Starting /dee2/code/volunteer_pipeline.sh SRR7169798 current disk space = 3053408161792 free memory = 1434595048 SRR7169798 SRAfilesize a9468d4985ec611b8d6251f3151636dd SRR7169798.sra SRR7169798.sra file validated SRR7169798 is paired end SRR7169798 is conventional basespace SRR7169798 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169798_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.0635 27.0 18.0 32.0 18.0 32.0 2 31.09 31.0 30.0 33.0 28.0 33.0 3 31.8755 33.0 31.0 33.0 29.0 33.0 4 32.20475 33.0 33.0 33.0 31.0 34.0 5 32.8645 33.0 33.0 34.0 32.0 34.0 6 36.72275 38.0 37.0 38.0 34.0 38.0 7 37.32225 38.0 38.0 38.0 36.0 38.0 8 37.44375 38.0 38.0 38.0 37.0 38.0 9 37.50625 38.0 38.0 38.0 37.0 38.0 10-14 37.564949999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.55585000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.5816 38.0 38.0 38.0 38.0 38.0 25-29 37.550599999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.5336 38.0 38.0 38.0 38.0 38.0 35-39 37.3262 38.0 38.0 38.0 37.0 38.0 40-44 36.9346 38.0 38.0 38.0 35.6 38.0 45-49 37.31635 38.0 38.0 38.0 36.8 38.0 50-54 37.36395 38.0 38.0 38.0 37.0 38.0 55-59 37.3266 38.0 38.0 38.0 37.0 38.0 60-64 37.2273 38.0 38.0 38.0 36.8 38.0 65-69 37.23045 38.0 38.0 38.0 36.6 38.0 70-74 37.133799999999994 38.0 38.0 38.0 36.0 38.0 75-79 37.110699999999994 38.0 38.0 38.0 36.0 38.0 80-84 37.01435 38.0 38.0 38.0 36.0 38.0 85-89 36.87695 38.0 38.0 38.0 35.6 38.0 90-94 36.703700000000005 38.0 38.0 38.0 34.8 38.0 95-99 36.836999999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.70375 38.0 38.0 38.0 34.8 38.0 105-109 36.43865 38.0 37.8 38.0 34.0 38.0 110-114 36.34595 38.0 37.8 38.0 33.8 38.0 115-119 36.14489999999999 38.0 37.0 38.0 33.8 38.0 120-124 36.088 38.0 37.0 38.0 33.2 38.0 125-129 35.89215 38.0 37.0 38.0 32.8 38.0 130-134 35.4344 38.0 36.0 38.0 30.8 38.0 135-139 35.306349999999995 38.0 35.4 38.0 30.6 38.0 140-144 34.870850000000004 38.0 35.0 38.0 28.2 38.0 145-149 34.4183 38.0 35.0 38.0 27.2 38.0 150-151 30.539125000000002 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 4.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 4.0 19 6.0 20 1.0 21 2.0 22 2.0 23 7.0 24 5.0 25 3.0 26 12.0 27 15.0 28 16.0 29 23.0 30 34.0 31 43.0 32 45.0 33 89.0 34 168.0 35 318.0 36 764.0 37 2435.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.27249618708694 12.785968479918658 10.421962379257753 34.519572953736656 2 23.724999999999998 15.2 33.025 28.050000000000004 3 19.650000000000002 21.65 26.35 32.35 4 22.075 29.575000000000003 23.825 24.525 5 22.425 31.8 25.624999999999996 20.150000000000002 6 18.575 35.775 24.775 20.875 7 14.549999999999999 26.424999999999997 41.55 17.474999999999998 8 18.875 26.025 29.599999999999998 25.5 9 18.35 24.75 32.75 24.15 10-14 20.015 29.59 26.97 23.425 15-19 19.37 28.73 27.834999999999997 24.065 20-24 19.56 29.125 27.715 23.599999999999998 25-29 20.185 28.595 27.21 24.01 30-34 19.685 28.78 27.605 23.93 35-39 19.634999999999998 29.2 27.384999999999998 23.78 40-44 20.87 28.125 27.52 23.485 45-49 20.055 28.705000000000002 27.875 23.365 50-54 19.77 28.285 27.365000000000002 24.58 55-59 19.994999999999997 28.705000000000002 27.544999999999998 23.755000000000003 60-64 20.28 28.525 27.145000000000003 24.05 65-69 19.84 28.505000000000003 27.6 24.055 70-74 20.45 28.595 27.57 23.385 75-79 