Starting /dee2/code/volunteer_pipeline.sh SRR7169797 current disk space = 3049635643392 free memory = 1407069032 SRR7169797 SRAfilesize c584047c8484e5cd62aa4e0b0af05099 SRR7169797.sra SRR7169797.sra file validated SRR7169797 is paired end SRR7169797 is conventional basespace SRR7169797 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169797_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.52875 33.0 33.0 34.0 32.0 34.0 2 33.163 34.0 33.0 34.0 32.0 34.0 3 33.17625 34.0 33.0 34.0 31.0 34.0 4 33.212 34.0 33.0 34.0 33.0 34.0 5 33.29725 34.0 33.0 34.0 33.0 34.0 6 37.18675 38.0 37.0 38.0 36.0 38.0 7 37.4065 38.0 38.0 38.0 37.0 38.0 8 37.39475 38.0 38.0 38.0 37.0 38.0 9 37.568 38.0 38.0 38.0 38.0 38.0 10-14 37.516450000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.5624 38.0 38.0 38.0 38.0 38.0 20-24 37.55575 38.0 38.0 38.0 38.0 38.0 25-29 37.492599999999996 38.0 38.0 38.0 37.8 38.0 30-34 37.4952 38.0 38.0 38.0 37.8 38.0 35-39 37.41275 38.0 38.0 38.0 37.4 38.0 40-44 37.317449999999994 38.0 38.0 38.0 36.8 38.0 45-49 37.41185 38.0 38.0 38.0 37.0 38.0 50-54 37.243050000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.036500000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.09075 38.0 38.0 38.0 36.2 38.0 65-69 37.0886 38.0 38.0 38.0 36.0 38.0 70-74 37.18535000000001 38.0 38.0 38.0 36.2 38.0 75-79 37.0148 38.0 38.0 38.0 36.0 38.0 80-84 36.97070000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.6674 38.0 38.0 38.0 35.0 38.0 90-94 36.849900000000005 38.0 38.0 38.0 35.2 38.0 95-99 36.76684999999999 38.0 38.0 38.0 35.2 38.0 100-104 36.588350000000005 38.0 38.0 38.0 34.2 38.0 105-109 35.65015 38.0 37.8 38.0 29.8 38.0 110-114 34.8691 38.0 37.0 38.0 26.0 38.0 115-119 35.97455000000001 38.0 37.4 38.0 32.2 38.0 120-124 36.112849999999995 38.0 37.4 38.0 33.6 38.0 125-129 36.01365 38.0 37.0 38.0 33.0 38.0 130-134 35.756 38.0 36.6 38.0 32.2 38.0 135-139 35.28565 38.0 35.8 38.0 30.0 38.0 140-144 34.5575 38.0 35.0 38.0 26.0 38.0 145-149 34.45225 38.0 35.0 38.0 27.6 38.0 150-151 30.883000000000003 36.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 1.0 15 3.0 16 0.0 17 2.0 18 3.0 19 3.0 20 1.0 21 2.0 22 1.0 23 3.0 24 7.0 25 10.0 26 17.0 27 18.0 28 21.0 29 25.0 30 59.0 31 49.0 32 61.0 33 79.0 34 153.0 35 320.0 36 655.0 37 2504.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.52554375316136 11.63378856853819 9.003540718259991 35.837126960040464 2 21.6 15.65 35.5 27.250000000000004 3 19.725 21.775 26.3 32.2 4 22.025 29.9 22.650000000000002 25.424999999999997 5 22.525000000000002 33.575 23.775 20.125 6 18.175 35.825 26.8 19.2 7 13.750000000000002 26.05 41.25 18.95 8 18.088566424818612 24.043032274205654 31.39854891168376 26.46985238929197 9 16.0 26.5 32.225 25.275 10-14 20.455000000000002 29.68 26.77 23.095 15-19 19.88 28.410000000000004 27.894999999999996 23.815 20-24 19.725 28.89 27.92 23.465 25-29 19.765 28.849999999999998 27.875 23.51 30-34 20.02 28.634999999999998 27.584999999999997 23.76 35-39 19.869999999999997 29.165000000000003 27.24 23.724999999999998 40-44 19.84 28.725 27.955000000000002 23.48 45-49 20.115 28.63 27.315 23.94 50-54 19.936993699369935 28.757875787578758 28.20782078207821 23.097309730973098 