Starting /dee2/code/volunteer_pipeline.sh SRR7169799 current disk space = 3053504143360 free memory = 1482456920 SRR7169799 SRAfilesize 9cbc94cb9052fbbd89970a30fc83d29b SRR7169799.sra SRR7169799.sra file validated SRR7169799 is paired end SRR7169799 is conventional basespace SRR7169799 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169799_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.14525 18.0 18.0 18.0 18.0 32.0 2 28.03525 27.0 27.0 30.0 25.0 31.0 3 30.14325 31.0 29.0 33.0 27.0 33.0 4 32.2285 33.0 33.0 33.0 31.0 33.0 5 32.7605 33.0 33.0 33.0 32.0 34.0 6 36.71425 38.0 37.0 38.0 34.0 38.0 7 37.20725 38.0 38.0 38.0 36.0 38.0 8 36.7215 38.0 38.0 38.0 35.0 38.0 9 37.365 38.0 38.0 38.0 37.0 38.0 10-14 37.4702 38.0 38.0 38.0 37.0 38.0 15-19 36.75595 38.0 37.6 38.0 34.2 38.0 20-24 37.58395 38.0 38.0 38.0 37.6 38.0 25-29 37.552350000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.35755 38.0 38.0 38.0 37.0 38.0 35-39 37.32175 38.0 38.0 38.0 37.0 38.0 40-44 37.11905 38.0 38.0 38.0 36.4 38.0 45-49 36.6513 38.0 37.8 38.0 34.2 38.0 50-54 37.344800000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.27965 38.0 38.0 38.0 36.4 38.0 60-64 37.2509 38.0 38.0 38.0 36.0 38.0 65-69 37.21325 38.0 38.0 38.0 36.2 38.0 70-74 37.093450000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.9902 38.0 38.0 38.0 35.8 38.0 80-84 36.8864 38.0 38.0 38.0 35.4 38.0 85-89 36.7759 38.0 38.0 38.0 35.0 38.0 90-94 36.56895 38.0 38.0 38.0 34.0 38.0 95-99 36.545550000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.5695 38.0 38.0 38.0 34.0 38.0 105-109 36.38605 38.0 37.6 38.0 34.0 38.0 110-114 35.68390000000001 38.0 36.6 38.0 31.2 38.0 115-119 35.85785 38.0 36.8 38.0 32.6 38.0 120-124 35.8072 38.0 36.6 38.0 32.0 38.0 125-129 35.48055 38.0 36.0 38.0 30.2 38.0 130-134 34.9424 38.0 35.6 38.0 26.6 38.0 135-139 34.708600000000004 38.0 35.0 38.0 27.4 38.0 140-144 34.4336 38.0 35.0 38.0 26.2 38.0 145-149 33.870099999999994 38.0 34.6 38.0 23.6 38.0 150-151 30.06825 36.0 28.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 3.0 15 1.0 16 0.0 17 1.0 18 8.0 19 2.0 20 2.0 21 4.0 22 3.0 23 5.0 24 5.0 25 9.0 26 11.0 27 10.0 28 21.0 29 31.0 30 41.0 31 39.0 32 68.0 33 129.0 34 217.0 35 370.0 36 1118.0 37 1900.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.19658976930793 24.12236710130391 9.252758274824474 34.42828485456369 2 22.125 16.125 34.300000000000004 27.450000000000003 3 19.009504752376188 21.98599299649825 26.91345672836418 32.09104552276138 4 22.45 30.75 22.8 24.0 5 21.075 35.425000000000004 22.875 20.625 6 19.7 37.325 24.025 18.95 7 14.174999999999999 25.575 41.425 18.825 8 17.75 26.0 30.65 25.6 9 17.95 25.924999999999997 32.800000000000004 23.325000000000003 10-14 20.405 30.520000000000003 26.56 22.515 15-19 19.62 29.895 27.310000000000002 23.175 20-24 19.93 29.165000000000003 27.875 23.03 25-29 20.0 29.445 27.235 23.32 30-34 19.705000000000002 29.445 26.8 24.05 35-39 19.345000000000002 29.89 27.04 23.724999999999998 40-44 19.06 29.935000000000002 27.355 23.65 45-49 19.645000000000003 29.205 27.045 24.104999999999997 50-54 19.96 29.054999999999996 27.33 23.655 55-59 20.3 29.189999999999998 27.52 22.99 60-64 20.244999999999997 28.895 27.755000000000003 23.105 65-69 19.994999999999997 29.65 26.889999999999997 23.465 70-74 19.744999999999997 29.160000000000004 27.08 24.015 75-79 