Starting /dee2/code/volunteer_pipeline.sh SRR7169796 current disk space = 3053425184768 free memory = 1451385208 SRR7169796 SRAfilesize a71ee5847038df3578d3f0f05b02bedc SRR7169796.sra SRR7169796.sra file validated SRR7169796 is paired end SRR7169796 is conventional basespace SRR7169796 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169796_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.5505 18.0 18.0 30.0 18.0 32.0 2 29.96075 31.0 29.0 33.0 27.0 33.0 3 31.69075 33.0 31.0 33.0 29.0 33.0 4 32.61 33.0 33.0 33.0 32.0 34.0 5 32.93025 33.0 33.0 34.0 32.0 34.0 6 36.9135 38.0 37.0 38.0 35.0 38.0 7 37.207 38.0 38.0 38.0 36.0 38.0 8 37.444 38.0 38.0 38.0 37.0 38.0 9 37.519 38.0 38.0 38.0 37.0 38.0 10-14 37.592749999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.60455 38.0 38.0 38.0 38.0 38.0 20-24 37.6263 38.0 38.0 38.0 38.0 38.0 25-29 37.60645 38.0 38.0 38.0 38.0 38.0 30-34 37.616899999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.520050000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.51115 38.0 38.0 38.0 38.0 38.0 45-49 37.51285 38.0 38.0 38.0 38.0 38.0 50-54 37.4285 38.0 38.0 38.0 37.4 38.0 55-59 37.2348 38.0 38.0 38.0 36.8 38.0 60-64 36.9774 38.0 38.0 38.0 35.6 38.0 65-69 37.235949999999995 38.0 38.0 38.0 36.8 38.0 70-74 37.294 38.0 38.0 38.0 37.0 38.0 75-79 37.153800000000004 38.0 38.0 38.0 36.4 38.0 80-84 37.2054 38.0 38.0 38.0 36.4 38.0 85-89 37.1661 38.0 38.0 38.0 36.2 38.0 90-94 36.92379999999999 38.0 38.0 38.0 35.8 38.0 95-99 37.0498 38.0 38.0 38.0 36.0 38.0 100-104 37.0299 38.0 38.0 38.0 36.0 38.0 105-109 36.896 38.0 38.0 38.0 35.4 38.0 110-114 36.774 38.0 38.0 38.0 35.0 38.0 115-119 36.598800000000004 38.0 38.0 38.0 34.6 38.0 120-124 36.60105 38.0 38.0 38.0 34.4 38.0 125-129 36.3815 38.0 38.0 38.0 34.0 38.0 130-134 36.17569999999999 38.0 37.2 38.0 33.4 38.0 135-139 35.93945 38.0 37.4 38.0 32.8 38.0 140-144 35.696 38.0 36.0 38.0 32.4 38.0 145-149 35.29925000000001 38.0 35.8 38.0 31.6 38.0 150-151 30.495375 36.0 28.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 2.0 17 2.0 18 1.0 19 1.0 20 1.0 21 1.0 22 0.0 23 2.0 24 5.0 25 3.0 26 8.0 27 15.0 28 16.0 29 16.0 30 37.0 31 32.0 32 67.0 33 84.0 34 117.0 35 198.0 36 600.0 37 2788.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.45 12.45 8.15 38.95 2 21.65206508135169 15.41927409261577 34.993742177722154 27.934918648310386 3 20.1 19.425 25.324999999999996 35.15 4 23.275000000000002 28.375 22.400000000000002 25.95 5 22.5 33.5 23.599999999999998 20.4 6 19.025 36.075 24.55 20.349999999999998 7 15.35 25.75 41.375 17.525 8 17.675 26.8 30.575000000000003 24.95 9 17.025000000000002 24.45 33.925 24.6 10-14 19.79 29.65 27.250000000000004 23.31 15-19 19.744999999999997 28.925 28.01 23.32 20-24 19.81 28.810000000000002 27.765 23.615 25-29 20.215 29.115000000000002 27.255000000000003 23.415 30-34 20.48 28.835 27.38 23.305 35-39 20.380000000000003 29.435 26.715 23.47 40-44 20.11 29.244999999999997 26.845000000000002 23.799999999999997 45-49 20.05 28.189999999999998 27.750000000000004 24.01 50-54 19.775000000000002 28.744999999999997 27.445000000000004 24.035 55-59 20.294999999999998 28.595 27.46 23.65 60-64 20.23 28.12 27.325 24.325 65-69 20.27 28.16 27.250000000000004 24.32 70-74 19.855 28.315 27.865000000000002 23.965 75-79 20.200000000000003 28.28 27.615000000000002 23.905 80-84 19.875 28.57 27.389999999999997 24.165 85-89 20.265 28.485 27.41 23.84 90-94 20.43 28.875 27.169999999999998 23.525 95-99 20.555 28.46 27.46 23.525 100-104 19.78 29.065 27.22 23.935000000000002 105-109 