55-59 20.325 28.705000000000002 27.47 23.5 60-64 20.345 28.87 27.27 23.515 65-69 20.08600430021501 28.72643632181609 27.896394819740987 23.291164558227912 70-74 19.919999999999998 28.810000000000002 27.445000000000004 23.825 75-79 20.216010800540026 28.86144307215361 27.461373068653433 23.461173058652932 80-84 20.325 28.73 27.43 23.515 85-89 20.165 28.389999999999997 27.435 24.01 90-94 19.975998799939997 28.816440822041102 27.58137906895345 23.62618130906545 95-99 20.599999999999998 28.28 27.815 23.305 100-104 20.346017300865043 29.071453572678635 27.611380569028455 22.97114855742787 105-109 20.899958999589995 28.21340713407134 27.706027060270603 23.18060680606806 110-114 20.666150271107668 29.03175832687839 26.986831913245545 23.315259488768397 115-119 20.587058705870586 29.162916291629166 26.187618761876188 24.062406240624064 120-124 20.825 28.939999999999998 27.005000000000003 23.23 125-129 20.7970797079708 28.06780678067807 27.062706270627064 24.072407240724072 130-134 20.66413282656531 28.675735147029407 26.965393078615723 23.69473894778956 135-139 21.194238847769554 28.575715143028606 25.89017803560712 24.33986797359472 140-144 20.95628688606582 28.293488046413923 26.367910373111936 24.382314694408322 145-149 21.11 27.785 26.935 24.169999999999998 150-151 21.036165686397197 28.331873357527222 27.030409210361654 23.601551745713927 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 1.0 24 3.5 25 4.5 26 7.0 27 8.5 28 9.5 29 11.0 30 17.0 31 25.0 32 29.5 33 46.5 34 65.5 35 73.0 36 81.5 37 98.0 38 127.0 39 176.5 40 211.5 41 210.5 42 230.5 43 270.5 44 275.5 45 270.5 46 264.0 47 252.5 48 242.5 49 200.5 50 165.0 51 145.0 52 115.5 53 87.5 54 73.0 55 65.5 56 39.5 57 25.5 58 23.5 59 15.5 60 9.0 61 8.0 62 6.5 63 1.0 64 0.0 65 1.0 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.075 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.005 105-109 2.44 110-114 3.175 115-119 0.01 120-124 0.0 125-129 0.01 130-134 0.02 135-139 0.02 140-144 0.03 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.85 0.0 0.0 0.0 0.0 88-89 1.025 0.0 0.0 0.0 0.0 90-91 1.3 0.0 0.0 0.0 0.0 92-93 1.45 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 2.0125 0.0 0.0 0.0 0.0 98-99 2.3625 0.0 0.0 0.0 0.0 100-101 2.7 0.0 0.0 0.0 0.0 102-103 3.175 0.0 0.0 0.0 0.0 104-105 3.575 0.0 0.0 0.0 0.0 106-107 3.925 0.0 0.0 0.0 0.0 108-109 4.325 0.0 0.0 0.0 0.0 110-111 4.7625 0.0 0.0 0.0 0.0 112-113 5.275 0.0 0.0 0.0 0.0 114-115 5.824999999999999 0.0 0.0 0.0 0.0 116-117 6.425 0.0 0.0 0.0 0.0 118-119 6.85 0.0 0.0 0.0 0.0 120-121 7.2125 0.0 0.0 0.0 0.0 122-123 7.925 0.0 0.0 0.0 0.0 124-125 8.5375 0.0 0.0 0.0 0.0 126-127 9.25 0.0 0.0 0.0 0.0 128-129 9.962499999999999 0.0 0.0 0.0 0.0 130-131 10.8125 0.0 0.0 0.0 0.0 132-133 11.625 0.0 0.0 0.0 0.0 134-135 12.275 0.0 0.0 0.0 0.0 136-137 13.05 0.0 0.0 0.0 0.0 138-139 13.