Starting /dee2/code/volunteer_pipeline.sh SRR7169802 current disk space = 3053449596928 free memory = 1426561788 SRR7169802 SRAfilesize e3a414a20a627d8536f0dbd1f88cc486 SRR7169802.sra SRR7169802.sra file validated SRR7169802 is paired end SRR7169802 is conventional basespace SRR7169802 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169802_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.05775 18.0 18.0 18.0 18.0 32.0 2 26.922 27.0 27.0 29.0 25.0 30.0 3 28.65475 29.0 27.0 31.0 25.0 33.0 4 31.39875 33.0 31.0 33.0 29.0 33.0 5 32.236 33.0 32.0 33.0 32.0 33.0 6 36.7555 38.0 37.0 38.0 35.0 38.0 7 37.387 38.0 38.0 38.0 37.0 38.0 8 37.40525 38.0 38.0 38.0 37.0 38.0 9 37.52075 38.0 38.0 38.0 37.0 38.0 10-14 37.67385 38.0 38.0 38.0 38.0 38.0 15-19 37.6999 38.0 38.0 38.0 38.0 38.0 20-24 37.74025 38.0 38.0 38.0 38.0 38.0 25-29 37.75345 38.0 38.0 38.0 38.0 38.0 30-34 37.71985 38.0 38.0 38.0 38.0 38.0 35-39 37.72285 38.0 38.0 38.0 38.0 38.0 40-44 37.65175000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.66785 38.0 38.0 38.0 38.0 38.0 50-54 37.54885 38.0 38.0 38.0 38.0 38.0 55-59 37.60485 38.0 38.0 38.0 38.0 38.0 60-64 37.4932 38.0 38.0 38.0 38.0 38.0 65-69 37.4722 38.0 38.0 38.0 37.4 38.0 70-74 37.495450000000005 38.0 38.0 38.0 37.8 38.0 75-79 37.44584999999999 38.0 38.0 38.0 37.4 38.0 80-84 37.378299999999996 38.0 38.0 38.0 37.0 38.0 85-89 37.2325 38.0 38.0 38.0 37.0 38.0 90-94 37.1275 38.0 38.0 38.0 36.4 38.0 95-99 37.19345 38.0 38.0 38.0 36.8 38.0 100-104 37.05495 38.0 38.0 38.0 36.2 38.0 105-109 36.43665 38.0 38.0 38.0 35.2 38.0 110-114 36.455499999999994 38.0 38.0 38.0 35.0 38.0 115-119 36.79365 38.0 38.0 38.0 35.0 38.0 120-124 36.7415 38.0 38.0 38.0 35.0 38.0 125-129 36.573049999999995 38.0 38.0 38.0 34.6 38.0 130-134 36.343450000000004 38.0 38.0 38.0 34.0 38.0 135-139 36.1072 38.0 38.0 38.0 33.6 38.0 140-144 35.78825 38.0 36.4 38.0 32.6 38.0 145-149 35.6428 38.0 36.4 38.0 32.6 38.0 150-151 32.301500000000004 36.5 32.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 3.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 5.0 20 2.0 21 3.0 22 2.0 23 3.0 24 2.0 25 5.0 26 4.0 27 6.0 28 8.0 29 19.0 30 22.0 31 18.0 32 33.0 33 69.0 34 123.0 35 202.0 36 614.0 37 2851.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.08195072900955 20.83961789844143 9.95475113122172 36.1236802413273 2 22.925 15.8 32.875 28.4 3 20.025000000000002 22.05 23.925 34.0 4 22.125 29.525000000000002 20.75 27.6 5 22.25 32.824999999999996 24.075 20.849999999999998 6 19.35 36.1 24.3 20.25 7 14.325 27.325 40.550000000000004 17.8 8 18.3 26.674999999999997 29.525000000000002 25.5 9 17.05 25.275 33.45 24.224999999999998 10-14 19.575 30.135 27.29 23.0 15-19 19.615 28.970000000000002 27.22 24.195 20-24 19.62 29.015 27.595 23.77 25-29 19.965 29.445 27.065 23.525 30-34 19.970998549927497 29.121456072803642 27.1963598179909 23.711185559277965 35-39 19.885 29.615000000000002 26.945000000000004 23.555 40-44 20.1 29.255 26.945000000000004 23.7 45-49 20.21 28.96 27.32 23.51 50-54 19.925 29.220000000000002 27.389999999999997 23.465 55-59 19.98 28.915000000000003 26.889999999999997 24.215 60-64 19.679278376346783 29.27085943372588 27.551991981959407 23.497870207967928 65-69 20.19 28.82 27.534999999999997 23.455000000000002 70-74 20.51 28.965000000000003 26.87 23.655 75-79 19.61 28.955 27.055 24.38 80-84 19.88 29.005 27.63 23.485 85-89 20.415 28.494999999999997 27.195000000000004 23.895 90-94 20.565 29.225 26.924999999999997 23.285 95-99 20.035 29.470000000000002 27.005000000000003 23.49 