20.985 28.444999999999997 26.565 24.005000000000003 110-114 20.732439463678208 28.59715829497699 27.176305783470085 23.494096457874726 115-119 20.845 28.785 26.595000000000002 23.775 120-124 20.51 28.79 26.82 23.880000000000003 125-129 20.549999999999997 29.049999999999997 26.590000000000003 23.810000000000002 130-134 20.79 28.825 26.43 23.955000000000002 135-139 21.2 28.615000000000002 26.22 23.965 140-144 20.785 28.715000000000003 26.450000000000003 24.05 145-149 21.26 28.605000000000004 26.540000000000003 23.595 150-151 20.549999999999997 27.725 26.8125 24.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 3.0 25 5.0 26 4.5 27 3.0 28 8.0 29 14.5 30 16.5 31 20.0 32 27.5 33 51.0 34 62.5 35 68.5 36 86.0 37 96.0 38 125.0 39 158.5 40 193.5 41 214.0 42 226.0 43 251.5 44 274.5 45 279.5 46 257.5 47 250.0 48 227.0 49 203.0 50 191.0 51 153.5 52 115.0 53 98.0 54 81.5 55 59.0 56 44.5 57 31.0 58 26.0 59 18.5 60 12.5 61 11.0 62 7.0 63 6.0 64 5.0 65 2.5 66 2.0 67 1.0 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.06 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.2625 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 3.0875 0.0 0.0 0.0 0.0 108-109 3.4625 0.0 0.0 0.0 0.0 110-111 3.7875 0.0 0.0 0.0 0.0 112-113 4.3 0.0 0.0 0.0 0.0 114-115 4.550000000000001 0.0 0.0 0.0 0.0 116-117 5.074999999999999 0.0 0.0 0.0 0.0 118-119 5.7125 0.0 0.0 0.0 0.0 120-121 6.35 0.0 0.0 0.0 0.0 122-123 6.85 0.0 0.0 0.0 0.0 124-125 7.375 0.0 0.0 0.0 0.0 126-127 7.8625 0.0 0.0 0.0 0.0 128-129 8.3625 0.0 0.0 0.0 0.0 130-131 8.8 0.0 0.0 0.0 0.0 132-133 9.175 0.0 0.0 0.0 0.0 134-135 9.962499999999999 0.0 0.0 0.0 0.0 136-137 10.5 0.0 0.0 0.0 0.0 138-139 11.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGTTG 10 0.006846698 144.88751 9 AAGAGCA 40 0.0056386297 54.332813 145 >>END_MODULE SRR7169796 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169796_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99575 33.0 33.0 34.0 32.0 34.0 2 33.087 34.0 33.0 34.0 32.0 34.0 3 33.094 34.0 33.0 34.0 33.0 34.0 4 33.09375 34.0 33.0 34.0 33.0 34.0 5 33.06725 34.0 33.0 34.0 33.0 34.0 6 37.24325 38.0 38.0 38.0 37.0 38.0 7 37.36525 38.0 38.0 38.0 37.0 38.0 8 37.269 38.0 38.0 38.0 37.0 38.0 9 37.3525 38.0 38.0 38.0 37.0 38.0 10-14 37.29615 38.0 38.0 38.0 37.2 38.0 15-19 37.1092 38.0 38.0 38.0 36.8 38.0 20-24 37.17955 38.0 38.0 38.0 37.0 38.0 25-29 37.19405 38.0 38.0 38.0 37.0 38.0 30-34 37.0873 38.0 38.0 38.0 36.4 38.0 35-39 37.057849999999995 38.0 38.0 38.0 36.6 38.0 40-44 37.12285000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.1635 38.0 38.0 38.0 37.0 38.0 50-54 37.020599999999995 38.0 38.0 38.0 36.8 38.0 55-59 36.7276 38.0 38.0 38.0 35.4 38.0 60-64 36.5133 38.0 38.0 38.0 34.0 38.0 65-69 36.9406 38.0 38.0 38.0 36.0 38.0 70-74 36.88865 38.0 38.0 38.0 36.0 38.0 75-79 35.649699999999996 38.0 38.0 38.0 32.0 38.0 80-84 36.4775 38.0 38.0 38.0 34.4 38.0 85-89 36.28660000000001 38.0 37.4 38.0 31.8 38.0 90-94 36.5192 38.0 37.8 38.0 34.0 38.0 95-99 36.6152 38.0 38.0 38.0 35.0 38.0 100-104 36.37635 38.0 38.0 38.0 34.0 38.0 105-109 34.62615 38.0 36.6 38.0 26.4 38.0 110-114 33.626999999999995 38.0 36.2 38.0 16.6 38.0 115-119 32.62115 38.0 35.8 38.0 4.2 38.0 120-124 32.946400000000004 38.0 35.4 38.0 11.6 38.0 125-129 33.63105 38.0 35.2 38.0 18.4 38.0 130-134 34.423399999999994 38.0 35.2 38.0 23.8 38.0 135-139 34.27785 38.0 34.8 38.0 24.8 38.0 140-144 34.6425 38.0 35.6 38.0 27.8 38.0 145-149 32.97775 37.6 32.8 38.0 20.6 38.0 150-151 30.02775 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 2.