Starting /dee2/code/volunteer_pipeline.sh SRR7169800 current disk space = 3053456740352 free memory = 1151206856 SRR7169800 SRAfilesize f0d4cfd8da6d8ee1eac8759d8f632901 SRR7169800.sra SRR7169800.sra file validated SRR7169800 is paired end SRR7169800 is conventional basespace SRR7169800 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169800_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.58825 32.0 30.0 33.0 18.0 33.0 2 32.15225 33.0 33.0 33.0 30.0 33.0 3 32.5825 33.0 33.0 33.0 31.0 34.0 4 32.98525 33.0 33.0 34.0 32.0 34.0 5 33.339 34.0 33.0 34.0 33.0 34.0 6 37.16525 38.0 38.0 38.0 36.0 38.0 7 37.3695 38.0 38.0 38.0 37.0 38.0 8 37.5045 38.0 38.0 38.0 37.0 38.0 9 37.61775 38.0 38.0 38.0 38.0 38.0 10-14 37.6086 38.0 38.0 38.0 38.0 38.0 15-19 37.59835 38.0 38.0 38.0 38.0 38.0 20-24 37.55915 38.0 38.0 38.0 38.0 38.0 25-29 37.55135 38.0 38.0 38.0 38.0 38.0 30-34 37.5931 38.0 38.0 38.0 38.0 38.0 35-39 37.4865 38.0 38.0 38.0 37.8 38.0 40-44 37.4484 38.0 38.0 38.0 37.8 38.0 45-49 37.40665 38.0 38.0 38.0 37.2 38.0 50-54 37.2972 38.0 38.0 38.0 36.8 38.0 55-59 37.168150000000004 38.0 38.0 38.0 36.4 38.0 60-64 36.977050000000006 38.0 38.0 38.0 35.8 38.0 65-69 37.157599999999995 38.0 38.0 38.0 36.6 38.0 70-74 37.195750000000004 38.0 38.0 38.0 36.8 38.0 75-79 37.0345 38.0 38.0 38.0 36.0 38.0 80-84 37.1113 38.0 38.0 38.0 36.2 38.0 85-89 37.0464 38.0 38.0 38.0 36.0 38.0 90-94 36.8566 38.0 38.0 38.0 35.4 38.0 95-99 36.9079 38.0 38.0 38.0 35.8 38.0 100-104 36.883300000000006 38.0 38.0 38.0 35.8 38.0 105-109 36.80685 38.0 38.0 38.0 35.4 38.0 110-114 36.60585 38.0 38.0 38.0 34.6 38.0 115-119 36.410199999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.288700000000006 38.0 38.0 38.0 34.0 38.0 125-129 36.198350000000005 38.0 38.0 38.0 33.8 38.0 130-134 35.967 38.0 37.2 38.0 33.0 38.0 135-139 35.7095 38.0 36.4 38.0 32.2 38.0 140-144 35.5269 38.0 36.0 38.0 31.4 38.0 145-149 35.08065 38.0 36.0 38.0 30.4 38.0 150-151 30.692375 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 6.0 20 3.0 21 3.0 22 5.0 23 2.0 24 5.0 25 4.0 26 12.0 27 13.0 28 13.0 29 21.0 30 33.0 31 59.0 32 58.0 33 99.0 34 117.0 35 196.0 36 528.0 37 2817.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.225 12.975 8.85 35.949999999999996 2 22.17217217217217 15.965965965965967 33.233233233233236 28.628628628628626 3 19.925 21.575 25.4 33.1 4 21.7 30.775000000000002 22.1 25.424999999999997 5 23.375 34.599999999999994 22.400000000000002 19.625 6 20.1 35.075 24.65 20.175 7 13.425 27.975 40.525 18.075 8 17.974999999999998 25.7 30.5 25.825 9 16.325 25.4 34.575 23.7 10-14 19.91 29.9 27.35 22.84 15-19 19.78 29.29 27.445000000000004 23.485 20-24 19.59 29.04 27.474999999999998 23.895 25-29 19.84 29.235 27.584999999999997 23.34 30-34 19.82 29.049999999999997 27.96 23.169999999999998 35-39 19.225 29.79 26.72 24.265 40-44 20.355 28.720000000000002 27.715 23.21 45-49 20.119999999999997 28.660000000000004 27.715 23.505000000000003 50-54 20.560000000000002 28.655 27.155 23.630000000000003 55-59 19.900000000000002 29.354999999999997 27.765 22.98 60-64 19.89 