Starting /dee2/code/volunteer_pipeline.sh SRR7169795 current disk space = 3053538684928 free memory = 1574326424 SRR7169795 SRAfilesize 8c31669e682995918b0d802ede5be510 SRR7169795.sra SRR7169795.sra file validated SRR7169795 is paired end SRR7169795 is conventional basespace SRR7169795 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169795_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.2245 18.0 18.0 18.0 18.0 32.0 2 28.04625 27.0 27.0 30.0 25.0 31.0 3 30.22625 31.0 29.0 33.0 27.0 33.0 4 32.204 33.0 33.0 33.0 31.0 33.0 5 32.7525 33.0 33.0 33.0 32.0 34.0 6 36.67475 38.0 37.0 38.0 34.0 38.0 7 37.19925 38.0 38.0 38.0 36.0 38.0 8 36.83625 38.0 38.0 38.0 35.0 38.0 9 37.49175 38.0 38.0 38.0 37.0 38.0 10-14 37.56 38.0 38.0 38.0 37.2 38.0 15-19 36.838 38.0 37.8 38.0 34.4 38.0 20-24 37.64425 38.0 38.0 38.0 37.8 38.0 25-29 37.59975 38.0 38.0 38.0 38.0 38.0 30-34 37.48530000000001 38.0 38.0 38.0 37.4 38.0 35-39 37.361450000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.18085 38.0 38.0 38.0 36.4 38.0 45-49 36.849000000000004 38.0 38.0 38.0 35.2 38.0 50-54 37.4538 38.0 38.0 38.0 37.0 38.0 55-59 37.3785 38.0 38.0 38.0 37.0 38.0 60-64 37.33845 38.0 38.0 38.0 37.0 38.0 65-69 37.272000000000006 38.0 38.0 38.0 36.4 38.0 70-74 37.23480000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.12005 38.0 38.0 38.0 36.0 38.0 80-84 36.9716 38.0 38.0 38.0 36.0 38.0 85-89 36.870450000000005 38.0 38.0 38.0 35.4 38.0 90-94 36.72240000000001 38.0 38.0 38.0 34.8 38.0 95-99 36.6652 38.0 38.0 38.0 34.6 38.0 100-104 36.64495 38.0 38.0 38.0 34.6 38.0 105-109 36.4651 38.0 38.0 38.0 34.0 38.0 110-114 35.81035000000001 38.0 36.4 38.0 31.4 38.0 115-119 35.96475 38.0 37.0 38.0 32.6 38.0 120-124 35.97715 38.0 37.0 38.0 33.0 38.0 125-129 35.68005 38.0 36.2 38.0 31.8 38.0 130-134 34.960899999999995 38.0 35.6 38.0 27.2 38.0 135-139 34.882600000000004 38.0 35.0 38.0 28.2 38.0 140-144 34.79785 38.0 35.0 38.0 28.4 38.0 145-149 34.04415 38.0 34.8 38.0 24.8 38.0 150-151 30.1135 36.0 27.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 3.0 17 2.0 18 2.0 19 6.0 20 2.0 21 3.0 22 4.0 23 1.0 24 7.0 25 5.0 26 8.0 27 13.0 28 17.0 29 26.0 30 28.0 31 48.0 32 66.0 33 102.0 34 194.0 35 379.0 36 1079.0 37 2002.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.84582602155929 23.289044873401853 7.620957633492104 34.24417147154675 2 24.05 15.0 32.125 28.825 3 20.090180360721444 18.13627254509018 26.22745490981964 35.54609218436874 4 23.375 24.725 22.775000000000002 29.125 5 22.825 29.65 24.425 23.1 6 20.275000000000002 34.325 24.224999999999998 21.175 7 14.674999999999999 28.549999999999997 39.6 17.175 8 17.325 27.55 30.025000000000002 25.1 9 16.825000000000003 25.6 33.7 23.875 10-14 19.86 30.435000000000002 26.855 22.85 15-19 19.57 29.360000000000003 27.334999999999997 23.735 20-24 19.82 29.57 27.58 23.03 25-29 19.42 28.945 27.715 23.919999999999998 30-34 19.78 28.694999999999997 27.88 23.645 35-39 19.515 29.110000000000003 27.655 23.72 40-44 19.59 28.315 27.694999999999997 24.4 