Starting /dee2/code/volunteer_pipeline.sh SRR7169801 current disk space = 3053464047616 free memory = 1509416072 SRR7169801 SRAfilesize 43ceec05fcd6927619e101e27347dc98 SRR7169801.sra SRR7169801.sra file validated SRR7169801 is paired end SRR7169801 is conventional basespace SRR7169801 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169801_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.429 18.0 18.0 25.0 18.0 32.0 2 26.58325 27.0 25.0 29.0 18.0 31.0 3 26.97775 28.0 25.0 31.0 18.0 33.0 4 30.80525 32.0 32.0 33.0 27.0 33.0 5 31.51025 33.0 32.0 33.0 28.0 33.0 6 36.162 37.0 36.0 38.0 33.0 38.0 7 37.024 38.0 37.0 38.0 35.0 38.0 8 37.13275 38.0 38.0 38.0 36.0 38.0 9 37.35275 38.0 38.0 38.0 36.0 38.0 10-14 37.45155 38.0 38.0 38.0 37.0 38.0 15-19 37.5851 38.0 38.0 38.0 37.8 38.0 20-24 37.58915 38.0 38.0 38.0 38.0 38.0 25-29 37.589 38.0 38.0 38.0 38.0 38.0 30-34 37.61385 38.0 38.0 38.0 38.0 38.0 35-39 37.51325 38.0 38.0 38.0 38.0 38.0 40-44 37.49425 38.0 38.0 38.0 37.8 38.0 45-49 37.453900000000004 38.0 38.0 38.0 37.4 38.0 50-54 37.32695 38.0 38.0 38.0 36.8 38.0 55-59 37.16224999999999 38.0 38.0 38.0 36.6 38.0 60-64 37.004949999999994 38.0 38.0 38.0 35.8 38.0 65-69 37.177800000000005 38.0 38.0 38.0 36.4 38.0 70-74 37.215599999999995 38.0 38.0 38.0 36.6 38.0 75-79 37.10445 38.0 38.0 38.0 36.0 38.0 80-84 37.18489999999999 38.0 38.0 38.0 36.0 38.0 85-89 37.10825 38.0 38.0 38.0 36.0 38.0 90-94 36.874550000000006 38.0 38.0 38.0 35.6 38.0 95-99 37.01675 38.0 38.0 38.0 36.0 38.0 100-104 36.977999999999994 38.0 38.0 38.0 35.8 38.0 105-109 36.833749999999995 38.0 38.0 38.0 35.2 38.0 110-114 36.697050000000004 38.0 38.0 38.0 35.0 38.0 115-119 36.5312 38.0 38.0 38.0 34.4 38.0 120-124 36.465050000000005 38.0 38.0 38.0 34.2 38.0 125-129 36.2847 38.0 38.0 38.0 34.0 38.0 130-134 36.03645 38.0 37.4 38.0 33.2 38.0 135-139 35.749 38.0 36.2 38.0 32.4 38.0 140-144 35.643899999999995 38.0 36.0 38.0 31.6 38.0 145-149 35.186899999999994 38.0 35.8 38.0 30.8 38.0 150-151 30.656750000000002 36.5 29.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 4.0 19 2.0 20 1.0 21 1.0 22 3.0 23 2.0 24 3.0 25 8.0 26 7.0 27 18.0 28 17.0 29 23.0 30 29.0 31 40.0 32 54.0 33 79.0 34 143.0 35 261.0 36 734.0 37 2565.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.400000000000006 15.775 9.925 33.900000000000006 2 22.566925193895422 15.936952714535902 32.49937453089817 28.996747560670507 3 20.45 22.25 25.424999999999997 31.874999999999996 4 23.0 29.25 22.0 25.75 5 22.575 33.324999999999996 24.3 19.8 6 19.775000000000002 36.3 23.925 20.0 7 14.05 25.124999999999996 41.9 18.925 8 18.375 26.025 29.95 25.650000000000002 9 18.425 24.125 32.800000000000004 24.65 10-14 20.25 29.65 26.924999999999997 23.175 15-19 19.814999999999998 28.96 27.765 23.46 20-24 19.655 29.86 27.165 23.32 25-29 20.165 29.315 27.169999999999998 23.35 30-34 20.13 28.939999999999998 27.575 23.355 35-39 20.36 28.92 27.05 23.669999999999998 40-44 20.76 28.555000000000003 