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 2.0 11 0.0 12 2.0 13 1.0 14 1.0 15 1.0 16 4.0 17 4.0 18 8.0 19 7.0 20 7.0 21 5.0 22 11.0 23 15.0 24 19.0 25 22.0 26 18.0 27 16.0 28 56.0 29 58.0 30 76.0 31 94.0 32 113.0 33 140.0 34 155.0 35 277.0 36 630.0 37 2244.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.074999999999996 20.025000000000002 13.825000000000001 28.075 2 25.481370342585645 26.506626656664167 30.23255813953488 17.779444861215303 3 20.740555416562422 28.621466099574683 30.79809857393045 19.83987990993245 4 22.734101151727593 34.75212819228843 23.410115172759138 19.103655483224838 5 24.58729364682341 35.5927963981991 22.56128064032016 17.258629314657327 6 21.6 37.325 22.425 18.65 7 19.400000000000002 21.349999999999998 39.425 19.825 8 22.325 24.8 27.35 25.525 9 23.525 24.3 29.525000000000002 22.650000000000002 10-14 23.369999999999997 28.34 26.974999999999998 21.315 15-19 22.979595919183836 27.540508101620325 28.310662132426483 21.16923384676935 20-24 22.91 27.915 28.215 20.96 25-29 23.575 28.34 27.815 20.27 30-34 22.79113955697785 27.711385569278463 28.521426071303562 20.976048802440122 35-39 22.965 27.61 28.49 20.935000000000002 40-44 23.02 27.750000000000004 28.749999999999996 20.48 45-49 23.427342734273427 27.542754275427544 28.18781878187819 20.842084208420843 50-54 23.46024916195527 27.773052484114675 28.253364687046577 20.513333666883472 55-59 23.55971194238848 28.060612122424484 27.895579115823168 20.484096819363874 60-64 23.326166308315415 28.57142857142857 27.9813990699535 20.121006050302515 65-69 23.580000000000002 28.38 27.615000000000002 20.424999999999997 70-74 23.34969448061705 27.84734047881398 28.558549534208154 20.244415506360813 75-79 23.669338265515822 27.93362104397863 28.216193999177968 20.180846691327577 80-84 23.69161225514817 27.55901557006529 28.64892014063285 20.100452034153694 85-89 23.544999999999998 27.1 28.655 20.7 90-94 24.286214310715536 27.45137256862843 27.876393819690986 20.386019300965046 95-99 24.04101025256314 27.656914228557138 28.077019254813703 20.225056264066016 100-104 24.572200540378265 27.58430901631142 27.519263484439104 20.32422695887121 105-109 24.25226897689769 27.727929042904293 27.841377887788777 20.17842409240924 110-114 24.8723049626324 27.35630947900425 27.71654390020969 20.054841658153663 115-119 24.84423676012461 28.15976858032933 27.186248331108143 19.809746328437917 120-124 25.1156462585034 27.755102040816325 27.346938775510203 19.782312925170068 125-129 25.29164477141356 27.43562795585917 27.577509196006307 19.695218076720966 130-134 25.10016025641026 27.609174679487182 27.488982371794872 19.801682692307693 135-139 25.040000000000003 27.01 28.389999999999997 19.56 140-144 25.505 27.224999999999998 27.560000000000002 19.71 145-149 25.486274313715683 27.631381569078457 27.29136456822841 19.59097954897745 150-151 26.152102744900528 26.693528078569628 27.159405691261647 19.994963485268194 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 2.5 24 3.5 25 2.5 26 3.5 27 4.0 28 7.0 29 9.5 30 14.0 31 20.0 32 25.5 33 31.0 34 41.5 35 61.0 36 82.5 37 108.0 38 125.5 39 148.5 40 200.5 41 249.5 42 275.0 43 291.5 44 301.0 45 306.5 46 290.0 47 252.0 48 211.5 49 181.5 50 164.5 51 138.0 52 101.5 53 77.5 54 72.5 55 51.5 56 35.5 57 33.0 58 23.5 59 13.5 60 6.5 61 6.5 62 6.0 63 4.0 64 2.5 65 2.0 66 1.5 67 1.0 68 1.5 69 2.