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCAGAT 10 0.0067409626 145.62025 145 >>END_MODULE SRR7169797 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169797_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9595 33.0 33.0 34.0 32.0 34.0 2 33.1085 34.0 33.0 34.0 32.0 34.0 3 33.18 34.0 33.0 34.0 33.0 34.0 4 33.193 34.0 33.0 34.0 33.0 34.0 5 33.0845 34.0 33.0 34.0 33.0 34.0 6 37.32025 38.0 38.0 38.0 37.0 38.0 7 37.28425 38.0 38.0 38.0 37.0 38.0 8 37.25075 38.0 38.0 38.0 37.0 38.0 9 37.261 38.0 38.0 38.0 37.0 38.0 10-14 37.19515 38.0 38.0 38.0 37.0 38.0 15-19 37.2095 38.0 38.0 38.0 37.0 38.0 20-24 37.2085 38.0 38.0 38.0 37.2 38.0 25-29 37.151650000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.06545 38.0 38.0 38.0 36.8 38.0 35-39 36.9756 38.0 38.0 38.0 37.0 38.0 40-44 36.872550000000004 38.0 38.0 38.0 36.2 38.0 45-49 36.95815 38.0 38.0 38.0 36.6 38.0 50-54 36.88095 38.0 38.0 38.0 36.0 38.0 55-59 36.90405 38.0 38.0 38.0 36.2 38.0 60-64 36.97485 38.0 38.0 38.0 36.4 38.0 65-69 36.949 38.0 38.0 38.0 36.4 38.0 70-74 35.232299999999995 38.0 37.8 38.0 26.8 38.0 75-79 30.439749999999997 38.0 32.4 38.0 2.0 38.0 80-84 33.979400000000005 38.0 34.2 38.0 22.4 38.0 85-89 36.607749999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.6391 38.0 38.0 38.0 35.4 38.0 95-99 36.43085 38.0 38.0 38.0 34.8 38.0 100-104 35.80315 38.0 37.8 38.0 33.0 38.0 105-109 30.85725 38.0 29.4 38.0 7.2 38.0 110-114 22.936500000000002 33.4 2.0 38.0 2.0 38.0 115-119 20.016250000000003 21.6 2.0 38.0 2.0 38.0 120-124 22.44535 29.0 2.0 38.0 2.0 38.0 125-129 25.112450000000003 35.8 6.2 38.0 2.0 38.0 130-134 31.5242 37.6 29.8 38.0 9.4 38.0 135-139 31.775349999999996 37.2 29.6 38.0 13.8 38.0 140-144 32.699650000000005 38.0 33.8 38.0 13.4 38.0 145-149 32.40385 38.0 33.0 38.0 6.4 38.0 150-151 28.17425 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 8.0 4 4.0 5 3.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 2.0 12 3.0 13 4.0 14 4.0 15 1.0 16 7.0 17 6.0 18 11.0 19 6.0 20 21.0 21 25.0 22 44.0 23 82.0 24 50.0 25 24.0 26 32.0 27 43.0 28 154.0 29 225.0 30 194.0 31 190.0 32 257.0 33 264.0 34 265.0 35 304.0 36 471.0 37 1288.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.825 21.425 11.225 26.525 2 25.45 27.375 31.275 15.9 3 20.075000000000003 27.800000000000004 30.775000000000002 21.349999999999998 4 23.455863965991497 34.40860215053764 23.755938984746187 18.37959489872468 5 23.767825869402053 36.42732049036778 23.01726294721041 16.787590693019766 6 21.641230923192396 35.876907680760574 23.892919689767325 18.58894170627971 7 19.6 19.975 40.65 19.775000000000002 8 22.511255627813906 23.56178089044522 28.88944472236118 25.03751875937969 9 21.2 25.2 29.475 24.125 10-14 22.7022702270227 28.347834783478348 27.04770477047705 21.902190219021904 15-19 22.85642821410705 28.114057028514257 28.18409204602301 20.845422711355678 20-24 23.278967380428256 28.352011206724036 27.571542925755455 20.797478487092256 25-29 22.916458229114557 27.86893446723362 27.658829414707352 21.555777888944473 30-34 22.83370022013208 28.041825095057032 28.55713428056834 20.567340404242547 35-39 22.431823867900928 28.696522391793845 27.705779334500875 21.165874405804352 40-44 23.27047171227052 27.597418838477317 28.73292981841829 20.399179630833874 45-49 22.526895171378534 27.875906930197647 28.656492369276958 20.94070552914686 50-54 23.247435576682513 27.955966975231423 28.111083312484364 20.6855141356017 55-59 23.003402722177743 27.712169735788635 28.33767013610889 20.94675740592474 60-64 