27.605 23.080000000000002 45-49 19.845 28.849999999999998 27.325 23.98 50-54 20.474999999999998 28.83 27.279999999999998 23.415 55-59 19.99 29.095 27.49 23.425 60-64 19.96 29.25 27.229999999999997 23.56 65-69 19.965 28.499999999999996 28.255000000000003 23.28 70-74 20.22 28.665000000000003 27.284999999999997 23.830000000000002 75-79 20.505000000000003 29.335 26.93 23.23 80-84 20.455000000000002 29.235 26.87 23.44 85-89 20.305 28.945 27.639999999999997 23.11 90-94 20.369999999999997 29.225 26.795 23.61 95-99 20.585 28.22 27.834999999999997 23.36 100-104 20.985 28.54 26.68 23.794999999999998 105-109 21.044999999999998 28.435 26.605 23.915 110-114 20.617216025608965 28.715050267593657 27.104486570299606 23.563247136497775 115-119 20.595 28.33 26.875 24.2 120-124 20.599999999999998 28.685 26.815 23.9 125-129 21.385 28.73 26.22 23.665 130-134 21.095 29.45 25.715 23.74 135-139 21.12 28.65 25.85 24.38 140-144 21.2 28.435 26.02 24.345 145-149 20.735 29.154999999999998 25.64 24.47 150-151 20.9875 28.487499999999997 25.624999999999996 24.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 2.5 26 3.0 27 5.5 28 8.5 29 9.0 30 14.0 31 23.0 32 35.5 33 40.0 34 45.0 35 64.5 36 98.5 37 124.5 38 144.5 39 167.0 40 195.0 41 226.5 42 248.5 43 264.0 44 268.0 45 279.5 46 278.5 47 252.5 48 218.0 49 182.0 50 162.0 51 145.5 52 120.5 53 100.0 54 81.0 55 58.5 56 35.5 57 25.5 58 17.0 59 9.5 60 9.5 61 7.0 62 5.5 63 4.0 64 2.5 65 2.5 66 2.5 67 2.0 68 2.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.034999999999999996 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 1.0625 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.6 0.0 0.0 0.0 0.0 96-97 1.725 0.0 0.0 0.0 0.0 98-99 1.95 0.0 0.0 0.0 0.0 100-101 2.1875 0.0 0.0 0.0 0.0 102-103 2.4875 0.0 0.0 0.0 0.0 104-105 2.8875 0.0 0.0 0.0 0.0 106-107 3.175 0.0 0.0 0.0 0.0 108-109 3.4625 0.0 0.0 0.0 0.0 110-111 3.7249999999999996 0.0 0.0 0.0 0.0 112-113 4.050000000000001 0.0 0.0 0.0 0.0 114-115 4.3875 0.0 0.0 0.0 0.0 116-117 4.8625 0.0 0.0 0.0 0.0 118-119 5.2875 0.0 0.0 0.0 0.0 120-121 6.05 0.0 0.0 0.0 0.0 122-123 6.65 0.0 0.0 0.0 0.0 124-125 7.3625 0.0 0.0 0.0 0.0 126-127 7.9375 0.0 0.0 0.0 0.0 128-129 8.7375 0.0 0.0 0.0 0.0 130-131 9.3625 0.0 0.0 0.0 0.0 132-133 10.0 0.0 0.0 0.0 0.0 134-135 10.5625 0.0 0.0 0.0 0.0 136-137 11.2625 0.0 0.0 0.0 0.0 138-139 12.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169801 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169801_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9465 33.0 33.0 34.0 32.0 34.0 2 33.026 34.0 33.0 34.0 32.0 34.0 3 33.07475 34.0 33.0 34.0 33.0 34.0 4 32.97875 34.0 33.0 34.0 33.0 34.0 5 32.975 34.0 33.0 34.0 33.0 34.0 6 37.18625 38.0 38.0 38.0 37.0 38.0 7 37.2355 38.0 38.0 38.0 37.0 38.0 8 37.21275 38.0 38.0 38.0 37.0 38.0 9 37.1565 38.0 38.0 38.0 37.0 38.0 10-14 37.21365 38.0 38.0 38.0 37.0 38.0 15-19 37.02475 38.0 38.0 38.0 36.8 38.0 20-24 37.1274 38.0 38.0 38.0 37.0 38.0 25-29 