20.724999999999998 28.49 27.065 23.72 80-84 20.115 28.01 27.589999999999996 24.285 85-89 20.87 28.46 27.500000000000004 23.169999999999998 90-94 20.064999999999998 28.055000000000003 27.66 24.22 95-99 20.52 28.37 27.71 23.400000000000002 100-104 20.555 28.325 27.495000000000005 23.625 105-109 20.805 28.58 26.939999999999998 23.674999999999997 110-114 20.71 28.59 26.979999999999997 23.72 115-119 21.46 28.68 26.435 23.425 120-124 20.880000000000003 28.595 26.68 23.845 125-129 20.665 28.89 26.165 24.279999999999998 130-134 21.795 28.59 25.91 23.705000000000002 135-139 21.555 28.799999999999997 26.14 23.505000000000003 140-144 21.44 28.444999999999997 25.715 24.4 145-149 21.765 28.444999999999997 25.885 23.905 150-151 21.275 27.950000000000003 26.187500000000004 24.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 1.5 11 1.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 0.0 25 2.5 26 3.5 27 3.0 28 10.0 29 12.5 30 13.5 31 22.0 32 28.0 33 37.5 34 49.0 35 68.5 36 94.5 37 106.5 38 120.0 39 152.5 40 178.0 41 210.5 42 246.5 43 266.5 44 279.0 45 279.5 46 273.0 47 268.5 48 236.0 49 195.5 50 180.0 51 148.5 52 117.5 53 99.0 54 73.0 55 53.0 56 45.0 57 34.0 58 23.0 59 16.0 60 12.5 61 8.5 62 6.0 63 5.0 64 3.5 65 3.0 66 1.5 67 1.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.55 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.0999999999999996 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.8499999999999996 0.0 0.0 0.0 0.0 110-111 3.325 0.0 0.0 0.0 0.0 112-113 3.725 0.0 0.0 0.0 0.0 114-115 4.1375 0.0 0.0 0.0 0.0 116-117 4.5 0.0 0.0 0.0 0.0 118-119 4.9875 0.0 0.0 0.0 0.0 120-121 5.612500000000001 0.0 0.0 0.0 0.0 122-123 6.225 0.0 0.0 0.0 0.0 124-125 6.925 0.0 0.0 0.0 0.0 126-127 7.6625 0.0 0.0 0.0 0.0 128-129 8.575 0.0 0.0 0.0 0.0 130-131 9.5 0.0 0.0 0.0 0.0 132-133 10.0625 0.0 0.0 0.0 0.0 134-135 10.5625 0.0 0.0 0.0 0.0 136-137 11.2625 0.0 0.0 0.0 0.0 138-139 12.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAAGT 10 0.0068343505 144.975 2 AGATCGG 55 0.0025189708 15.8154545 140-144 >>END_MODULE SRR7169798 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169798_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73125 33.0 33.0 34.0 32.0 34.0 2 31.4795 33.0 32.0 34.0 25.0 34.0 3 32.68275 33.0 33.0 34.0 32.0 34.0 4 32.85375 33.0 33.0 34.0 32.0 34.0 5 33.013 34.0 33.0 34.0 33.0 34.0 6 37.31275 38.0 38.0 38.0 37.0 38.0 7 37.374 38.0 38.0 38.0 38.0 38.0 8 37.36175 38.0 38.0 38.0 38.0 38.0 9 37.367 38.0 38.0 38.0 38.0 38.0 10-14 37.304950000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.2921 38.0 38.0 38.0 38.0 38.0 20-24 37.27065 38.0 38.0 38.0 37.6 38.0 25-29 37.2784 38.0 38.0 38.0 37.8 38.0 30-34 37.21705 38.0 38.0 38.0 37.0 38.0 35-39 36.822050000000004 38.0 38.0 38.0 35.2 38.0 40-44 37.1399 38.0 38.0 38.0 37.0 38.0 45-49 36.84175 38.0 38.0 38.0 36.0 38.0 50-54 37.05335 38.0 38.0 38.0 36.8 38.0 55-59 36.3487 38.0 37.4 38.0 33.2 38.0 60-64 36.96560000000001 38.0 38.0 38.0 36.4 38.0 65-69 36.851800000000004 38.0 38.0 38.0 36.2 38.0 70-74 36.85510000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.76645 38.0 38.0 38.0 35.8 38.0 80-84 36.746849999999995 38.0 38.0 38.0 35.8 38.0 85-89 35.6712 38.0 36.6 38.0 29.8 38.0 90-94 36.646 38.0 38.0 38.0 35.2 38.0 95-99 36.599599999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.481399999999994 38.0 