45-49 19.830000000000002 28.405 27.855 23.91 50-54 19.55 29.03 26.85 24.57 55-59 19.84 29.185 27.029999999999998 23.945 60-64 20.57 28.08 27.965 23.385 65-69 20.16 28.58 27.165 24.095 70-74 20.330000000000002 28.76 26.905 24.005000000000003 75-79 20.07 28.599999999999998 27.315 24.015 80-84 20.580000000000002 28.060000000000002 27.800000000000004 23.56 85-89 20.305 28.375 27.325 23.995 90-94 20.044999999999998 28.849999999999998 26.924999999999997 24.18 95-99 20.465 28.52 27.22 23.794999999999998 100-104 20.935000000000002 29.04 27.045 22.98 105-109 20.73725804031411 28.264892712449356 26.894413044565596 24.103436202670935 110-114 20.895 28.79 27.07 23.244999999999997 115-119 21.025 28.88 26.179999999999996 23.915 120-124 20.599999999999998 28.67 26.755000000000003 23.974999999999998 125-129 21.39 28.18 26.63 23.799999999999997 130-134 20.75 27.73 27.195000000000004 24.325 135-139 20.885 28.715000000000003 26.155 24.245 140-144 20.615 28.165000000000003 26.479999999999997 24.740000000000002 145-149 21.055 27.555000000000003 26.625 24.765 150-151 20.2375 28.3875 26.5375 24.837500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 2.0 24 5.5 25 5.5 26 3.0 27 6.5 28 8.0 29 12.5 30 20.5 31 21.5 32 24.5 33 40.5 34 57.0 35 72.5 36 89.5 37 97.0 38 127.5 39 154.0 40 179.5 41 217.0 42 241.0 43 266.5 44 286.5 45 292.0 46 277.5 47 243.0 48 210.0 49 204.5 50 180.0 51 136.5 52 117.5 53 98.5 54 79.0 55 59.0 56 38.5 57 31.5 58 25.0 59 17.5 60 10.0 61 8.0 62 7.5 63 4.5 64 4.5 65 5.0 66 2.5 67 0.5 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.2 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.034999999999999996 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.2761737383881496 0.5499999999999999 3 0.07532011046949535 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.36250000000000004 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.6 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.9125 0.0 0.0 0.0 0.0 88-89 1.1875 0.0 0.0 0.0 0.0 90-91 1.4125 0.0 0.0 0.0 0.0 92-93 1.7125 0.0 0.0 0.0 0.0 94-95 2.0250000000000004 0.0 0.0 0.0 0.0 96-97 2.4375 0.0 0.0 0.0 0.0 98-99 2.7625 0.0 0.0 0.0 0.0 100-101 3.0625 0.0 0.0 0.0 0.0 102-103 3.3875 0.0 0.0 0.0 0.0 104-105 3.8875 0.0 0.0 0.0 0.0 106-107 4.3625 0.0 0.0 0.0 0.0 108-109 4.975 0.0 0.0 0.0 0.0 110-111 5.6 0.0 0.0 0.0 0.0 112-113 6.2875 0.0 0.0 0.0 0.0 114-115 7.0 0.0 0.0 0.0 0.0 116-117 7.75 0.0 0.0 0.0 0.0 118-119 8.6375 0.0 0.0 0.0 0.0 120-121 9.5625 0.0 0.0 0.0 0.0 122-123 10.225 0.0 0.0 0.0 0.0 124-125 10.9625 0.0 0.0 0.0 0.0 126-127 11.8 0.0 0.0 0.0 0.0 128-129 12.7875 0.0 0.0 0.0 0.0 130-131 13.837499999999999 0.0 0.0 0.0 0.0 132-133 14.6 0.0 0.0 0.0 0.0 134-135 15.4625 0.0 0.0 0.0 0.0 136-137 16.5125 0.0 0.0 0.0 0.0 138-139 17.