37.0915 38.0 38.0 38.0 37.0 38.0 30-34 36.939800000000005 38.0 38.0 38.0 36.4 38.0 35-39 37.04045000000001 38.0 38.0 38.0 36.8 38.0 40-44 37.09485 38.0 38.0 38.0 37.0 38.0 45-49 37.039049999999996 38.0 38.0 38.0 37.0 38.0 50-54 36.8949 38.0 38.0 38.0 36.6 38.0 55-59 36.69525 38.0 38.0 38.0 35.8 38.0 60-64 36.57365 38.0 38.0 38.0 35.0 38.0 65-69 36.8285 38.0 38.0 38.0 36.0 38.0 70-74 36.81945 38.0 38.0 38.0 36.0 38.0 75-79 35.78725 38.0 38.0 38.0 33.4 38.0 80-84 36.461850000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.40325 38.0 37.8 38.0 34.2 38.0 90-94 36.46855 38.0 38.0 38.0 34.8 38.0 95-99 36.527499999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.3212 38.0 38.0 38.0 34.6 38.0 105-109 34.8044 38.0 36.8 38.0 27.0 38.0 110-114 34.156 38.0 37.0 38.0 22.2 38.0 115-119 33.418 38.0 36.6 38.0 14.6 38.0 120-124 33.60360000000001 38.0 36.2 38.0 17.4 38.0 125-129 34.08185000000001 38.0 36.0 38.0 20.0 38.0 130-134 34.77795 38.0 35.8 38.0 26.6 38.0 135-139 34.41085 38.0 35.0 38.0 25.6 38.0 140-144 34.58605 38.0 35.8 38.0 27.8 38.0 145-149 33.07115 38.0 33.2 38.0 20.8 38.0 150-151 30.1415 35.5 28.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 5.0 4 1.0 5 0.0 6 3.0 7 3.0 8 3.0 9 0.0 10 1.0 11 0.0 12 2.0 13 2.0 14 3.0 15 2.0 16 2.0 17 2.0 18 8.0 19 3.0 20 10.0 21 8.0 22 10.0 23 20.0 24 16.0 25 16.0 26 18.0 27 17.0 28 26.0 29 65.0 30 72.0 31 85.0 32 96.0 33 108.0 34 137.0 35 262.0 36 528.0 37 2451.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.925 20.05 16.650000000000002 23.375 2 25.725725725725724 25.45045045045045 30.305305305305307 18.51851851851852 3 22.42242242242242 28.22822822822823 30.605605605605607 18.743743743743742 4 23.69146005509642 35.48710242925119 21.838216879539193 18.9832206361132 5 24.8998998998999 35.08508508508508 21.796796796796798 18.21821821821822 6 21.25 37.1 23.025000000000002 18.625 7 21.025 20.825 38.525 19.625 8 22.900000000000002 23.95 27.975 25.174999999999997 9 22.025 24.4 29.575000000000003 24.0 10-14 23.685000000000002 28.189999999999998 26.655 21.47 15-19 23.06922769107643 27.32092837134854 28.376350540216087 21.233493397358945 20-24 23.24 27.85 28.065 20.845 25-29 22.905 27.534999999999997 28.225 21.335 30-34 22.71113555677784 27.94139706985349 28.41142057102855 20.936046802340115 35-39 23.175 28.18 27.994999999999997 20.65 40-44 23.265 27.915 28.199999999999996 20.62 45-49 23.455863965991497 27.366841710427607 28.617154288572145 20.560140035008754 50-54 23.35835835835836 26.901901901901905 28.863863863863866 20.875875875875877 55-59 23.120404181881845 27.61742784252914 28.4828172677705 20.77935070781852 60-64 23.17347602140321 27.56413462019303 28.32924938740811 20.933139970995647 65-69 23.380000000000003 27.365000000000002 28.804999999999996 20.45 70-74 23.426940982129448 27.9821795064324 28.252490363918508 20.33838914751965 75-79 23.57365808729468 27.708130788517625 28.01514608811339 20.703065036074296 80-84 23.60650798433263 27.166817314452146 