38.0 38.0 34.8 38.0 105-109 35.80865 38.0 37.4 38.0 32.4 38.0 110-114 34.82684999999999 38.0 37.2 38.0 26.6 38.0 115-119 33.8177 38.0 36.4 38.0 20.2 38.0 120-124 34.358 38.0 36.0 38.0 24.8 38.0 125-129 34.327600000000004 38.0 36.0 38.0 22.4 38.0 130-134 34.3602 38.0 35.2 38.0 24.4 38.0 135-139 34.1231 38.0 35.0 38.0 24.4 38.0 140-144 32.760200000000005 37.6 31.6 38.0 19.0 38.0 145-149 32.3203 37.6 31.6 38.0 16.6 38.0 150-151 28.955625 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 7.0 4 2.0 5 1.0 6 1.0 7 3.0 8 0.0 9 0.0 10 1.0 11 3.0 12 1.0 13 2.0 14 4.0 15 2.0 16 2.0 17 3.0 18 4.0 19 8.0 20 5.0 21 10.0 22 7.0 23 7.0 24 9.0 25 23.0 26 16.0 27 19.0 28 18.0 29 26.0 30 41.0 31 67.0 32 105.0 33 176.0 34 179.0 35 342.0 36 798.0 37 2099.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.575 20.7 13.775 24.95 2 26.6 25.6 30.475 17.325 3 20.75 28.199999999999996 30.425 20.625 4 24.9 33.975 23.025000000000002 18.099999999999998 5 24.099999999999998 35.4 23.325000000000003 17.175 6 21.775 37.125 23.225 17.875 7 19.75 21.3 38.525 20.424999999999997 8 22.575 25.124999999999996 27.725 24.575 9 23.0 25.5 27.725 23.775 10-14 23.89 28.375 26.14 21.595 15-19 23.150000000000002 27.735 28.299999999999997 20.815 20-24 23.39 28.15 27.115000000000002 21.345 25-29 23.66 28.08 27.38 20.880000000000003 30-34 23.36 28.34 27.24 21.060000000000002 35-39 23.369999999999997 27.855 27.339999999999996 21.435000000000002 40-44 23.585 28.035 27.32 21.060000000000002 45-49 23.5 27.375 28.189999999999998 20.935000000000002 50-54 23.735 27.735 27.82 20.71 55-59 23.49 28.015 27.529999999999998 20.965 60-64 23.064999999999998 27.93 27.96 21.044999999999998 65-69 23.630000000000003 27.72 28.29 20.36 70-74 24.16 27.41 27.865000000000002 20.565 75-79 23.43 27.474999999999998 28.634999999999998 20.46 80-84 23.56 27.515 27.965 20.96 85-89 24.15 27.725 27.400000000000002 20.724999999999998 90-94 23.455000000000002 27.175 28.46 20.91 95-99 23.799999999999997 27.38 27.994999999999997 20.825 100-104 24.555 27.93 27.41 20.105 105-109 24.32 27.665 27.96 20.055 110-114 24.89283685379332 27.728141300418326 27.593864587099105 19.785157258689253 115-119 24.568484784109618 27.563864251951774 27.563864251951774 20.30378671198683 120-124 24.52012383900929 27.7296181630547 27.801857585139317 19.948400412796698 125-129 25.15868140868141 27.66687141687142 27.344389844389845 19.83005733005733 130-134 25.474999999999998 28.405 27.279999999999998 18.84 135-139 25.645 28.15 26.724999999999998 19.48 140-144 25.735000000000003 27.644999999999996 27.42 19.2 145-149 26.419999999999998 27.589999999999996 27.084999999999997 18.905 150-151 27.025 27.212500000000002 27.037499999999998 18.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 1.0 24 1.5 25 0.5 26 2.0 27 4.0 28 3.5 29 6.0 30 9.0 31 15.5 32 22.0 33 25.5 34 35.0 35 54.0 36 70.5 37 81.5 38 113.0 39 164.0 40 205.5 41 235.5 42 270.5 43 287.5 44 279.0 45 289.0 46 281.5 47 259.0 48 242.5 49 202.5 50 168.0 51 154.0 52 134.0 53 92.0 54 62.5 55 51.0 56 40.5 57 31.5 58 24.0 59 22.0 60 19.5 61 11.0 62 7.0 63 6.0 64 3.0 65 3.5 66 3.