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.025 3 0.075 4 0.15 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.02 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.065 55-59 0.02 60-64 0.005 65-69 0.0 70-74 0.16999999999999998 75-79 2.68 80-84 0.44999999999999996 85-89 0.0 90-94 0.005 95-99 0.025 100-104 0.06999999999999999 105-109 3.04 110-114 7.005 115-119 10.12 120-124 8.125 125-129 4.8500000000000005 130-134 0.16 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.7250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.8125 0.0 0.0 0.0 0.0 102-103 2.2 0.0 0.0 0.0 0.0 104-105 2.4875 0.0 0.0 0.0 0.0 106-107 2.9625 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 3.625 0.0 0.0 0.0 0.0 112-113 4.15 0.0 0.0 0.0 0.0 114-115 4.325 0.0 0.0 0.0 0.0 116-117 4.8 0.0 0.0 0.0 0.0 118-119 5.362500000000001 0.0 0.0 0.0 0.0 120-121 5.925000000000001 0.0 0.0 0.0 0.0 122-123 6.4 0.0 0.0 0.0 0.0 124-125 6.85 0.0 0.0 0.0 0.0 126-127 7.3125 0.0 0.0 0.0 0.0 128-129 7.7375 0.0 0.0 0.0 0.0 130-131 8.15 0.0 0.0 0.0 0.0 132-133 8.525 0.0 0.0 0.0 0.0 134-135 9.287500000000001 0.0 0.0 0.0 0.0 136-137 9.775 0.0 0.0 0.0 0.0 138-139 10.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGATA 10 0.0071765934 142.62502 5 AGATATT 10 0.0071765934 142.62502 7 >>END_MODULE Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra Read 1024097 spots for SRR7169796.sra Written 1024097 spots for SRR7169796.sra Read 1024095 spots for SRR7169796.sra Written 1024095 spots for SRR7169796.sra SRR ids: ['SRR7169796.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8chh_rwd SRR7169796.sra spots: 20481902 blocks: [[1, 1024095], [1024096, 2048190], [2048191, 3072285], [3072286, 4096380], [4096381, 5120475], [5120476, 6144570], [6144571, 7168665], [7168666, 8192760], [8192761, 9216855], [9216856, 10240950], [10240951, 11265045], [11265046, 12289140], [12289141, 13313235], [13313236, 14337330], [14337331, 15361425], [15361426, 16385520], [16385521, 17409615], [17409616, 18433710], [18433711, 19457805], [19457806, 20481902]] SRR7169796 file size 6918944 SRR7169796 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169796 SRR7169796_1.fastq SRR7169796_2.fastq Input file: SRR7169796_1.fastq Paired file: SRR7169796_2.fastq trimmed: SRR7169796-trimmed-pair1.fastq, SRR7169796-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:22:10 2025 >> started Tue Feb 11 18:22:32 2025 >> done (22.473s) 20481902 read pairs processed; of these: 14492 ( 0.07%) short read pairs filtered out after trimming by size control 16463 ( 0.08%) empty read pairs filtered out after trimming by size control 20450947 (99.85%) read pairs available; of these: 9501392 (46.46%) trimmed read pairs available after processing 10949555 (53.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 0 0.00% 21 4 0.00% 22 11 0.00% 23 3 0.00% 24 8 0.00% 25 5 0.00% 26 8 0.00% 27 5 0.00% 28 5 0.00% 29 5 0.00% 30 16 0.00% 31 17 0.00% 32 25 0.00% 33 16 0.00% 34 26 0.00% 35 19 0.00% 36 24 0.00% 37 30 0.00% 38 43 0.00% 39 48 0.00% 40 44 0.00% 41 59 0.00% 42 55 0.00% 43 74 0.00% 44 75 0.00% 45 73 0.00% 46 97 0.00% 47 123 0.00% 48 119 0.00% 49 168 0.00% 50 177 0.00% 51 233 0.00% 52 234 0.00% 53 251 0.00% 54 289 0.00% 55 331 0.00% 56 355 0.00% 57 372 0.00% 58 448 0.00% 59 546 0.00% 60 583 0.00% 61 774 0.00% 62 821 0.00% 63 926 0.00% 64 1032 0.01% 65 1108 0.01% 66 1192 0.01% 67 1443 0.01% 68 1613 0.01% 69 1768 0.01% 70 2159 0.01% 71 2371 0.01% 72 2740 0.01% 73 3076 0.02% 74 3708 0.02% 75 4141 0.02% 76 4800 0.02% 77 5120 0.03% 78 5234 0.03% 79 5753 0.03% 80 6223 0.03% 81 7268 0.04% 82 8130 0.04% 83 9176 0.04% 84 10712 0.05% 85 12061 0.06% 86 12774 0.06% 87 13686 0.07% 88 15037 0.07% 89 15358 0.08% 