28.25148136989053 20.975193331324697 85-89 23.585 27.88 28.125 20.41 90-94 23.523528529279393 27.509126368955343 28.454268140221036 20.513076961544233 95-99 24.16966786714686 26.800720288115247 28.51640656262505 20.513205282112846 100-104 24.352176088044022 27.018509254627315 27.85892946473237 20.770385192596297 105-109 23.221338804821748 27.786611951782508 28.874070274429343 20.1179789689664 110-114 24.5288013553579 27.41952562473528 27.70012706480305 20.35154595510377 115-119 24.4874715261959 27.48671222475323 27.62230176808764 20.403514480963228 120-124 24.19501254872644 27.87953222619747 27.50040049126929 20.425054733806803 125-129 25.00651075576853 27.444137715506017 27.24621074014272 20.303140788582738 130-134 24.921167225586867 27.328695129886384 27.77916812653286 19.970969517993893 135-139 25.14 27.455000000000002 27.46 19.945 140-144 25.480000000000004 27.05 27.46 20.01 145-149 25.751287564378217 27.29136456822841 27.486374318715935 19.470973548677435 150-151 26.436203645505973 27.479572595851664 26.926461345065995 19.157762413576368 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 3.0 26 3.5 27 4.5 28 6.5 29 8.0 30 11.5 31 15.0 32 19.5 33 33.5 34 45.0 35 62.0 36 80.0 37 106.0 38 137.5 39 168.0 40 210.5 41 232.0 42 245.0 43 269.0 44 279.5 45 269.0 46 270.0 47 269.0 48 241.5 49 198.5 50 164.0 51 145.5 52 128.5 53 100.5 54 78.5 55 63.5 56 43.5 57 24.0 58 14.5 59 15.0 60 9.0 61 6.0 62 6.0 63 3.0 64 1.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.17500000000000002 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.04 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.025 50-54 0.1 55-59 0.045 60-64 0.015 65-69 0.0 70-74 0.11499999999999999 75-79 2.2849999999999997 80-84 0.43 85-89 0.0 90-94 0.015 95-99 0.04 100-104 0.05 105-109 2.5250000000000004 110-114 5.56 115-119 7.8100000000000005 120-124 6.365 125-129 4.005 130-134 0.105 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.5625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 1.0375 0.0 0.0 0.0 0.0 92-93 1.2374999999999998 0.0 0.0 0.0 0.0 94-95 1.55 0.0 0.0 0.0 0.0 96-97 1.675 0.0 0.0 0.0 0.0 98-99 1.9 0.0 0.0 0.0 0.0 100-101 2.1125 0.0 0.0 0.0 0.0 102-103 2.3625 0.0 0.0 0.0 0.0 104-105 2.75 0.0 0.0 0.0 0.0 106-107 3.0250000000000004 0.0 0.0 0.0 0.0 108-109 3.3125 0.0 0.0 0.0 0.0 110-111 3.575 0.0 0.0 0.0 0.0 112-113 3.8875 0.0 0.0 0.0 0.0 114-115 4.2 0.0 0.0 0.0 0.0 116-117 4.6875 0.0 0.0 0.0 0.0 118-119 5.074999999999999 0.0 0.0 0.0 0.0 120-121 5.775 0.0 0.0 0.0 0.0 122-123 6.35 0.0 0.0 0.0 0.0 124-125 7.0875 0.0 0.0 0.0 0.0 126-127 7.574999999999999 0.0 0.0 0.0 0.0 128-129 8.2875 0.0 0.0 0.0 0.0 130-131 8.9125 0.0 0.0 0.0 0.0 132-133 9.575 0.0 0.0 0.0 0.0 134-135 10.162500000000001 0.0 0.0 0.0 0.0 136-137 10.8 0.0 0.0 0.0 0.0 138-139 11.