28.92 27.55 23.64 65-69 20.94 28.1 27.35 23.61 70-74 20.044999999999998 29.459999999999997 27.41 23.085 75-79 20.175 28.99 27.200000000000003 23.635 80-84 19.875 29.455 26.82 23.849999999999998 85-89 20.0 28.794999999999998 27.625 23.580000000000002 90-94 20.23 28.355000000000004 27.389999999999997 24.025 95-99 20.044999999999998 29.49 27.055 23.41 100-104 20.25 28.660000000000004 27.400000000000002 23.69 105-109 20.41 28.59 27.175 23.825 110-114 20.510382787090318 28.636477358018514 27.420565424068048 23.432574430823117 115-119 20.625 29.104999999999997 26.88 23.39 120-124 20.855 28.815 26.545 23.785 125-129 20.78 27.76 26.91 24.55 130-134 20.685000000000002 28.205000000000002 26.950000000000003 24.16 135-139 21.065 28.144999999999996 26.645000000000003 24.145 140-144 20.845 28.29 26.115 24.75 145-149 20.995 27.97 25.845000000000002 25.19 150-151 20.4125 28.15 26.674999999999997 24.762500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 2.0 26 4.0 27 7.0 28 11.5 29 19.0 30 25.0 31 28.0 32 30.0 33 42.5 34 60.5 35 85.0 36 102.0 37 111.5 38 128.5 39 147.5 40 189.5 41 227.0 42 250.0 43 255.0 44 257.5 45 262.5 46 252.0 47 252.5 48 242.5 49 199.5 50 162.0 51 145.5 52 124.0 53 96.5 54 68.5 55 55.0 56 41.5 57 28.0 58 25.5 59 14.5 60 7.5 61 7.0 62 4.5 63 3.5 64 3.0 65 2.5 66 2.0 67 2.0 68 2.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.075 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.5874999999999999 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.7875000000000001 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 1.2375 0.0 0.0 0.0 0.0 90-91 1.45 0.0 0.0 0.0 0.0 92-93 1.725 0.0 0.0 0.0 0.0 94-95 1.925 0.0 0.0 0.0 0.0 96-97 2.2 0.0 0.0 0.0 0.0 98-99 2.4749999999999996 0.0 0.0 0.0 0.0 100-101 2.8875 0.0 0.0 0.0 0.0 102-103 3.3 0.0 0.0 0.0 0.0 104-105 3.725 0.0 0.0 0.0 0.0 106-107 4.262499999999999 0.0 0.0 0.0 0.0 108-109 4.762499999999999 0.0 0.0 0.0 0.0 110-111 5.4625 0.0 0.0 0.0 0.0 112-113 5.9375 0.0 0.0 0.0 0.0 114-115 6.449999999999999 0.0 0.0 0.0 0.0 116-117 7.1625 0.0 0.0 0.0 0.0 118-119 7.625 0.0 0.0 0.0 0.0 120-121 8.3125 0.0 0.0 0.0 0.0 122-123 8.7875 0.0 0.0 0.0 0.0 124-125 9.55 0.0 0.0 0.0 0.0 126-127 10.162500000000001 0.0 0.0 0.0 0.0 128-129 11.0 0.0 0.0 0.0 0.0 130-131 11.8875 0.0 0.0 0.0 0.0 132-133 12.675 0.0 0.0 0.0 0.0 134-135 13.4375 0.0 0.0 0.0 0.0 136-137 14.5875 0.0 0.0 0.0 0.0 138-139 15.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTTTC 10 0.006830828 145.0 5 TTAGCTT 10 0.006830828 145.0 8 AATTGAA 10 0.006830828 145.0 5 >>END_MODULE SRR7169800 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169800_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.072 33.0 33.0 34.0 32.0 34.0 2 33.15025 34.0 33.0 34.0 33.0 34.0 3 33.136 34.0 33.0 34.0 33.0 34.0 4 33.0275 34.0 33.0 34.0 33.0 34.0 5 33.11275 34.0 33.0 34.0 33.0 34.0 6 37.30675 38.0 38.0 38.0 37.0 38.0 7 37.36525 38.0 38.0 38.0 38.0 38.0 8 37.329 38.0 38.0 38.0 38.0 38.0 9 37.31775 38.0 38.0 38.0 37.0 38.0 10-14 37.2958 38.0 38.0 38.0 37.8 38.0 15-19 37.1707 38.0 38.0 38.0 37.0 38.0 20-24 37.25765 