20.21 29.375 26.955000000000002 23.46 80-84 19.935 29.255 26.91 23.9 85-89 19.53 29.39 27.35 23.73 90-94 20.305 29.32 26.56 23.815 95-99 20.29 28.810000000000002 27.794999999999998 23.105 100-104 20.345 29.439999999999998 26.995 23.22 105-109 20.817081708170818 29.042904290429046 26.772677267726774 23.367336733673366 110-114 20.925 28.835 27.139999999999997 23.1 115-119 20.695 29.2 26.27 23.835 120-124 21.015 29.365000000000002 25.929999999999996 23.69 125-129 20.625 28.54 26.88 23.955000000000002 130-134 20.765 28.494999999999997 26.5 24.240000000000002 135-139 20.485 28.87 26.240000000000002 24.404999999999998 140-144 20.93 28.28 26.484999999999996 24.305 145-149 20.965 28.815 26.205000000000002 24.015 150-151 20.8625 28.812500000000004 25.4 24.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.5 25 4.5 26 10.0 27 12.0 28 13.5 29 18.5 30 26.5 31 39.0 32 51.5 33 62.0 34 67.0 35 70.0 36 85.5 37 114.5 38 137.5 39 162.5 40 178.0 41 198.0 42 243.0 43 257.0 44 265.5 45 266.0 46 263.5 47 263.0 48 234.0 49 209.0 50 171.5 51 140.0 52 110.0 53 82.0 54 68.0 55 48.0 56 34.5 57 26.0 58 17.0 59 9.0 60 6.5 61 7.5 62 6.5 63 4.5 64 2.0 65 0.5 66 2.0 67 2.0 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.2375 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.7375 0.0 0.0 0.0 0.0 104-105 2.125 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.825 0.0 0.0 0.0 0.0 110-111 3.2375 0.0 0.0 0.0 0.0 112-113 3.7874999999999996 0.0 0.0 0.0 0.0 114-115 4.237500000000001 0.0 0.0 0.0 0.0 116-117 4.7375 0.0 0.0 0.0 0.0 118-119 5.3375 0.0 0.0 0.0 0.0 120-121 5.725 0.0 0.0 0.0 0.0 122-123 6.300000000000001 0.0 0.0 0.0 0.0 124-125 6.9 0.0 0.0 0.0 0.0 126-127 7.4125 0.0 0.0 0.0 0.0 128-129 7.9375 0.0 0.0 0.0 0.0 130-131 8.35 0.0 0.0 0.0 0.0 132-133 8.774999999999999 0.0 0.0 0.0 0.0 134-135 9.412500000000001 0.0 0.0 0.0 0.0 136-137 10.15 0.0 0.0 0.0 0.0 138-139 10.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATTTA 10 0.006830828 145.0 7 CAGGTTG 10 0.006830828 145.0 9 GAATACC 10 0.006830828 145.0 2 >>END_MODULE SRR7169799 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169799_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.022 33.0 33.0 34.0 32.0 34.0 2 33.1045 34.0 33.0 34.0 33.0 34.0 3 33.10675 34.0 33.0 34.0 33.0 34.0 4 33.08925 34.0 33.0 34.0 33.0 34.0 5 33.08675 34.0 33.0 34.0 33.0 34.0 6 37.38825 38.0 38.0 38.0 38.0 38.0 7 37.31525 38.0 38.0 38.0 37.0 38.0 8 37.37775 38.0 38.0 38.0 37.0 38.0 9 37.20225 38.0 38.0 38.0 37.0 38.0 10-14 36.88365 38.0 38.0 38.0 35.2 38.0 15-19 37.1849 38.0 38.0 38.0 37.0 38.0 20-24 37.11095 38.0 38.0 38.0 36.8 38.0 25-29 37.206849999999996 38.0 38.0 38.0 37.0 38.0 30-34 36.7243 38.0 37.8 38.0 34.8 38.0 35-39 37.019400000000005 38.0 38.0 38.0 36.6 38.0 40-44 36.482549999999996 38.0 37.4 38.0 33.8 38.0 45-49 37.10185 38.0 38.0 38.0 36.8 38.0 50-54 36.7384 38.0 37.8 38.0 35.2 38.0 55-59 36.7316 38.0 38.0 38.0 35.4 38.0 60-64 36.904300000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.6955 38.0 38.0 38.0 35.6 38.0 70-74 36.68485 38.0 38.0 38.0 35.0 38.0 75-79 36.6666 38.0 38.0 38.0 35.2 38.0 80-84 36.4357 38.0 37.8 38.0 34.4 38.0 85-89 36.71015 38.0 38.0 38.0 35.0 38.0 90-94 36.35675 38.0 37.8 38.0 33.6 38.0 95-99 36.5259 38.0 38.0 38.0 34.8 38.0 100-104 36.17 38.0 38.0 38.0 33.4 38.0 105-109 35.15745 38.0 37.0 38.0 29.0 38.0 110-114 