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169795 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169795_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03725 33.0 33.0 34.0 32.0 34.0 2 33.1715 34.0 33.0 34.0 33.0 34.0 3 33.143 34.0 33.0 34.0 33.0 34.0 4 33.172 34.0 33.0 34.0 33.0 34.0 5 33.2145 34.0 33.0 34.0 33.0 34.0 6 37.44425 38.0 38.0 38.0 38.0 38.0 7 37.45325 38.0 38.0 38.0 38.0 38.0 8 37.465 38.0 38.0 38.0 38.0 38.0 9 37.3875 38.0 38.0 38.0 37.0 38.0 10-14 37.007999999999996 38.0 38.0 38.0 36.0 38.0 15-19 37.3634 38.0 38.0 38.0 37.2 38.0 20-24 37.24825 38.0 38.0 38.0 37.0 38.0 25-29 37.3595 38.0 38.0 38.0 37.0 38.0 30-34 36.889250000000004 38.0 37.8 38.0 35.2 38.0 35-39 37.20725 38.0 38.0 38.0 36.8 38.0 40-44 36.626149999999996 38.0 37.8 38.0 33.8 38.0 45-49 37.2976 38.0 38.0 38.0 37.0 38.0 50-54 37.0262 38.0 37.8 38.0 35.4 38.0 55-59 36.98365 38.0 38.0 38.0 35.8 38.0 60-64 37.1344 38.0 38.0 38.0 36.6 38.0 65-69 36.867450000000005 38.0 38.0 38.0 35.6 38.0 70-74 36.87845 38.0 38.0 38.0 35.8 38.0 75-79 36.86215 38.0 38.0 38.0 35.4 38.0 80-84 36.68299999999999 38.0 37.8 38.0 35.0 38.0 85-89 36.903949999999995 38.0 38.0 38.0 35.8 38.0 90-94 36.609449999999995 38.0 38.0 38.0 34.6 38.0 95-99 36.785000000000004 38.0 38.0 38.0 35.2 38.0 100-104 36.3575 38.0 38.0 38.0 33.8 38.0 105-109 35.17545 38.0 37.0 38.0 29.2 38.0 110-114 34.44025 38.0 36.0 38.0 23.8 38.0 115-119 34.0311 38.0 36.4 38.0 21.4 38.0 120-124 33.535 38.0 34.8 38.0 19.0 38.0 125-129 34.4357 38.0 35.2 38.0 25.0 38.0 130-134 34.52915 38.0 35.0 38.0 25.0 38.0 135-139 34.659000000000006 38.0 35.2 38.0 26.4 38.0 140-144 34.52635 38.0 34.4 38.0 27.8 38.0 145-149 33.95975 38.0 33.4 38.0 25.0 38.0 150-151 29.43025 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 0.0 16 2.0 17 1.0 18 3.0 19 7.0 20 10.0 21 6.0 22 6.0 23 5.0 24 12.0 25 24.0 26 16.0 27 14.0 28 32.0 29 25.0 30 56.0 31 91.0 32 121.0 33 133.0 34 196.0 35 326.0 36 687.0 37 2216.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.3 21.45 14.475 28.775000000000002 2 28.549999999999997 26.200000000000003 28.1 17.150000000000002 3 20.355088772193046 29.107276819204802 30.03250812703176 20.505126281570394 4 25.05 32.975 23.599999999999998 18.375 5 25.0 37.025000000000006 21.3 16.675 6 22.525000000000002 36.425000000000004 22.275 18.775 7 21.925 23.25 36.25 18.575 8 22.5 26.400000000000002 26.450000000000003 24.65 9 22.6 24.525 30.075000000000003 22.8 10-14 24.415 28.89 25.77 20.925 15-19 24.375 28.78 26.605 20.24 20-24 23.56 28.52 27.084999999999997 20.835 25-29 23.935000000000002 28.12 26.825 21.12 30-34 23.405 28.68 27.1 20.815 35-39 23.82 28.199999999999996 27.245 20.735 40-44 23.695 27.49 27.79 21.025 45-49 23.365 28.74 27.089999999999996 20.805 50-54 24.215 27.83 27.584999999999997 20.369999999999997 55-59 24.099999999999998 27.825 27.439999999999998 20.635 60-64 23.645 28.110000000000003 27.395000000000003 20.849999999999998 65-69 23.75 28.16 27.810000000000002 20.28 70-74 24.29953385795198 28.038694802265553 27.362036990627036 20.299734349155433 75-79 23.961565408867983 27.8300470423381 27.634871384245823 20.573516164548096 80-84 23.424684936987397 27.440488097619525 28.030606121224245 21.104220844168832 85-89 24.335 27.935 27.365000000000002 20.365 