100-104 20.515391557204453 29.038403689962898 26.942745412614055 23.50345934021859 105-109 20.20898853606574 28.695343410774072 26.60545805011667 24.490210003043522 110-114 20.58793715154587 28.80892042574759 27.688798783578306 22.914343639128234 115-119 20.595 28.705000000000002 26.83 23.87 120-124 21.365000000000002 28.134999999999998 27.245 23.255 125-129 21.41 28.244999999999997 26.729999999999997 23.615 130-134 21.575 28.410000000000004 26.555 23.46 135-139 20.705000000000002 28.74 26.384999999999998 24.169999999999998 140-144 21.38 28.305000000000003 26.415 23.9 145-149 20.8 28.449999999999996 26.305 24.445 150-151 21.65 27.8625 25.912499999999998 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 2.5 25 3.5 26 5.0 27 8.0 28 7.0 29 10.5 30 16.0 31 23.5 32 38.0 33 44.5 34 57.0 35 81.0 36 91.5 37 100.0 38 122.0 39 162.5 40 201.0 41 222.0 42 244.5 43 251.0 44 263.0 45 279.5 46 274.5 47 260.0 48 234.5 49 217.5 50 180.0 51 135.5 52 119.0 53 100.0 54 73.5 55 45.5 56 34.0 57 26.5 58 15.5 59 13.0 60 11.0 61 8.0 62 5.5 63 4.0 64 2.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.22499999999999998 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.27 105-109 1.43 110-114 1.35 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.5 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 3.0 0.0 0.0 0.0 0.0 110-111 3.2875 0.0 0.0 0.0 0.0 112-113 3.575 0.0 0.0 0.0 0.0 114-115 3.9125 0.0 0.0 0.0 0.0 116-117 4.5 0.0 0.0 0.0 0.0 118-119 5.1125 0.0 0.0 0.0 0.0 120-121 5.525 0.0 0.0 0.0 0.0 122-123 6.0 0.0 0.0 0.0 0.0 124-125 6.5625 0.0 0.0 0.0 0.0 126-127 7.262499999999999 0.0 0.0 0.0 0.0 128-129 7.887499999999999 0.0 0.0 0.0 0.0 130-131 8.8875 0.0 0.0 0.0 0.0 132-133 9.462499999999999 0.0 0.0 0.0 0.0 134-135 10.075 0.0 0.0 0.0 0.0 136-137 10.8125 0.0 0.0 0.0 0.0 138-139 11.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTGT 10 0.006899958 144.51251 6 TCATTTA 10 0.006899958 144.51251 2 CCTGGTC 10 0.006899958 144.51251 6 TTTTTTT 20 0.00603359 28.902502 20-24 >>END_MODULE SRR7169802 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169802_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2195 34.0 33.0 34.0 33.0 34.0 2 33.1895 34.0 33.0 34.0 33.0 34.0 3 33.3 34.0 33.0 34.0 33.0 34.0 4 33.21375 34.0 33.0 34.0 33.0 34.0 5 33.2805 34.0 33.0 34.0 33.0 34.0 6 37.481 38.0 38.0 38.0 38.0 38.0 7 37.46625 38.0 38.0 38.0 38.0 38.0 8 37.50675 38.0 38.0 38.0 38.0 38.0 9 37.5295 38.0 38.0 38.0 38.0 38.0 10-14 37.474900000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.46895 38.0 38.0 38.0 38.0 38.0 20-24 37.44675000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.4 38.0 38.0 38.0 38.0 38.0 30-34 37.35755 38.0 38.0 38.0 38.0 38.0 35-39 37.3668 38.0 38.0 38.0 38.0 38.0 40-44 37.326299999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.3421 38.0 38.0 38.0 37.8 38.0 50-54 37.265100000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.9733 38.0 38.0 38.0 36.6 38.0 60-64 36.2214 38.0 37.4 38.0 32.4 38.0 65-69 37.27745 38.0 38.0 38.0 37.4 38.0 70-74 36.8684 38.0 38.0 38.0 36.6 38.0 75-79 35.63535 38.0 38.0 38.0 34.4 38.0 80-84 36.45235 38.0 38.0 38.0 35.2 38.0 85-89 37.053599999999996 38.0 38.0 38.0 36.8 38.0 90-94 37.004999999999995 38.0 38.0 38.0 36.8 38.0 95-99 36.8942 38.0 38.0 38.0 36.2 38.0 100-104 36.5122 38.0 38.0 38.0 35.2 38.0 105-109 34.787349999999996 38.0 38.0 38.0 29.6 38.0 110-114 33.51369999999999 38.0 37.4 38.0 11.0 38.0 115-119 32.7288 38.0 36.4 38.0 2.0 38.0 120-124 32.8153 38.0 36.0 38.0 6.6 38.0 125-129 33.420750000000005 38.0 36.0 38.0 16.8 38.0 130-134 34.8913 38.0 36.0 38.0 26.6 38.0 135-139 35.317150000000005 38.0 36.4 38.0 31.4 38.0 140-144 34.47895 38.0 35.2 38.0 26.0 38.0 145-149 34.436099999999996 38.0 35.6 38.0 28.0 38.0 150-151 30.448625 35.