90 16768 0.08% 91 18308 0.09% 92 19673 0.10% 93 21408 0.10% 94 23063 0.11% 95 24391 0.12% 96 26244 0.13% 97 26885 0.13% 98 28116 0.14% 99 29085 0.14% 100 30943 0.15% 101 31980 0.16% 102 34141 0.17% 103 36034 0.18% 104 38251 0.19% 105 40169 0.20% 106 41567 0.20% 107 42942 0.21% 108 43654 0.21% 109 44696 0.22% 110 45759 0.22% 111 47833 0.23% 112 49594 0.24% 113 51430 0.25% 114 54031 0.26% 115 56046 0.27% 116 57198 0.28% 117 58269 0.28% 118 59209 0.29% 119 59427 0.29% 120 60623 0.30% 121 62520 0.31% 122 63698 0.31% 123 66447 0.32% 124 68744 0.34% 125 71275 0.35% 126 73379 0.36% 127 75392 0.37% 128 76366 0.37% 129 77685 0.38% 130 78247 0.38% 131 79457 0.39% 132 81735 0.40% 133 84189 0.41% 134 86163 0.42% 135 89648 0.44% 136 92610 0.45% 137 95335 0.47% 138 98971 0.48% 139 103013 0.50% 140 107580 0.53% 141 113363 0.55% 142 119980 0.59% 143 128924 0.63% 144 144133 0.70% 145 164850 0.81% 146 194998 0.95% 147 250528 1.23% 148 368612 1.80% 149 797014 3.90% 150 4203562 20.55% 151 10949555 53.54% 20450947 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=41 prefix-density=0.17 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=308.70 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=18.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=40 prefix-density=0.30 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=162.66 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=14.0 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169796 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:23:17 Started mapping on | Feb 11 18:23:18 Finished on | Feb 11 18:25:14 Mapping speed, Million of reads per hour | 634.68 Number of input reads | 20450947 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 19544093 Uniquely mapped reads % | 95.57% Average mapped length | 290.66 Number of splices: Total | 17746937 Number of splices: Annotated (sjdb) | 17440822 Number of splices: GT/AG | 17479639 Number of splices: GC/AG | 211395 Number of splices: AT/AC | 14825 Number of splices: Non-canonical | 41078 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354920 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 48857 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 565649 565649 565649 N_multimapping 354920 354920 354920 N_noFeature 496398 19320489 608964 N_ambiguous 188949 1122 77058 UnstrandedReadsAssigned:18858746 PositiveStrandReadsAssigned:222482 NegativeStrandReadsAssigned:18858071 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169796 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169796-trimmed-pair1.fastq SRR7169796-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,450,947 reads, 18,764,515 reads pseudoaligned [quant] estimated average fragment length: 217.215 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7169796.ke.tsv 34699 SRR7169796.se.tsv 87100 total ==> SRR7169796.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.79 370 11.5656 Potri.005G024800.1.v4.1 1035 818.785 53 3.64566 Potri.004G059700.1.v4.1 961 744.806 13 0.983039 Potri.007G009000.2.v4.1 1416 1199.79 0 0 Potri.003G141000.2.v4.1 2943 2726.79 347.028 7.16776 Potri.016G087400.1.v4.1 270 91.8237 1837 1126.74 Potri.015G069301.1.v4.1 564 350.775 0 0 Potri.010G195200.1.v4.1 1773 1556.79 35 1.26622 Potri.012G127500.1.v4.1 977 760.796 8471 627.1 ==> SRR7169796.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1789 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 385 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169796 completed mapping pipeline successfully