38.0 38.0 38.0 37.4 38.0 25-29 37.19315 38.0 38.0 38.0 37.0 38.0 30-34 37.133050000000004 38.0 38.0 38.0 36.8 38.0 35-39 37.158150000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.21820000000001 38.0 38.0 38.0 37.4 38.0 45-49 37.175349999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.064350000000005 38.0 38.0 38.0 37.0 38.0 55-59 36.86065 38.0 38.0 38.0 36.2 38.0 60-64 36.7482 38.0 38.0 38.0 35.6 38.0 65-69 37.037850000000006 38.0 38.0 38.0 36.8 38.0 70-74 37.00125 38.0 38.0 38.0 36.6 38.0 75-79 35.93145 38.0 38.0 38.0 34.4 38.0 80-84 36.6069 38.0 38.0 38.0 35.2 38.0 85-89 36.56255 38.0 37.8 38.0 34.4 38.0 90-94 36.690749999999994 38.0 38.0 38.0 35.4 38.0 95-99 36.754000000000005 38.0 38.0 38.0 36.0 38.0 100-104 36.538250000000005 38.0 38.0 38.0 35.2 38.0 105-109 34.91325 38.0 37.0 38.0 26.8 38.0 110-114 34.3101 38.0 37.0 38.0 24.6 38.0 115-119 33.657799999999995 38.0 36.8 38.0 15.8 38.0 120-124 33.80795 38.0 36.8 38.0 19.4 38.0 125-129 34.24455 38.0 36.2 38.0 23.8 38.0 130-134 34.90345 38.0 35.8 38.0 28.0 38.0 135-139 34.669 38.0 35.8 38.0 26.4 38.0 140-144 34.821600000000004 38.0 35.8 38.0 29.4 38.0 145-149 33.2586 38.0 33.4 38.0 21.0 38.0 150-151 30.23025 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 1.0 5 2.0 6 2.0 7 1.0 8 1.0 9 0.0 10 2.0 11 0.0 12 4.0 13 2.0 14 4.0 15 2.0 16 6.0 17 3.0 18 1.0 19 1.0 20 5.0 21 10.0 22 9.0 23 8.0 24 21.0 25 17.0 26 11.0 27 25.0 28 40.0 29 54.0 30 56.0 31 80.0 32 91.0 33 122.0 34 141.0 35 213.0 36 521.0 37 2532.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.65 19.85 14.825 24.675 2 27.463731865932967 25.78789394697349 29.214607303651825 17.53376688344172 3 20.96168294515402 27.848735286751815 31.204608064112193 19.984973703981968 4 25.331996993234778 33.19969932347783 23.37759959909797 18.090704084189426 5 24.94994994994995 35.08508508508508 22.24724724724725 17.71771771771772 6 21.425 37.175000000000004 23.474999999999998 17.925 7 20.625 20.200000000000003 40.050000000000004 19.125 8 21.45 25.650000000000002 26.474999999999998 26.424999999999997 9 22.400000000000002 24.075 30.775000000000002 22.75 10-14 24.03 28.555000000000003 26.35 21.065 15-19 23.3370011003301 27.8333500050015 27.89336801040312 20.93628088426528 20-24 23.39 27.839999999999996 27.894999999999996 20.875 25-29 22.994999999999997 28.355000000000004 27.744999999999997 20.905 30-34 22.985 28.050000000000004 27.975 20.990000000000002 35-39 22.67 28.244999999999997 28.565 20.52 40-44 23.215 28.13 27.91 20.745 45-49 23.367336733673366 27.47274727472747 28.587858785878588 20.572057205720572 50-54 23.65010258719912 28.078867036981435 27.41830555972577 20.85272481609368 55-59 23.42702810843253 28.008402520756228 27.95838751625488 20.606181854556365 60-64 23.296164808240412 27.78138906945347 28.146407320366016 20.776038801940096 65-69 23.165 27.395000000000003 28.565 20.875 70-74 23.874167209337273 27.711265841807343 28.13204428192155 20.28252266693383 75-79 23.302912223133713 27.99938474159147 28.101927809680067 20.59577522559475 80-84 23.814785054238648 28.16894335074327 