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 2.0 5 1.0 6 0.0 7 1.0 8 4.0 9 3.0 10 0.0 11 1.0 12 1.0 13 3.0 14 2.0 15 1.0 16 1.0 17 3.0 18 5.0 19 7.0 20 6.0 21 8.0 22 16.0 23 25.0 24 16.0 25 14.0 26 12.0 27 30.0 28 50.0 29 50.0 30 64.0 31 67.0 32 94.0 33 109.0 34 137.0 35 199.0 36 448.0 37 2613.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.09304652326163 19.084542271135568 16.03301650825413 28.789394697348676 2 25.946352469290552 25.921283529706695 31.336174479819505 16.796189521183255 3 21.925 26.75 30.275000000000002 21.05 4 25.387693846923458 32.84142071035518 24.062031015507753 17.70885442721361 5 26.325 34.075 22.525000000000002 17.075000000000003 6 21.275 36.9 22.8 19.025 7 19.8 21.025 39.0 20.175 8 22.400000000000002 25.174999999999997 26.474999999999998 25.95 9 21.725 24.0 30.575000000000003 23.7 10-14 24.15 28.475 26.529999999999998 20.845 15-19 23.0 27.965 27.85 21.185000000000002 20-24 23.005 28.175 27.655 21.165 25-29 23.724744948989798 28.085617123424683 27.340468093618725 20.849169833966794 30-34 23.275818954738682 28.16704176044011 27.68192048012003 20.875218804701177 35-39 23.556778389194598 28.274137068534266 27.41370685342671 20.755377688844423 40-44 23.239647929585917 28.000600120024004 27.885577115423082 20.874174834966993 45-49 23.78237823782378 26.927692769276927 28.232823282328233 21.057105710571054 50-54 22.875 27.85 28.499999999999996 20.775 55-59 23.84953981592637 28.056222488995598 27.696078431372552 20.39815926370548 60-64 23.215 27.334999999999997 28.804999999999996 20.645 65-69 23.365 27.365000000000002 28.544999999999998 20.724999999999998 70-74 23.436554367561023 27.471252773855152 28.28827920112972 20.803913657454103 75-79 23.699421965317917 27.042649586002188 28.7611310732698 20.496797375410093 80-84 23.777991204569577 27.30627306273063 28.70141030177425 20.21432543092554 85-89 23.412341234123414 27.917791779177918 28.15781578157816 20.512051205120514 90-94 23.49 28.255000000000003 27.685 20.57 95-99 23.53 27.334999999999997 28.365000000000002 20.77 100-104 24.261454983922828 27.069935691318324 28.160168810289388 20.508440514469452 105-109 23.702031602708804 27.885978266575673 27.770486639718623 20.6415034909969 110-114 24.380754055238928 27.14270056992547 28.233231039017976 20.243314335817626 115-119 24.9972057672963 27.29965351514474 27.769084609366267 19.934056108192692 120-124 24.224934036939313 27.616534740545294 28.028803869832892 20.129727352682497 125-129 24.448144368655676 28.26682421182663 27.55250013427144 19.732531285246253 130-134 25.47217452782547 27.926472073527925 27.370972629027374 19.23038076961923 135-139 25.1 27.57 27.794999999999998 19.535 140-144 25.05375806370956 26.8740311046657 28.119217882682403 19.95299294894234 145-149 26.06 26.355 27.939999999999998 19.645000000000003 150-151 26.280425963488845 26.622718052738335 28.156693711967545 18.940162271805274 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 2.5 28 3.0 29 3.0 30 11.5 31 18.0 32 20.0 33 32.5 34 46.0 35 57.5 36 77.0 37 102.0 38 128.5 39 160.0 40 206.0 41 240.0 42 270.0 43 303.5 44 300.0 45 281.5 46 268.5 47 251.5 48 243.5 49 209.5 50 169.0 51 145.0 52 115.0 53 85.0 54 61.0 55 54.5 56 45.5 57 32.5 58 19.5 59 9.5 60 6.0 61 4.5 62 3.5 63 2.0 64 2.0 65 2.