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTACAC 10 0.0068957224 144.51898 145 >>END_MODULE Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717215 spots for SRR7169801.sra Written 717215 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra Read 717212 spots for SRR7169801.sra Written 717212 spots for SRR7169801.sra SRR ids: ['SRR7169801.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pk2olp2y SRR7169801.sra spots: 14344243 blocks: [[1, 717212], [717213, 1434424], [1434425, 2151636], [2151637, 2868848], [2868849, 3586060], [3586061, 4303272], [4303273, 5020484], [5020485, 5737696], [5737697, 6454908], [6454909, 7172120], [7172121, 7889332], [7889333, 8606544], [8606545, 9323756], [9323757, 10040968], [10040969, 10758180], [10758181, 11475392], [11475393, 12192604], [12192605, 12909816], [12909817, 13627028], [13627029, 14344243]] SRR7169801 file size 4839092 SRR7169801 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169801 SRR7169801_1.fastq SRR7169801_2.fastq Input file: SRR7169801_1.fastq Paired file: SRR7169801_2.fastq trimmed: SRR7169801-trimmed-pair1.fastq, SRR7169801-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:18:13 2025 >> started Tue Feb 11 19:18:28 2025 >> done (14.628s) 14344243 read pairs processed; of these: 22641 ( 0.16%) short read pairs filtered out after trimming by size control 37745 ( 0.26%) empty read pairs filtered out after trimming by size control 14283857 (99.58%) read pairs available; of these: 6856008 (48.00%) trimmed read pairs available after processing 7427849 (52.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 6 0.00% 20 6 0.00% 21 4 0.00% 22 5 0.00% 23 5 0.00% 24 6 0.00% 25 7 0.00% 26 9 0.00% 27 4 0.00% 28 10 0.00% 29 7 0.00% 30 14 0.00% 31 13 0.00% 32 14 0.00% 33 12 0.00% 34 25 0.00% 35 30 0.00% 36 20 0.00% 37 31 0.00% 38 44 0.00% 39 52 0.00% 40 54 0.00% 41 62 0.00% 42 69 0.00% 43 85 0.00% 44 70 0.00% 45 89 0.00% 46 107 0.00% 47 107 0.00% 48 155 0.00% 49 174 0.00% 50 177 0.00% 51 242 0.00% 52 244 0.00% 53 262 0.00% 54 286 0.00% 55 338 0.00% 56 364 0.00% 57 403 0.00% 58 432 0.00% 59 575 0.00% 60 628 0.00% 61 727 0.01% 62 760 0.01% 63 934 0.01% 64 994 0.01% 65 1060 0.01% 66 1146 0.01% 67 1308 0.01% 68 1479 0.01% 69 1690 0.01% 70 1922 0.01% 71 2183 0.02% 72 2489 0.02% 73 2804 0.02% 74 3218 0.02% 75 3530 0.02% 76 4560 0.03% 77 4770 0.03% 78 4323 0.03% 79 4833 0.03% 80 5395 0.04% 81 6043 0.04% 82 6838 0.05% 83 7730 0.05% 84 9320 0.07% 85 10646 0.07% 86 11240 0.08% 87 11523 0.08% 88 12571 0.09% 89 12709 0.09% 90 13880 0.10% 91 14897 0.10% 92 15934 0.11% 93 17531 0.12% 94 18627 0.13% 95 19503 0.14% 96 20604 0.14% 97 21231 0.15% 98 22237 0.16% 99 22544 0.16% 100 23940 0.17% 101 25006 0.18% 102 27067 0.19% 103 28507 0.20% 104 29707 0.21% 105 31348 0.22% 106 32520 0.23% 107 32844 0.23% 108 33062 0.23% 109 34106 0.24% 110 35331 0.25% 111 36329 0.25% 112 37870 0.27% 113 39506 0.28% 114 41454 0.29% 115 42856 0.30% 116 43436 0.30% 117 44889 0.31% 118 44925 0.31% 119 45176 0.32% 120 45723 0.32% 121 46451 0.33% 122 48680 0.34% 123 50015 0.35% 124 52464 0.37% 125 54184 0.38% 126 56066 0.39% 127 