27.78726396143029 20.229007633587788 85-89 23.625 27.985 28.095 20.294999999999998 90-94 23.971198559928 27.86639331966598 28.131406570328515 20.031001550077505 95-99 24.10482096419284 27.560512102420482 28.135627125425085 20.19903980796159 100-104 24.235600260221187 28.27403292798879 27.688535254966723 19.8018315568233 105-109 24.700437130367703 27.930059141167398 27.683209051169968 19.686294677294935 110-114 24.500503471302135 27.590227357040646 27.950606815411522 19.958662356245693 115-119 25.185506147429994 27.758219140984675 27.341168824134755 19.715105887450576 120-124 25.14822926125741 27.316916831365845 27.76561081138828 19.76924309598846 125-129 25.221839440442633 28.1866583150642 26.975675957824407 19.615826286668756 130-134 26.019232695582488 27.63197435640589 27.47170189321847 18.877091054793148 135-139 25.955000000000002 28.189999999999998 26.87 18.985 140-144 26.400000000000002 27.389999999999997 27.060000000000002 19.15 145-149 26.424999999999997 27.98 26.815 18.78 150-151 26.41057934508816 27.808564231738035 27.70780856423174 18.073047858942065 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 2.5 26 2.5 27 2.0 28 5.5 29 8.0 30 9.5 31 15.0 32 25.5 33 34.0 34 41.5 35 66.0 36 97.0 37 113.0 38 136.5 39 162.5 40 185.0 41 232.0 42 271.0 43 274.5 44 278.5 45 290.0 46 274.5 47 264.0 48 239.5 49 207.0 50 185.5 51 147.5 52 112.5 53 74.5 54 52.5 55 50.0 56 38.0 57 22.0 58 17.0 59 18.5 60 15.5 61 7.0 62 4.0 63 4.0 64 1.5 65 1.5 66 2.0 67 1.5 68 2.5 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.05 3 0.17500000000000002 4 0.22499999999999998 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.03 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.08499999999999999 55-59 0.03 60-64 0.005 65-69 0.0 70-74 0.185 75-79 2.48 80-84 0.44 85-89 0.0 90-94 0.005 95-99 0.02 100-104 0.08499999999999999 105-109 2.775 110-114 5.655 115-119 7.6850000000000005 120-124 6.3950000000000005 125-129 4.21 130-134 0.16999999999999998 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.6125 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.7875000000000001 0.0 0.0 0.0 0.0 86-87 0.9249999999999999 0.0 0.0 0.0 0.0 88-89 1.2125 0.0 0.0 0.0 0.0 90-91 1.45 0.0 0.0 0.0 0.0 92-93 1.725 0.0 0.0 0.0 0.0 94-95 1.925 0.0 0.0 0.0 0.0 96-97 2.2 0.0 0.0 0.0 0.0 98-99 2.45 0.0 0.0 0.0 0.0 100-101 2.8375 0.0 0.0 0.0 0.0 102-103 3.225 0.0 0.0 0.0 0.0 104-105 3.5875 0.0 0.0 0.0 0.0 106-107 4.0875 0.0 0.0 0.0 0.0 108-109 4.575 0.0 0.0 0.0 0.0 110-111 5.2125 0.0 0.0 0.0 0.0 112-113 5.6375 0.0 0.0 0.0 0.0 114-115 6.025 0.0 0.0 0.0 0.0 116-117 6.6 0.0 0.0 0.0 0.0 118-119 7.0125 0.0 0.0 0.0 0.0 120-121 7.6625 0.0 0.0 0.0 0.0 122-123 8.125 0.0 0.0 0.0 0.0 124-125 8.85 0.0 0.0 0.0 0.0 126-127 9.462499999999999 0.0 0.0 0.0 0.0 128-129 10.2625 0.0 0.0 0.0 0.0 130-131 11.125 0.0 0.0 0.0 0.0 132-133 11.8875 0.0 0.0 0.0 0.0 134-135 12.587499999999999 0.0 0.0 0.0 0.0 136-137 13.600000000000001 0.0 0.0 0.0 0.0 138-139 14.