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 3.1850000000000005 115-119 5.8549999999999995 120-124 3.1 125-129 2.32 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.7124999999999999 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.2374999999999998 0.0 0.0 0.0 0.0 98-99 1.4249999999999998 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.1624999999999996 0.0 0.0 0.0 0.0 112-113 3.5125 0.0 0.0 0.0 0.0 114-115 3.9125 0.0 0.0 0.0 0.0 116-117 4.237500000000001 0.0 0.0 0.0 0.0 118-119 4.7375 0.0 0.0 0.0 0.0 120-121 5.325 0.0 0.0 0.0 0.0 122-123 5.925 0.0 0.0 0.0 0.0 124-125 6.6125 0.0 0.0 0.0 0.0 126-127 7.3375 0.0 0.0 0.0 0.0 128-129 8.212499999999999 0.0 0.0 0.0 0.0 130-131 9.075 0.0 0.0 0.0 0.0 132-133 9.625 0.0 0.0 0.0 0.0 134-135 10.1 0.0 0.0 0.0 0.0 136-137 10.725 0.0 0.0 0.0 0.0 138-139 11.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTATG 10 0.0070063258 143.775 5 TTATGTA 10 0.0070063258 143.775 7 AGATCGG 50 0.0014076463 17.253 140-144 >>END_MODULE Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981115 spots for SRR7169798.sra Written 981115 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra Read 981113 spots for SRR7169798.sra Written 981113 spots for SRR7169798.sra SRR ids: ['SRR7169798.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y_vzrdwd SRR7169798.sra spots: 19622262 blocks: [[1, 981113], [981114, 1962226], [1962227, 2943339], [2943340, 3924452], [3924453, 4905565], [4905566, 5886678], [5886679, 6867791], [6867792, 7848904], [7848905, 8830017], [8830018, 9811130], [9811131, 10792243], [10792244, 11773356], [11773357, 12754469], [12754470, 13735582], [13735583, 14716695], [14716696, 15697808], [15697809, 16678921], [16678922, 17660034], [17660035, 18641147], [18641148, 19622262]] SRR7169798 file size 6627640 SRR7169798 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169798 SRR7169798_1.fastq SRR7169798_2.fastq Input file: SRR7169798_1.fastq Paired file: SRR7169798_2.fastq trimmed: SRR7169798-trimmed-pair1.fastq, SRR7169798-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:11:32 2025 >> started Tue Feb 11 18:11:55 2025 >> done (23.400s) 19622262 read pairs processed; of these: 25717 ( 0.13%) short read pairs filtered out after trimming by size control 35987 ( 0.18%) empty read pairs filtered out after trimming by size control 19560558 (99.69%) read pairs available; of these: 10128999 (51.78%) trimmed read pairs available after processing 9431559 (48.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 5 0.00% 21 9 0.00% 22 11 0.00% 23 8 0.00% 24 13 0.00% 25 7 0.00% 26 14 0.00% 27 22 0.00% 28 15 0.00% 29 19 0.00% 30 17 0.00% 31 13 0.00% 32 17 0.00% 33 25 0.00% 34 23 0.00% 35 19 0.00% 36 35 0.00% 37 32 0.00% 38 24 0.00% 39 33 0.00% 40 47 0.00% 41 39 0.00% 42 59 0.00% 43 69 0.00% 44 56 0.00% 45 83 0.00% 46 72 0.00% 47 88 0.00% 48 91 0.00% 49 112 0.00% 50 156 0.00% 51 189 0.00% 52 200 0.00% 53 227 0.00% 54 247 0.00% 55 261 0.00% 56 314 0.00% 57 357 0.00% 58 404 0.00% 59 481 0.00% 60 555 0.00% 61 694 0.00% 62 753 0.00% 63 844 0.00% 64 956 0.00% 65 1052 0.01% 66 1143 0.01% 67 1209 0.01% 68 1467 0.01% 69 1682 0.01% 70 1888 0.01% 71 2229 0.01% 72 2633 0.01% 73 2993 0.02% 74 3226 0.02% 75 3794 0.02% 76 4665 0.02% 77 5069 0.03% 78 5000 0.03% 79 5407 0.03% 80 5981 0.03% 81 6839 0.03% 82 7846 0.04% 83 8998 0.05% 84 10986 0.06% 85 12748 0.07% 86 13549 0.07% 87 14481 0.07% 88 15594 0.08% 89 16263 0.08% 90 17123 0.09% 91 18405 0.09% 92 19927 0.10% 93 22343 0.11% 94 23593 0.12% 95 25619 0.13% 96 26864 0.14% 97 27543 0.14% 98 28519 0.15% 99 29485 0.15% 100 31256 