56845 0.40% 128 57147 0.40% 129 58325 0.41% 130 58532 0.41% 131 59215 0.41% 132 61273 0.43% 133 62975 0.44% 134 64556 0.45% 135 66787 0.47% 136 69095 0.48% 137 71420 0.50% 138 73586 0.52% 139 75962 0.53% 140 79362 0.56% 141 83185 0.58% 142 88218 0.62% 143 95595 0.67% 144 106070 0.74% 145 120742 0.85% 146 142677 1.00% 147 182075 1.27% 148 267032 1.87% 149 569774 3.99% 150 2891118 20.24% 151 7427849 52.00% 14283857 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=38 prefix-density=0.25 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=76.78 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.0 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=40 prefix-density=0.26 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=38.45 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=11.3 sequence=GAGAAGGCATACCATGAGCAGCTCTC SRR7169801 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:19:09 Started mapping on | Feb 11 19:19:10 Finished on | Feb 11 19:20:13 Mapping speed, Million of reads per hour | 816.22 Number of input reads | 14283857 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13658347 Uniquely mapped reads % | 95.62% Average mapped length | 289.45 Number of splices: Total | 11700810 Number of splices: Annotated (sjdb) | 11499104 Number of splices: GT/AG | 11544859 Number of splices: GC/AG | 122694 Number of splices: AT/AC | 9687 Number of splices: Non-canonical | 23570 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 210323 % of reads mapped to multiple loci | 1.47% Number of reads mapped to too many loci | 24760 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 433630 433630 433630 N_multimapping 210323 210323 210323 N_noFeature 362165 13462220 429680 N_ambiguous 185122 791 55940 UnstrandedReadsAssigned:13111060 PositiveStrandReadsAssigned:195336 NegativeStrandReadsAssigned:13172727 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169801 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169801-trimmed-pair1.fastq SRR7169801-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,283,857 reads, 13,066,134 reads pseudoaligned [quant] estimated average fragment length: 213.738 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR7169801.ke.tsv 34699 SRR7169801.se.tsv 87100 total ==> SRR7169801.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.26 254 12.1073 Potri.005G024800.1.v4.1 1035 822.262 17 1.77906 Potri.004G059700.1.v4.1 961 748.279 3 0.344993 Potri.007G009000.2.v4.1 1416 1203.26 0 0 Potri.003G141000.2.v4.1 2943 2730.26 249.036 7.84894 Potri.016G087400.1.v4.1 270 94.5071 1103.62 1004.86 Potri.015G069301.1.v4.1 564 354.378 0 0 Potri.010G195200.1.v4.1 1773 1560.26 12 0.661815 Potri.012G127500.1.v4.1 977 764.262 2746 309.18 ==> SRR7169801.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1418 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 186 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169801 completed mapping pipeline successfully