499999999999999 105-109 0.385 110-114 1.2550000000000001 115-119 3.1850000000000005 120-124 2.815 125-129 1.585 130-134 0.08 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.6125 0.0 0.0 0.0 0.0 104-105 1.8875000000000002 0.0 0.0 0.0 0.0 106-107 2.1875 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.7750000000000004 0.0 0.0 0.0 0.0 112-113 3.2 0.0 0.0 0.0 0.0 114-115 3.625 0.0 0.0 0.0 0.0 116-117 4.125 0.0 0.0 0.0 0.0 118-119 4.55 0.0 0.0 0.0 0.0 120-121 4.9375 0.0 0.0 0.0 0.0 122-123 5.45 0.0 0.0 0.0 0.0 124-125 5.975 0.0 0.0 0.0 0.0 126-127 6.4375 0.0 0.0 0.0 0.0 128-129 6.85 0.0 0.0 0.0 0.0 130-131 7.2875 0.0 0.0 0.0 0.0 132-133 8.1375 0.0 0.0 0.0 0.0 134-135 8.899999999999999 0.0 0.0 0.0 0.0 136-137 9.675 0.0 0.0 0.0 0.0 138-139 10.462499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577484 spots for SRR7169794.sra Written 577484 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra Read 577474 spots for SRR7169794.sra Written 577474 spots for SRR7169794.sra SRR ids: ['SRR7169794.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vdv6tpyf SRR7169794.sra spots: 11549490 blocks: [[1, 577474], [577475, 1154948], [1154949, 1732422], [1732423, 2309896], [2309897, 2887370], [2887371, 3464844], [3464845, 4042318], [4042319, 4619792], [4619793, 5197266], [5197267, 5774740], [5774741, 6352214], [6352215, 6929688], [6929689, 7507162], [7507163, 8084636], [8084637, 8662110], [8662111, 9239584], [9239585, 9817058], [9817059, 10394532], [10394533, 10972006], [10972007, 11549490]] SRR7169794 file size 3892042 SRR7169794 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169794 SRR7169794_1.fastq SRR7169794_2.fastq Input file: SRR7169794_1.fastq Paired file: SRR7169794_2.fastq trimmed: SRR7169794-trimmed-pair1.fastq, SRR7169794-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:52:43 2025 >> started Tue Feb 11 16:52:57 2025 >> done (13.554s) 11549490 read pairs processed; of these: 12275 ( 0.11%) short read pairs filtered out after trimming by size control 15260 ( 0.13%) empty read pairs filtered out after trimming by size control 11521955 (99.76%) read pairs available; of these: 5420591 (47.05%) trimmed read pairs available after processing 6101364 (52.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 0 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 5 0.00% 28 2 0.00% 29 4 0.00% 30 3 0.00% 31 6 0.00% 32 2 0.00% 33 3 0.00% 34 7 0.00% 35 12 0.00% 36 5 0.00% 37 10 0.00% 38 9 0.00% 39 11 0.00% 40 12 0.00% 41 16 0.00% 42 10 0.00% 43 16 0.00% 44 14 0.00% 45 29 0.00% 46 29 0.00% 47 33 0.00% 48 38 0.00% 49 37 0.00% 50 54 0.00% 51 52 0.00% 52 68 0.00% 53 88 0.00% 54 81 0.00% 55 93 0.00% 56 118 0.00% 57 153 0.00% 58 143 0.00% 59 157 0.00% 60 203 0.00% 61 241 0.00% 62 312 0.00% 63 320 0.00% 64 364 0.00% 65 353 0.00% 66 469 0.00% 67 510 0.00% 68 572 0.00% 69 676 0.01% 70 816 0.01% 71 875 0.01% 72 1069 0.01% 73 1276 0.01% 74 1401 0.01% 75 1582 0.01% 76 1882 0.02% 77 2305 0.02% 78 2250 0.02% 79 2426 0.02% 80 2665 0.02% 81 2997 0.03% 82 3664 0.03% 83 4010 0.03% 84 5009 0.04% 85 5833 0.05% 86 6172 0.05% 87 6673 0.06% 88 7317 0.06% 89 7689 0.07% 90 8066 0.07% 91 8783 0.08% 92 9332 0.08% 93 10285 0.09% 94 11212 0.10% 95 12046 0.10% 96 12738 0.11% 97 13489 0.12% 98 13950 0.12% 99 14391 0.12% 100 15248 0.13% 101 