22.650855598919243 28.06964875412789 28.965275692985088 20.314219953967775 65-69 23.038823293976385 28.151891134680806 28.47708625175105 20.332199319591755 70-74 23.301174496644293 27.55348154362416 28.60738255033557 20.537961409395976 75-79 23.356821771352205 27.420726521686305 28.45340784837808 20.769043858583405 80-84 23.78808501727568 27.578264056119778 28.185530310962204 20.44812061564234 85-89 23.361352947062944 28.529970979685782 27.509256479535676 20.599419593715602 90-94 23.97058087757042 27.462850853054487 28.618602091359385 19.94796617801571 95-99 23.632724543407555 28.126094570928196 28.17613209907431 20.06504878658994 100-104 23.59850776366203 28.36761443839484 27.44000806614237 20.593869731800766 105-109 24.563363716553955 27.950602763892974 27.77418406351073 19.71184945604234 110-114 24.96731020690716 27.15175755711099 28.413198984693484 19.46773325128836 115-119 25.060555245015838 28.1442146450531 27.641140301844608 19.154089808086454 120-124 25.066209689982866 28.259853559744506 27.683439788128993 18.990496962143634 125-129 24.93808475509081 28.81810676940011 27.37341772151899 18.870390753990094 130-134 26.250711366340727 27.96833773087071 27.088830255057168 18.69212064773139 135-139 25.425255153091854 28.83730238142886 27.22633580148089 18.5111066639984 140-144 25.225135081048627 28.727236341805085 27.09125475285171 18.956373824294577 145-149 26.415566226490593 27.986194477791116 27.480992396958783 18.117246898759504 150-151 26.392221240055562 27.857052658163912 27.655006945321382 18.09571915645915 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.5 22 1.0 23 2.5 24 3.5 25 3.5 26 5.0 27 7.5 28 9.5 29 14.0 30 17.0 31 24.5 32 36.0 33 42.0 34 54.5 35 71.5 36 103.5 37 130.5 38 166.0 39 200.0 40 209.5 41 245.5 42 280.0 43 288.5 44 277.0 45 262.0 46 267.0 47 241.0 48 196.0 49 170.0 50 150.0 51 127.0 52 101.5 53 85.5 54 61.0 55 39.5 56 33.0 57 21.5 58 11.5 59 8.0 60 5.0 61 5.5 62 5.0 63 5.5 64 3.5 65 0.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.075 6 0.075 7 0.0 8 0.05 9 0.0 10-14 0.01 15-19 0.05 20-24 0.06 25-29 0.05 30-34 0.06 35-39 0.075 40-44 0.045 45-49 0.075 50-54 0.075 55-59 0.08 60-64 0.06999999999999999 65-69 0.06 70-74 4.64 75-79 17.69 80-84 4.49 85-89 0.06999999999999999 90-94 0.065 95-99 0.075 100-104 0.8200000000000001 105-109 14.975 110-114 34.995 115-119 46.33 120-124 35.809999999999995 125-129 27.32 130-134 3.3550000000000004 135-139 0.06 140-144 0.06 145-149 0.04 150-151 1.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.6625 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.375 0.0 0.0 0.0 0.0 94-95 1.55 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.175 0.0 0.0 0.0 0.0 100-101 2.4125 0.0 0.0 0.0 0.0 102-103 2.7249999999999996 0.0 0.0 0.0 0.0 104-105 2.9625 0.0 0.0 0.0 0.0 106-107 3.1125 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 3.5625 0.0 0.0 0.0 0.0 112-113 3.825 0.0 0.0 0.0 0.0 114-115 3.9875000000000003 0.0 0.0 0.0 0.0 116-117 4.175 0.0 0.0 0.0 0.0 118-119 4.3375 0.0 0.0 0.0 0.0 120-121 4.45 0.0 0.0 0.0 0.0 122-123 4.925 0.0 0.0 0.0 0.0 124-125 5.262499999999999 0.0 0.0 0.0 0.0 126-127 5.6875 0.0 0.0 0.0 0.0 128-129 6.2125 0.0 0.0 0.0 0.0 130-131 6.9125 0.0 0.0 0.0 0.0 132-133 7.6 0.0 0.0 0.0 0.0 134-135 8.1875 0.0 0.0 0.0 0.0 136-137 8.95 0.0 0.0 0.0 0.0 138-139 9.