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 45 2.6815214E-5 22.337778 135-139 >>END_MODULE Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra Read 704253 spots for SRR7169800.sra Written 704253 spots for SRR7169800.sra Read 704239 spots for SRR7169800.sra Written 704239 spots for SRR7169800.sra SRR ids: ['SRR7169800.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_asqz27xa SRR7169800.sra spots: 14084794 blocks: [[1, 704239], [704240, 1408478], [1408479, 2112717], [2112718, 2816956], [2816957, 3521195], [3521196, 4225434], [4225435, 4929673], [4929674, 5633912], [5633913, 6338151], [6338152, 7042390], [7042391, 7746629], [7746630, 8450868], [8450869, 9155107], [9155108, 9859346], [9859347, 10563585], [10563586, 11267824], [11267825, 11972063], [11972064, 12676302], [12676303, 13380541], [13380542, 14084794]] SRR7169800 file size 4751174 SRR7169800 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169800 SRR7169800_1.fastq SRR7169800_2.fastq Input file: SRR7169800_1.fastq Paired file: SRR7169800_2.fastq trimmed: SRR7169800-trimmed-pair1.fastq, SRR7169800-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:35:25 2025 >> started Tue Feb 11 18:35:40 2025 >> done (15.591s) 14084794 read pairs processed; of these: 11653 ( 0.08%) short read pairs filtered out after trimming by size control 24246 ( 0.17%) empty read pairs filtered out after trimming by size control 14048895 (99.75%) read pairs available; of these: 6780844 (48.27%) trimmed read pairs available after processing 7268051 (51.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 5 0.00% 21 5 0.00% 22 4 0.00% 23 8 0.00% 24 4 0.00% 25 6 0.00% 26 3 0.00% 27 6 0.00% 28 10 0.00% 29 7 0.00% 30 16 0.00% 31 20 0.00% 32 10 0.00% 33 19 0.00% 34 17 0.00% 35 22 0.00% 36 28 0.00% 37 26 0.00% 38 21 0.00% 39 38 0.00% 40 49 0.00% 41 65 0.00% 42 78 0.00% 43 83 0.00% 44 93 0.00% 45 102 0.00% 46 111 0.00% 47 145 0.00% 48 166 0.00% 49 207 0.00% 50 226 0.00% 51 292 0.00% 52 305 0.00% 53 353 0.00% 54 369 0.00% 55 418 0.00% 56 434 0.00% 57 528 0.00% 58 629 0.00% 59 719 0.01% 60 843 0.01% 61 989 0.01% 62 1144 0.01% 63 1300 0.01% 64 1379 0.01% 65 1523 0.01% 66 1811 0.01% 67 1935 0.01% 68 2083 0.01% 69 2436 0.02% 70 2781 0.02% 71 3153 0.02% 72 3712 0.03% 73 4250 0.03% 74 4695 0.03% 75 5284 0.04% 76 5958 0.04% 77 6410 0.05% 78 6605 0.05% 79 7197 0.05% 80 8073 0.06% 81 8950 0.06% 82 10081 0.07% 83 11149 0.08% 84 12725 0.09% 85 14085 0.10% 86 14651 0.10% 87 15478 0.11% 88 16347 0.12% 89 16916 0.12% 90 18315 0.13% 91 19199 0.14% 92 20773 0.15% 93 22431 0.16% 94 23986 0.17% 95 24932 0.18% 96 25900 0.18% 97 26484 0.19% 98 27271 0.19% 99 27684 0.20% 100 28969 0.21% 101 29925 0.21% 102 31350 0.22% 103 33276 0.24% 104 34257 0.24% 105 36190 0.26% 106 37369 0.27% 107 37203 0.26% 108 37848 0.27% 109 38351 0.27% 110 39078 0.28% 111 40238 0.29% 112 41306 0.29% 113 42873 0.31% 114 44727 0.32% 115 46127 0.33% 116 47651 0.34% 117 48102 0.34% 118 48379 0.34% 119 48167 0.34% 120 48711 0.35% 121 49486 0.35% 122 50657 0.36% 123 52202 0.37% 124 54115 0.39% 125 55407 0.39% 126 57474 0.41% 127 58628 0.42% 128 58540 0.42% 129 58755 0.42% 130 59994 0.43% 131 59921 0.43% 132 61270 0.44% 133 