90-94 24.22 28.09 27.73 19.96 95-99 24.63 27.800000000000004 27.85 19.72 100-104 24.519807923169267 27.756102440976388 27.44597839135654 20.278111244497797 105-109 24.425257995299887 27.13804025748442 28.09849800756105 20.338203739654645 110-114 24.855851644070437 27.936211105916577 27.43234117708171 19.775596072931275 115-119 25.157766346714748 27.9100599246964 26.987325661558042 19.94484806703081 120-124 25.554857621440537 27.910385259631493 27.161850921273036 19.37290619765494 125-129 25.989190291658172 27.90128492759535 26.47358759942892 19.635937181317562 130-134 25.779334500875656 27.72579434575932 26.99524643482612 19.499624718538904 135-139 26.515 27.77 26.765 18.95 140-144 26.229999999999997 27.96 26.779999999999998 19.03 145-149 26.955000000000002 26.85 26.855 19.34 150-151 27.5125 26.1625 27.125 19.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.5 28 3.0 29 4.0 30 6.5 31 10.0 32 15.0 33 26.0 34 32.0 35 42.0 36 61.0 37 90.5 38 129.0 39 157.5 40 190.0 41 237.0 42 267.0 43 286.5 44 312.5 45 308.5 46 293.0 47 283.5 48 237.5 49 195.0 50 171.0 51 145.0 52 123.0 53 95.5 54 68.0 55 51.5 56 44.0 57 28.5 58 19.0 59 15.0 60 8.0 61 10.5 62 11.0 63 6.0 64 4.5 65 2.5 66 2.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.245 75-79 0.09 80-84 0.02 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 2.13 110-114 3.7449999999999997 115-119 5.715 120-124 4.4799999999999995 125-129 1.94 130-134 0.075 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67361285463218 99.25 2 0.3012804418779814 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025106703489831784 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.7125 0.0 0.0 0.0 0.0 86-87 0.8875 0.0 0.0 0.0 0.0 88-89 1.1625 0.0 0.0 0.0 0.0 90-91 1.3875 0.0 0.0 0.0 0.0 92-93 1.7000000000000002 0.0 0.0 0.0 0.0 94-95 2.0375 0.0 0.0 0.0 0.0 96-97 2.4625 0.0 0.0 0.0 0.0 98-99 2.7625 0.0 0.0 0.0 0.0 100-101 3.05 0.0 0.0 0.0 0.0 102-103 3.3625 0.0 0.0 0.0 0.0 104-105 3.8375000000000004 0.0 0.0 0.0 0.0 106-107 4.237500000000001 0.0 0.0 0.0 0.0 108-109 4.800000000000001 0.0 0.0 0.0 0.0 110-111 5.2375 0.0 0.0 0.0 0.0 112-113 5.8625 0.0 0.0 0.0 0.0 114-115 6.550000000000001 0.0 0.0 0.0 0.0 116-117 7.25 0.0 0.0 0.0 0.0 118-119 8.0375 0.0 0.0 0.0 0.0 120-121 8.8875 0.0 0.0 0.0 0.0 122-123 9.5625 0.0 0.0 0.0 0.0 124-125 10.325 0.0 0.0 0.0 0.0 126-127 11.125 0.0 0.0 0.0 0.0 128-129 12.149999999999999 0.0 0.0 0.0 0.0 130-131 13.225 0.0 0.0 0.0 0.0 132-133 13.975 0.0 0.0 0.0 0.0 134-135 14.850000000000001 0.0 0.0 0.0 0.0 136-137 15.850000000000001 0.0 0.0 0.0 0.0 138-139 16.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGCAAT 10 0.007090778 143.2 9 TTGTGAC 10 0.007090778 143.2 9 ATTTTGT 10 0.007090778 143.2 6 TTTGTGA 10 0.007090778 143.2 8 >>END_MODULE Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975797 spots for SRR7169795.sra Written 975797 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra Read 975790 spots for SRR7169795.sra Written 975790 spots for SRR7169795.sra SRR ids: ['SRR7169795.