0.16% 101 32658 0.17% 102 34959 0.18% 103 37386 0.19% 104 39484 0.20% 105 41659 0.21% 106 43875 0.22% 107 44456 0.23% 108 45313 0.23% 109 46660 0.24% 110 48101 0.25% 111 50059 0.26% 112 52397 0.27% 113 54921 0.28% 114 57703 0.29% 115 59706 0.31% 116 60731 0.31% 117 62385 0.32% 118 63278 0.32% 119 63500 0.32% 120 65232 0.33% 121 67313 0.34% 122 69022 0.35% 123 71622 0.37% 124 74904 0.38% 125 76563 0.39% 126 79775 0.41% 127 81133 0.41% 128 82488 0.42% 129 83767 0.43% 130 84787 0.43% 131 86418 0.44% 132 89018 0.46% 133 92009 0.47% 134 95047 0.49% 135 99601 0.51% 136 102697 0.53% 137 106045 0.54% 138 109790 0.56% 139 114168 0.58% 140 118292 0.60% 141 126165 0.64% 142 135368 0.69% 143 147924 0.76% 144 165371 0.85% 145 192321 0.98% 146 231435 1.18% 147 299586 1.53% 148 437776 2.24% 149 838436 4.29% 150 4330556 22.14% 151 9431559 48.22% 19560558 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=32 prefix-density=0.25 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=245.67 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=45 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=241.60 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=26.5 sequence=AAGAAGAAGAAG SRR7169798 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:12:45 Started mapping on | Feb 11 18:12:45 Finished on | Feb 11 18:14:43 Mapping speed, Million of reads per hour | 596.76 Number of input reads | 19560558 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 18405722 Uniquely mapped reads % | 94.10% Average mapped length | 289.60 Number of splices: Total | 16329089 Number of splices: Annotated (sjdb) | 16033790 Number of splices: GT/AG | 16086090 Number of splices: GC/AG | 187333 Number of splices: AT/AC | 13988 Number of splices: Non-canonical | 41678 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 329620 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 29724 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.03% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 848389 848389 848389 N_multimapping 329620 329620 329620 N_noFeature 414537 18184250 513306 N_ambiguous 193258 1226 69643 UnstrandedReadsAssigned:17797927 PositiveStrandReadsAssigned:220246 NegativeStrandReadsAssigned:17822773 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169798 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169798-trimmed-pair1.fastq SRR7169798-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,560,558 reads, 17,758,560 reads pseudoaligned [quant] estimated average fragment length: 206.327 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR7169798.ke.tsv 34699 SRR7169798.se.tsv 87100 total ==> SRR7169798.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1812.67 355 10.5505 Potri.005G024800.1.v4.1 1035 829.673 40 2.59726 Potri.004G059700.1.v4.1 961 755.678 3 0.213869 Potri.007G009000.2.v4.1 1416 1210.67 0 0 Potri.003G141000.2.v4.1 2943 2737.67 305.145 6.00464 Potri.016G087400.1.v4.1 270 94.1463 1666 953.311 Potri.015G069301.1.v4.1 564 360.199 0 0 Potri.010G195200.1.v4.1 1773 1567.67 25 0.859107 Potri.012G127500.1.v4.1 977 771.678 9951 694.694 ==> SRR7169798.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1761 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 495 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169798 completed mapping pipeline successfully