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.27499999999999997 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.02 30-34 0.025 35-39 0.05 40-44 0.02 45-49 0.01 50-54 0.0 55-59 0.04 60-64 0.0 65-69 0.0 70-74 0.86 75-79 3.9849999999999994 80-84 1.085 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.48 105-109 4.755 110-114 8.76 115-119 10.530000000000001 120-124 9.04 125-129 6.905 130-134 0.9900000000000001 135-139 0.0 140-144 0.015 145-149 0.0 150-151 1.4000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.425 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.825 0.0 0.0 0.0 0.0 110-111 3.125 0.0 0.0 0.0 0.0 112-113 3.375 0.0 0.0 0.0 0.0 114-115 3.675 0.0 0.0 0.0 0.0 116-117 4.225 0.0 0.0 0.0 0.0 118-119 4.762499999999999 0.0 0.0 0.0 0.0 120-121 5.15 0.0 0.0 0.0 0.0 122-123 5.5625 0.0 0.0 0.0 0.0 124-125 6.074999999999999 0.0 0.0 0.0 0.0 126-127 6.775 0.0 0.0 0.0 0.0 128-129 7.375 0.0 0.0 0.0 0.0 130-131 8.3125 0.0 0.0 0.0 0.0 132-133 8.9 0.0 0.0 0.0 0.0 134-135 9.5125 0.0 0.0 0.0 0.0 136-137 10.2375 0.0 0.0 0.0 0.0 138-139 10.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGGTG 10 0.007391405 141.225 5 >>END_MODULE Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808142 spots for SRR7169802.sra Written 808142 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra Read 808133 spots for SRR7169802.sra Written 808133 spots for SRR7169802.sra SRR ids: ['SRR7169802.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zuf4hcr1 SRR7169802.sra spots: 16162669 blocks: [[1, 808133], [808134, 1616266], [1616267, 2424399], [2424400, 3232532], [3232533, 4040665], [4040666, 4848798], [4848799, 5656931], [5656932, 6465064], [6465065, 7273197], [7273198, 8081330], [8081331, 8889463], [8889464, 9697596], [9697597, 10505729], [10505730, 11313862], [11313863, 12121995], [12121996, 12930128], [12930129, 13738261], [13738262, 14546394], [14546395, 15354527], [15354528, 16162669]] SRR7169802 file size 5455297 SRR7169802 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169802 SRR7169802_1.fastq SRR7169802_2.fastq Input file: SRR7169802_1.fastq Paired file: SRR7169802_2.fastq trimmed: SRR7169802-trimmed-pair1.fastq, SRR7169802-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:30:09 2025 >> started Tue Feb 11 18:30:27 2025 >> done (17.969s) 16162669 read pairs processed; of these: 11693 ( 0.07%) short read pairs filtered out after trimming by size control 24782 ( 0.15%) empty read pairs filtered out after trimming by size control 16126194 (99.77%) read pairs available; of these: 7249381 (44.95%) trimmed read pairs available after processing 8876813 (55.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 3 0.00% 23 2 0.00% 24 7 0.00% 25 5 0.00% 26 4 0.00% 27 4 0.00% 28 6 0.00% 29 3 0.00% 30 12 0.00% 31 10 0.00% 32 13 0.00% 33 5 0.00% 34 11 0.00% 35 21 0.00% 36 13 0.00% 37 14 0.00% 38 23 0.00% 39 28 0.00% 40 25 0.00% 41 46 0.00% 42 36 0.00% 43 36 0.00% 44 58 0.00% 45 47 0.00% 46 51 0.00% 47 52 0.00% 48 69 0.00% 49 91 0.00% 50 111 0.00% 51 124 0.00% 52 121 0.00% 53 161 0.00% 54 168 0.00% 55 177 0.00% 56 236 0.00% 57 247 0.00% 58 274 0.00% 59 372 0.00% 60 369 0.00% 61 436 0.00% 62 567 0.00% 63 648 0.00% 64 712 0.00% 65 795 0.00% 66 832 0.01% 67 922 0.01% 68 1058 0.01% 69 1266 0.01% 70 1395 0.01% 71 1686 0.01% 72 1944 0.01% 73 2295 0.01% 74 2609 0.02% 75 2977 0.02% 76 3458 0.02% 77 3820 0.02% 78 3832 0.02% 79 4179 0.03% 80 4624 0.03% 81 5424 0.03% 82 6155 0.04% 83 6899 0.04% 84 8210 0.05% 85 9130 0.06% 86 10026 0.06% 87 10743 0.07% 88 11351 0.07% 89 11779 0.07% 90 12813 0.08% 