34.53705 38.0 36.0 38.0 26.0 38.0 115-119 34.0923 38.0 36.2 38.0 21.8 38.0 120-124 33.534850000000006 38.0 34.6 38.0 18.4 38.0 125-129 34.47429999999999 38.0 35.4 38.0 25.4 38.0 130-134 34.30245000000001 38.0 34.6 38.0 24.2 38.0 135-139 34.48475 38.0 35.0 38.0 25.6 38.0 140-144 34.31695 38.0 34.4 38.0 26.6 38.0 145-149 33.606300000000005 38.0 33.4 38.0 23.2 38.0 150-151 29.04175 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 2.0 5 4.0 6 1.0 7 1.0 8 1.0 9 0.0 10 1.0 11 2.0 12 4.0 13 1.0 14 1.0 15 2.0 16 3.0 17 2.0 18 6.0 19 5.0 20 6.0 21 8.0 22 8.0 23 7.0 24 13.0 25 12.0 26 17.0 27 16.0 28 27.0 29 46.0 30 50.0 31 92.0 32 103.0 33 123.0 34 211.0 35 300.0 36 743.0 37 2171.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.675 18.0 15.75 27.575 2 25.55 25.825 30.325000000000003 18.3 3 20.630157539384847 28.482120530132534 30.407601900475118 20.4801200300075 4 24.325 33.7 23.35 18.625 5 24.0 36.775000000000006 21.975 17.25 6 21.099999999999998 36.475 23.5 18.925 7 19.3 21.425 39.825 19.45 8 22.225 25.074999999999996 27.400000000000002 25.3 9 21.4 24.4 30.725 23.474999999999998 10-14 23.405 28.325 26.275 21.995 15-19 23.95 27.935 27.48 20.635 20-24 22.689999999999998 27.54 28.82 20.95 25-29 23.794999999999998 28.02 27.965 20.22 30-34 23.294999999999998 27.634999999999998 28.22 20.849999999999998 35-39 22.994999999999997 28.475 27.565 20.965 40-44 23.48 27.639999999999997 28.51 20.369999999999997 45-49 23.18 27.725 28.21 20.885 50-54 22.945 28.139999999999997 28.395 20.52 55-59 24.21 27.384999999999998 28.349999999999998 20.055 60-64 23.775 27.089999999999996 28.92 20.215 65-69 23.43 27.72 28.310000000000002 20.54 70-74 23.25686235223402 27.95031055900621 28.45121218192747 20.341614906832298 75-79 23.65774330748061 27.51563672754566 28.72654490868151 20.10007505629222 80-84 23.585 27.51 28.215 20.69 85-89 22.955000000000002 28.115000000000002 28.360000000000003 20.57 90-94 22.95 26.784999999999997 29.895 20.369999999999997 95-99 23.825 27.075 28.625 20.474999999999998 100-104 24.233635045256786 27.20908136220433 28.31924788718308 20.238035705355802 105-109 24.007119247393845 27.72438342232393 27.815916603101957 20.45258072718027 110-114 24.258676705688206 27.595276159042854 28.14707854159146 19.99896859367748 115-119 24.18778256755336 28.11481442540217 27.37356744821785 20.323835558826623 120-124 24.802453732584738 27.276980661260136 27.989186941152006 19.93137866500312 125-129 25.12055225623065 27.562052687680826 27.96812344551038 19.349271610578143 130-134 24.97623930768846 27.88754939722875 27.922565154319447 19.213646140763345 135-139 25.15 27.395000000000003 27.785 19.67 140-144 25.259999999999998 27.169999999999998 27.845 19.725 145-149 25.765 27.765 27.185 19.285 150-151 25.275 27.037499999999998 27.6375 20.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.0 25 1.5 26 1.5 27 3.0 28 4.5 29 9.5 30 14.5 31 23.0 32 28.0 33 32.0 34 45.5 35 63.5 36 82.0 37 105.5 38 137.5 39 153.0 40 183.5 41 242.0 42 269.5 43 262.0 44 276.5 45 293.5 46 283.5 47 263.5 48 239.0 49 211.0 50 180.5 51 151.0 52 113.0 53 84.0 54 67.0 55 46.5 56 32.5 57 27.5 58 23.5 59 15.0 60 6.0 61 5.0 62 5.0 63 2.5 64 1.5 65 1.0 66 0.5 67 0.5 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.18 75-79 0.075 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 1.675 110-114 3.045 115-119 4.89 120-124 