16021 0.14% 102 17119 0.15% 103 18231 0.16% 104 19416 0.17% 105 20501 0.18% 106 21304 0.18% 107 22111 0.19% 108 22704 0.20% 109 23468 0.20% 110 24265 0.21% 111 25179 0.22% 112 26160 0.23% 113 27789 0.24% 114 28428 0.25% 115 29890 0.26% 116 30733 0.27% 117 31647 0.27% 118 32400 0.28% 119 32602 0.28% 120 33204 0.29% 121 34238 0.30% 122 34904 0.30% 123 36809 0.32% 124 38133 0.33% 125 39263 0.34% 126 40949 0.36% 127 41916 0.36% 128 42211 0.37% 129 43037 0.37% 130 44251 0.38% 131 44580 0.39% 132 46025 0.40% 133 47088 0.41% 134 49063 0.43% 135 50461 0.44% 136 52104 0.45% 137 54246 0.47% 138 56097 0.49% 139 58413 0.51% 140 60890 0.53% 141 63533 0.55% 142 68695 0.60% 143 74220 0.64% 144 83338 0.72% 145 95693 0.83% 146 114856 1.00% 147 148682 1.29% 148 221703 1.92% 149 439262 3.81% 150 2489944 21.61% 151 6101364 52.95% 11521955 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=37 prefix-density=0.13 prefix-fanout=2.8 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=285.46 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=36 prefix-density=0.23 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=12 fanout-score=284.00 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=29.6 sequence=AAGAAGAAGAAA SRR7169794 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:53:53 Started mapping on | Feb 11 16:53:53 Finished on | Feb 11 16:55:01 Mapping speed, Million of reads per hour | 609.99 Number of input reads | 11521955 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 9561571 Uniquely mapped reads % | 82.99% Average mapped length | 285.59 Number of splices: Total | 8770731 Number of splices: Annotated (sjdb) | 8620290 Number of splices: GT/AG | 8635522 Number of splices: GC/AG | 106542 Number of splices: AT/AC | 6985 Number of splices: Non-canonical | 21682 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 182027 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 11816 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.30% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1789870 1789870 1789870 N_multimapping 182027 182027 182027 N_noFeature 210825 9458749 255525 N_ambiguous 132615 1664 73182 UnstrandedReadsAssigned:9218131 PositiveStrandReadsAssigned:101158 NegativeStrandReadsAssigned:9232864 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169794 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169794-trimmed-pair1.fastq SRR7169794-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,521,955 reads, 10,509,535 reads pseudoaligned [quant] estimated average fragment length: 205.398 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR7169794.ke.tsv 34699 SRR7169794.se.tsv 87100 total ==> SRR7169794.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.6 206 11.3825 Potri.005G024800.1.v4.1 1035 830.602 31 3.74009 Potri.004G059700.1.v4.1 961 756.607 1 0.132447 Potri.007G009000.2.v4.1 1416 1211.6 0 0 Potri.003G141000.2.v4.1 2943 2738.6 195 7.13541 Potri.016G087400.1.v4.1 270 96.3479 1182 1229.39 Potri.015G069301.1.v4.1 564 361.158 0 0 Potri.010G195200.1.v4.1 1773 1568.6 86 5.49413 Potri.012G127500.1.v4.1 977 772.602 5677 736.337 ==> SRR7169794.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1231 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169794 completed mapping pipeline successfully