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690793 spots for SRR7169797.sra Written 3690793 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra Read 3690787 spots for SRR7169797.sra Written 3690787 spots for SRR7169797.sra SRR ids: ['SRR7169797.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_35rcd4jj SRR7169797.sra spots: 73815746 blocks: [[1, 3690787], [3690788, 7381574], [7381575, 11072361], [11072362, 14763148], [14763149, 18453935], [18453936, 22144722], [22144723, 25835509], [25835510, 29526296], [29526297, 33217083], [33217084, 36907870], [36907871, 40598657], [40598658, 44289444], [44289445, 47980231], [47980232, 51671018], [51671019, 55361805], [55361806, 59052592], [59052593, 62743379], [62743380, 66434166], [66434167, 70124953], [70124954, 73815746]] SRR7169797 file size 24992033 SRR7169797 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169797 SRR7169797_1.fastq SRR7169797_2.fastq Input file: SRR7169797_1.fastq Paired file: SRR7169797_2.fastq trimmed: SRR7169797-trimmed-pair1.fastq, SRR7169797-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:45:19 2025 >> started Tue Feb 11 17:46:43 2025 >> done (83.090s) 73815746 read pairs processed; of these: 83954 ( 0.11%) short read pairs filtered out after trimming by size control 79087 ( 0.11%) empty read pairs filtered out after trimming by size control 73652705 (99.78%) read pairs available; of these: 37289668 (50.63%) trimmed read pairs available after processing 36363037 (49.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 24 0.00% 20 21 0.00% 21 20 0.00% 22 27 0.00% 23 26 0.00% 24 30 0.00% 25 30 0.00% 26 39 0.00% 27 49 0.00% 28 44 0.00% 29 42 0.00% 30 44 0.00% 31 67 0.00% 32 70 0.00% 33 82 0.00% 34 93 0.00% 35 99 0.00% 36 139 0.00% 37 135 0.00% 38 206 0.00% 39 214 0.00% 40 236 0.00% 41 310 0.00% 42 349 0.00% 43 343 0.00% 44 427 0.00% 45 474 0.00% 46 498 0.00% 47 588 0.00% 48 684 0.00% 49 861 0.00% 50 978 0.00% 51 1113 0.00% 52 1322 0.00% 53 1457 0.00% 54 1567 0.00% 55 1684 0.00% 56 1798 0.00% 57 2043 0.00% 58 2339 0.00% 59 2750 0.00% 60 3265 0.00% 61 3830 0.01% 62 4435 0.01% 63 4991 0.01% 64 5367 0.01% 65 6124 0.01% 66 6759 0.01% 67 7175 0.01% 68 8034 0.01% 69 9171 0.01% 70 10707 0.01% 71 12359 0.02% 72 14617 0.02% 73 16398 0.02% 74 18146 0.02% 75 20156 0.03% 76 22994 0.03% 77 25040 0.03% 78 25753 0.03% 79 28428 0.04% 80 31365 0.04% 81 35744 0.05% 82 40886 0.06% 83 45388 0.06% 84 53337 0.07% 85 59042 0.08% 86 61650 0.08% 87 65066 0.09% 88 69146 0.09% 89 72858 0.10% 90 79238 0.11% 91 85162 0.12% 92 92237 0.13% 93 100611 0.14% 94 107869 0.15% 95 113565 0.15% 96 119357 0.16% 97 121913 0.17% 98 125606 0.17% 99 129807 0.18% 100 137412 0.19% 101 143760 0.20% 102 151824 0.21% 103 160536 0.22% 104 169063 0.23% 105 176224 0.24% 106 183278 0.25% 107 185212 0.25% 108 187741 0.25% 109 192328 0.26% 110 195992 0.27% 111 202991 0.28% 112 212203 0.29% 113 220128 0.30% 114 229742 0.31% 115 237952 0.32% 116 242342 0.33% 117 248124 0.34% 118 248040 0.34% 119 249297 0.34% 120 254470 0.35% 121 260711 0.35% 122 267878 0.36% 123 277104 