3.82 125-129 1.4949999999999999 130-134 0.045 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.975 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.675 0.0 0.0 0.0 0.0 110-111 3.075 0.0 0.0 0.0 0.0 112-113 3.625 0.0 0.0 0.0 0.0 114-115 4.0125 0.0 0.0 0.0 0.0 116-117 4.4875 0.0 0.0 0.0 0.0 118-119 5.025 0.0 0.0 0.0 0.0 120-121 5.4 0.0 0.0 0.0 0.0 122-123 5.9375 0.0 0.0 0.0 0.0 124-125 6.487500000000001 0.0 0.0 0.0 0.0 126-127 7.0125 0.0 0.0 0.0 0.0 128-129 7.5625 0.0 0.0 0.0 0.0 130-131 7.9875 0.0 0.0 0.0 0.0 132-133 8.4125 0.0 0.0 0.0 0.0 134-135 9.037500000000001 0.0 0.0 0.0 0.0 136-137 9.7625 0.0 0.0 0.0 0.0 138-139 10.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871837 spots for SRR7169799.sra Written 871837 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra Read 871832 spots for SRR7169799.sra Written 871832 spots for SRR7169799.sra SRR ids: ['SRR7169799.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u9r8hqlx SRR7169799.sra spots: 17436645 blocks: [[1, 871832], [871833, 1743664], [1743665, 2615496], [2615497, 3487328], [3487329, 4359160], [4359161, 5230992], [5230993, 6102824], [6102825, 6974656], [6974657, 7846488], [7846489, 8718320], [8718321, 9590152], [9590153, 10461984], [10461985, 11333816], [11333817, 12205648], [12205649, 13077480], [13077481, 13949312], [13949313, 14821144], [14821145, 15692976], [15692977, 16564808], [16564809, 17436645]] SRR7169799 file size 5887006 SRR7169799 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169799 SRR7169799_1.fastq SRR7169799_2.fastq Input file: SRR7169799_1.fastq Paired file: SRR7169799_2.fastq trimmed: SRR7169799-trimmed-pair1.fastq, SRR7169799-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:47:50 2025 >> started Tue Feb 11 18:48:10 2025 >> done (19.507s) 17436645 read pairs processed; of these: 17294 ( 0.10%) short read pairs filtered out after trimming by size control 20803 ( 0.12%) empty read pairs filtered out after trimming by size control 17398548 (99.78%) read pairs available; of these: 8785231 (50.49%) trimmed read pairs available after processing 8613317 (49.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 3 0.00% 21 4 0.00% 22 3 0.00% 23 3 0.00% 24 5 0.00% 25 5 0.00% 26 8 0.00% 27 5 0.00% 28 5 0.00% 29 4 0.00% 30 4 0.00% 31 7 0.00% 32 11 0.00% 33 15 0.00% 34 13 0.00% 35 17 0.00% 36 24 0.00% 37 15 0.00% 38 22 0.00% 39 28 0.00% 40 36 0.00% 41 46 0.00% 42 49 0.00% 43 64 0.00% 44 64 0.00% 45 72 0.00% 46 81 0.00% 47 100 0.00% 48 112 0.00% 49 127 0.00% 50 146 0.00% 51 152 0.00% 52 176 0.00% 53 219 0.00% 54 243 0.00% 55 244 0.00% 56 269 0.00% 57 320 0.00% 58 393 0.00% 59 448 0.00% 60 556 0.00% 61 602 0.00% 62 750 0.00% 63 841 0.00% 64 894 0.01% 65 1017 0.01% 66 1108 0.01% 67 1150 0.01% 68 1351 0.01% 69 1594 0.01% 70 1796 0.01% 71 2052 0.01% 72 2345 0.01% 73 2700 0.02% 74 3123 0.02% 75 3527 0.02% 76 4114 0.02% 77 4242 0.02% 78 4421 0.03% 79 5093 0.03% 80 5446 0.03% 81 6231 0.04% 82 7065 0.04% 83 8092 0.05% 84 9639 0.06% 85 10732 0.06% 86 11350 0.07% 87 12205 0.07% 88 13043 0.07% 89 13781 0.08% 90 14825 0.09% 91 15863 0.09% 92 17214 0.10% 93 18707 0.11% 94 20175 0.12% 95 21655 0.12% 96 22504 0.13% 97 23035 0.13% 98 23974 0.14% 99 25013 0.14% 100 26418 0.15% 101 27444 0.16% 102 30013 0.17% 103 31449 0.18% 104 32791 0.19% 105 34193 0.20% 106 35809 0.21% 107 36486 0.21% 108 