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4k64ckn_ SRR7169795.sra spots: 19515807 blocks: [[1, 975790], [975791, 1951580], [1951581, 2927370], [2927371, 3903160], [3903161, 4878950], [4878951, 5854740], [5854741, 6830530], [6830531, 7806320], [7806321, 8782110], [8782111, 9757900], [9757901, 10733690], [10733691, 11709480], [11709481, 12685270], [12685271, 13661060], [13661061, 14636850], [14636851, 15612640], [15612641, 16588430], [16588431, 17564220], [17564221, 18540010], [18540011, 19515807]] SRR7169795 file size 6591566 SRR7169795 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169795 SRR7169795_1.fastq SRR7169795_2.fastq Input file: SRR7169795_1.fastq Paired file: SRR7169795_2.fastq trimmed: SRR7169795-trimmed-pair1.fastq, SRR7169795-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:44:11 2025 >> started Tue Feb 11 18:44:33 2025 >> done (21.834s) 19515807 read pairs processed; of these: 13659 ( 0.07%) short read pairs filtered out after trimming by size control 45701 ( 0.23%) empty read pairs filtered out after trimming by size control 19456447 (99.70%) read pairs available; of these: 10776586 (55.39%) trimmed read pairs available after processing 8679861 (44.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 10 0.00% 20 5 0.00% 21 4 0.00% 22 15 0.00% 23 7 0.00% 24 8 0.00% 25 11 0.00% 26 15 0.00% 27 10 0.00% 28 18 0.00% 29 10 0.00% 30 24 0.00% 31 22 0.00% 32 37 0.00% 33 35 0.00% 34 32 0.00% 35 40 0.00% 36 38 0.00% 37 55 0.00% 38 71 0.00% 39 76 0.00% 40 97 0.00% 41 108 0.00% 42 102 0.00% 43 114 0.00% 44 129 0.00% 45 158 0.00% 46 168 0.00% 47 208 0.00% 48 262 0.00% 49 246 0.00% 50 286 0.00% 51 336 0.00% 52 417 0.00% 53 431 0.00% 54 480 0.00% 55 493 0.00% 56 560 0.00% 57 632 0.00% 58 728 0.00% 59 914 0.00% 60 1009 0.01% 61 1224 0.01% 62 1498 0.01% 63 1627 0.01% 64 1854 0.01% 65 1995 0.01% 66 2214 0.01% 67 2511 0.01% 68 2722 0.01% 69 3068 0.02% 70 3614 0.02% 71 4113 0.02% 72 4980 0.03% 73 5658 0.03% 74 6336 0.03% 75 7479 0.04% 76 10196 0.05% 77 10657 0.05% 78 9624 0.05% 79 10347 0.05% 80 11191 0.06% 81 12848 0.07% 82 14282 0.07% 83 15751 0.08% 84 18400 0.09% 85 20476 0.11% 86 21998 0.11% 87 23336 0.12% 88 24789 0.13% 89 26101 0.13% 90 27977 0.14% 91 28832 0.15% 92 31397 0.16% 93 34276 0.18% 94 36679 0.19% 95 39301 0.20% 96 41645 0.21% 97 42329 0.22% 98 43930 0.23% 99 44667 0.23% 100 46920 0.24% 101 48681 0.25% 102 51128 0.26% 103 53474 0.27% 104 55974 0.29% 105 58877 0.30% 106 61479 0.32% 107 62120 0.32% 108 63306 0.33% 109 65483 0.34% 110 65497 0.34% 111 66536 0.34% 112 69171 0.36% 113 71365 0.37% 114 73957 0.38% 115 77256 0.40% 116 79516 0.41% 117 81425 0.42% 118 82030 0.42% 119 82515 0.42% 120 83248 0.43% 121 84196 0.43% 122 85955 0.44% 123 87645 0.45% 124 90299 0.46% 125 93481 0.48% 126 95531 0.49% 127 97822 0.50% 128 98810 0.51% 129 99857 0.51% 130 101673 0.52% 131 101621 0.52% 132 103785 0.53% 133 106005 0.54% 134 108436 0.56% 135 111947 0.58% 136 115335 0.59% 137 118449 0.61% 138 121765 0.63% 139 126375 0.65% 