63046 0.45% 134 64526 0.46% 135 66620 0.47% 136 68862 0.49% 137 71285 0.51% 138 72941 0.52% 139 75046 0.53% 140 78062 0.56% 141 81456 0.58% 142 84992 0.60% 143 91770 0.65% 144 100980 0.72% 145 113531 0.81% 146 132215 0.94% 147 167603 1.19% 148 243134 1.73% 149 516299 3.68% 150 2735360 19.47% 151 7268051 51.73% 14048895 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=36 prefix-density=0.20 prefix-fanout=2.4 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.15 sequence-density-rank=4 fanout-score=58.98 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=13.4 sequence=CCACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=7.46 fanout-score-rank=13 prefix-density=0.29 prefix-fanout=5.1 sequence=TCAATGCTGTTG criterion=fanout-score sequence-density=0.15 sequence-density-rank=11 fanout-score=37.70 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=11.3 sequence=TGTTGGTGGTGG SRR7169800 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:36:23 Started mapping on | Feb 11 18:36:24 Finished on | Feb 11 18:37:44 Mapping speed, Million of reads per hour | 632.20 Number of input reads | 14048895 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 13432073 Uniquely mapped reads % | 95.61% Average mapped length | 287.94 Number of splices: Total | 11512746 Number of splices: Annotated (sjdb) | 11318512 Number of splices: GT/AG | 11352914 Number of splices: GC/AG | 125649 Number of splices: AT/AC | 9416 Number of splices: Non-canonical | 24767 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223579 % of reads mapped to multiple loci | 1.59% Number of reads mapped to too many loci | 27351 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.56% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 403555 403555 403555 N_multimapping 223579 223579 223579 N_noFeature 351783 13212820 465803 N_ambiguous 154549 1011 48507 UnstrandedReadsAssigned:12925741 PositiveStrandReadsAssigned:218242 NegativeStrandReadsAssigned:12917763 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169800 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169800-trimmed-pair1.fastq SRR7169800-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,048,895 reads, 12,832,339 reads pseudoaligned [quant] estimated average fragment length: 208.978 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7169800.ke.tsv 34699 SRR7169800.se.tsv 87100 total ==> SRR7169800.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.02 256 12.0498 Potri.005G024800.1.v4.1 1035 827.022 29 2.98747 Potri.004G059700.1.v4.1 961 753.032 4 0.452553 Potri.007G009000.2.v4.1 1416 1208.02 0 0 Potri.003G141000.2.v4.1 2943 2735.02 213.25 6.64278 Potri.016G087400.1.v4.1 270 97.6323 1033 901.425 Potri.015G069301.1.v4.1 564 358.615 0 0 Potri.010G195200.1.v4.1 1773 1565.02 20 1.08876 Potri.012G127500.1.v4.1 977 769.027 3016 334.128 ==> SRR7169800.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1382 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 286 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169800 completed mapping pipeline successfully