37687 0.22% 109 38119 0.22% 110 39151 0.23% 111 40491 0.23% 112 42556 0.24% 113 43853 0.25% 114 46343 0.27% 115 48177 0.28% 116 48977 0.28% 117 49596 0.29% 118 50607 0.29% 119 50760 0.29% 120 51835 0.30% 121 53486 0.31% 122 55146 0.32% 123 56858 0.33% 124 59255 0.34% 125 62220 0.36% 126 64199 0.37% 127 65186 0.37% 128 65869 0.38% 129 67418 0.39% 130 67960 0.39% 131 69382 0.40% 132 71814 0.41% 133 74335 0.43% 134 76894 0.44% 135 79852 0.46% 136 83079 0.48% 137 85841 0.49% 138 89770 0.52% 139 93543 0.54% 140 97340 0.56% 141 104573 0.60% 142 113330 0.65% 143 125052 0.72% 144 143549 0.83% 145 168680 0.97% 146 211096 1.21% 147 277784 1.60% 148 401608 2.31% 149 792919 4.56% 150 3817050 21.94% 151 8613317 49.51% 17398548 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=39 prefix-density=0.25 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=15 fanout-score=30.59 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=10.7 sequence=TTCTCATCAAGGT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=41 prefix-density=0.25 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=43 fanout-score=45.39 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=6.6 sequence=CTCTTCTTTTCTCCCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTGGATGAAGTGAG SRR7169799 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:48:51 Started mapping on | Feb 11 18:48:51 Finished on | Feb 11 18:50:10 Mapping speed, Million of reads per hour | 792.85 Number of input reads | 17398548 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16672480 Uniquely mapped reads % | 95.83% Average mapped length | 290.24 Number of splices: Total | 14383437 Number of splices: Annotated (sjdb) | 14137689 Number of splices: GT/AG | 14188434 Number of splices: GC/AG | 151760 Number of splices: AT/AC | 11934 Number of splices: Non-canonical | 31309 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 273559 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 70911 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 468002 468002 468002 N_multimapping 273559 273559 273559 N_noFeature 417484 16444417 500032 N_ambiguous 212136 982 65968 UnstrandedReadsAssigned:16042860 PositiveStrandReadsAssigned:227081 NegativeStrandReadsAssigned:16106480 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169799 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169799-trimmed-pair1.fastq SRR7169799-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,398,548 reads, 16,045,407 reads pseudoaligned [quant] estimated average fragment length: 213.105 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52401 SRR7169799.ke.tsv 34699 SRR7169799.se.tsv 87100 total ==> SRR7169799.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.9 300 10.9978 Potri.005G024800.1.v4.1 1035 822.895 38 3.05715 Potri.004G059700.1.v4.1 961 748.901 2 0.1768 Potri.007G009000.2.v4.1 1416 1203.9 0 0 Potri.003G141000.2.v4.1 2943 2730.9 229.078 5.55337 Potri.016G087400.1.v4.1 270 91.663 1477 1066.75 Potri.015G069301.1.v4.1 564 353.656 0 0 Potri.010G195200.1.v4.1 1773 1560.9 15 0.636202 Potri.012G127500.1.v4.1 977 764.901 2159 186.864 ==> SRR7169799.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1826 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 38 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169799 completed mapping pipeline successfully