140 130024 0.67% 141 136909 0.70% 142 144828 0.74% 143 156846 0.81% 144 173094 0.89% 145 200840 1.03% 146 241657 1.24% 147 312280 1.61% 148 441651 2.27% 149 847569 4.36% 150 3981595 20.46% 151 8679861 44.61% 19456447 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=36 prefix-density=0.18 prefix-fanout=2.3 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=110.99 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.4 sequence=AAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTGAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTACTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=41 prefix-density=0.16 prefix-fanout=2.2 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=32 fanout-score=99.09 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=16.5 sequence=TGCTGCTGACCCCAGGATTGAAATTTGCATGCTTCCTGTTGGTGATGG SRR7169795 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:45:17 Started mapping on | Feb 11 18:45:17 Finished on | Feb 11 18:47:05 Mapping speed, Million of reads per hour | 648.55 Number of input reads | 19456447 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 18543207 Uniquely mapped reads % | 95.31% Average mapped length | 285.96 Number of splices: Total | 15817466 Number of splices: Annotated (sjdb) | 15518011 Number of splices: GT/AG | 15573499 Number of splices: GC/AG | 193282 Number of splices: AT/AC | 14679 Number of splices: Non-canonical | 36006 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323289 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 118656 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.32% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 601688 601688 601688 N_multimapping 323289 323289 323289 N_noFeature 469188 18266470 610879 N_ambiguous 217148 1446 80999 UnstrandedReadsAssigned:17856871 PositiveStrandReadsAssigned:275291 NegativeStrandReadsAssigned:17851329 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=140 echo kmer=135 SRR7169795 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169795-trimmed-pair1.fastq SRR7169795-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,456,447 reads, 17,870,755 reads pseudoaligned [quant] estimated average fragment length: 198.169 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR7169795.ke.tsv 34699 SRR7169795.se.tsv 87100 total ==> SRR7169795.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1820.83 461 14.8331 Potri.005G024800.1.v4.1 1035 837.831 101 7.0626 Potri.004G059700.1.v4.1 961 763.845 23 1.7641 Potri.007G009000.2.v4.1 1416 1218.83 0 0 Potri.003G141000.2.v4.1 2943 2745.83 363 7.7452 Potri.016G087400.1.v4.1 270 100.264 1462 854.281 Potri.015G069301.1.v4.1 564 368.164 0 0 Potri.010G195200.1.v4.1 1773 1575.83 155.768 5.7912 Potri.012G127500.1.v4.1 977 779.839 8122 610.181 ==> SRR7169795.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2224 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 431 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169795 completed mapping pipeline successfully