91 13846 0.09% 92 15120 0.09% 93 16355 0.10% 94 18051 0.11% 95 18938 0.12% 96 19684 0.12% 97 20473 0.13% 98 21586 0.13% 99 21725 0.13% 100 23394 0.15% 101 24362 0.15% 102 26332 0.16% 103 27700 0.17% 104 29536 0.18% 105 31065 0.19% 106 32470 0.20% 107 33025 0.20% 108 33724 0.21% 109 34639 0.21% 110 35558 0.22% 111 36259 0.22% 112 37989 0.24% 113 39666 0.25% 114 41836 0.26% 115 43159 0.27% 116 44511 0.28% 117 45697 0.28% 118 46152 0.29% 119 45962 0.29% 120 47188 0.29% 121 48232 0.30% 122 49565 0.31% 123 51415 0.32% 124 53963 0.33% 125 55773 0.35% 126 57394 0.36% 127 58602 0.36% 128 59358 0.37% 129 60201 0.37% 130 60717 0.38% 131 61264 0.38% 132 62918 0.39% 133 65029 0.40% 134 67259 0.42% 135 69721 0.43% 136 72156 0.45% 137 74381 0.46% 138 76585 0.47% 139 79206 0.49% 140 82416 0.51% 141 86102 0.53% 142 92391 0.57% 143 97846 0.61% 144 110700 0.69% 145 122033 0.76% 146 144154 0.89% 147 184497 1.14% 148 269410 1.67% 149 551953 3.42% 150 3262495 20.23% 151 8876813 55.05% 16126194 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=32 fanout-score=21.04 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=6.2 sequence=ATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=41 prefix-density=0.25 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=59.89 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.7 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGT SRR7169802 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:31:08 Started mapping on | Feb 11 18:31:08 Finished on | Feb 11 18:32:40 Mapping speed, Million of reads per hour | 631.02 Number of input reads | 16126194 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15397111 Uniquely mapped reads % | 95.48% Average mapped length | 291.04 Number of splices: Total | 13677220 Number of splices: Annotated (sjdb) | 13451117 Number of splices: GT/AG | 13489293 Number of splices: GC/AG | 146792 Number of splices: AT/AC | 11108 Number of splices: Non-canonical | 30027 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 257570 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 14958 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.80% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 482443 482443 482443 N_multimapping 257570 257570 257570 N_noFeature 332436 15198845 406197 N_ambiguous 181474 693 56575 UnstrandedReadsAssigned:14883201 PositiveStrandReadsAssigned:197573 NegativeStrandReadsAssigned:14934339 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169802 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169802-trimmed-pair1.fastq SRR7169802-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,126,194 reads, 14,824,051 reads pseudoaligned [quant] estimated average fragment length: 214.454 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7169802.ke.tsv 34699 SRR7169802.se.tsv 87100 total ==> SRR7169802.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.55 233 8.74434 Potri.005G024800.1.v4.1 1035 821.546 23 1.89598 Potri.004G059700.1.v4.1 961 747.572 3 0.271774 Potri.007G009000.2.v4.1 1416 1202.55 0 0 Potri.003G141000.2.v4.1 2943 2729.55 254 6.30205 Potri.016G087400.1.v4.1 270 91.7455 1453.54 1072.95 Potri.015G069301.1.v4.1 564 353.128 0 0 Potri.010G195200.1.v4.1 1773 1559.55 18.7176 0.812815 Potri.012G127500.1.v4.1 977 763.559 4446 394.335 ==> SRR7169802.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1503 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 285 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7169802 completed mapping pipeline successfully