0.38% 124 288402 0.39% 125 296748 0.40% 126 306195 0.42% 127 310477 0.42% 128 313448 0.43% 129 317264 0.43% 130 321052 0.44% 131 324462 0.44% 132 333911 0.45% 133 346091 0.47% 134 357107 0.48% 135 369761 0.50% 136 383569 0.52% 137 392899 0.53% 138 407665 0.55% 139 424790 0.58% 140 445565 0.60% 141 469379 0.64% 142 495970 0.67% 143 541687 0.74% 144 602705 0.82% 145 690968 0.94% 146 820289 1.11% 147 1061767 1.44% 148 1530178 2.08% 149 2890427 3.92% 150 15325601 20.81% 151 36363037 49.37% 73652705 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=30 prefix-density=0.18 prefix-fanout=2.8 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=272.95 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=30.6 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=32 prefix-density=0.38 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=262.04 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=28.3 sequence=AAGAAGAAGAAA SRR7169797 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:47:22 Started mapping on | Feb 11 17:47:23 Finished on | Feb 11 17:52:56 Mapping speed, Million of reads per hour | 796.25 Number of input reads | 73652705 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 70481380 Uniquely mapped reads % | 95.69% Average mapped length | 288.56 Number of splices: Total | 65750210 Number of splices: Annotated (sjdb) | 64617634 Number of splices: GT/AG | 64763385 Number of splices: GC/AG | 791604 Number of splices: AT/AC | 58175 Number of splices: Non-canonical | 137046 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1248501 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 666439 % of reads mapped to too many loci | 0.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.56% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1985045 1985045 1985045 N_multimapping 1248501 1248501 1248501 N_noFeature 1980005 69619714 2500602 N_ambiguous 607547 4198 263609 UnstrandedReadsAssigned:67893828 PositiveStrandReadsAssigned:857468 NegativeStrandReadsAssigned:67717169 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169797 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169797-trimmed-pair1.fastq SRR7169797-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 73,652,705 reads, 67,741,994 reads pseudoaligned [quant] estimated average fragment length: 208.723 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR7169797.ke.tsv 34699 SRR7169797.se.tsv 87100 total ==> SRR7169797.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.28 1245 11.1763 Potri.005G024800.1.v4.1 1035 827.277 149 2.92691 Potri.004G059700.1.v4.1 961 753.283 8 0.172586 Potri.007G009000.2.v4.1 1416 1208.28 0 0 Potri.003G141000.2.v4.1 2943 2735.28 1566.24 9.3053 Potri.016G087400.1.v4.1 270 96.3368 5763.3 972.194 Potri.015G069301.1.v4.1 564 358.98 0 0 Potri.010G195200.1.v4.1 1773 1565.28 78 0.809799 Potri.012G127500.1.v4.1 977 769.277 34741 733.894 ==> SRR7169797.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5861 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 1319 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 49 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169797 completed mapping pipeline successfully